Anti Sense Therapy ( Lnp ) Essay

Anti Sense Therapy ( Lnp ) Essay
1)Abstract: Although Anti–sense Therapy has limitations related to targeted drug delivery, it is still considered as one of the promising technology for
treating most of the Rare and Inherited disorders, being categorized as precision medicine has advanced very much with recent advances in drug
delivery technologies like lipid nanoparticle (LNP) formulations, cell–targeting technologies. Anti–sense drugs are seen as most potential drugs for
treating debilitating conditions with more targeted approach. The journey of Anti–sense oligonucleotides from the state of highly potential drug
candidates to a sudden debacle with limitations in drug delivery and toxicity and the resume of these candidates with technological advancements will
be reviewed with a special focus on application of this technology for the treatment of Huntington's disease and spinal muscular atrophy. The most
recently accepted application of Nusinersen, an anti–sense oligonucleotide drug for spinal muscular atrophy by US FDA and EMA and many
candidates in late stage clinical trials proves the viability and glory of these candidates as potential drugs for treatment of rare diseases and conditions
that need more targeted approach.
2)Anti–Sense Therapy:
a)Definition: Anti–sense therapy involves the use of antisense DNA or RNA for the inhibition of transcription or translation of a specific gene or gene
product for therapeutic purposes. Anti–Sense oligonucleotides are small pieces of DNA or RNA that can
... Get more on HelpWriting.net ...

Crvical Cancer Essay
In Cytology the majority of the samples received are part of the NHS (National Health Service) cervical screening programme. This programme
facilitates the screening of cervical smears slides, looking for abnormal cells in a woman's cervix, that may go on to form cervical cancer. 99.7 % of
cervical cancers are caused by a sexually transmitted infection called Human Papilloma Virus (HPV). There are over a hundred different types of the
HPV virus and certain ones are counted as more 'high risk'. 80% of the population will have HPV at some point in their lives and in most cases their
immune system will get rid of it within a couple of years. Scientists still don't understand why some women are able to clear the infection, while in
others the ... Show more content on Helpwriting.net ...
The pot and the tube are then put into the output section ready to be transferred onto the Panther by a member of staff (Tomcat Instrument 2014).
Gloves are always worn as you are unable to touch the tube as you may transfer your DNA onto it and it may contaminate the test.
The second machine the Panther uses Real time TNA technology to identify pathogens like HPV by their unique genetic sequencing. For HPV
testing the Panther is testing for two of the hundred types of HPV, 16 and 18 as these are the two types that are counted as high risk (Cervical
screening 2016). They are present when the HPV is less likely to regress and also therefore more likely to cause cell abnormalities. The specific
oligonucleotide and the T7 primers hydrolyse in the Panther are specialised to only bind to HPV 16 and 18.
The Panther is loaded with the tray of the sample vials after they have been processed on the Tomcat. The Panther is a fully automated system and can
perform 275 tests per 8–hour shift and up to 750 tests in 16 hours. . There are three main steps starting with the capture of targeted sequences.
Stage one the DNA in the pathogens is first transcribed into RNA so that is can be used, as a single strand is needed. Then the pathogens are lysed to
expose the nucleic acids and a specific oligonucleotide hydrolyses to the

Contributions Of Nanotechnology
Mirkin has published on a variety of nanotechnology applications, including; anisotropic nanostructures, programmable nanostructure, dip–pen
nanolithography, and spherical nucleic acids. The general goal of his research is to develop analytical technique, bio–diagnostic, and biotherapies that
are assisted by nanoparticles. The primary focus of this report will be Professor
Mirkin's work on bio–therapeutics performed with spherical nucleic acids (SNA's).
A SNA can be defined as a nanoparticle bound with a dense oligonucleotide (a polymer of 13–25 nucleotides) shell. 5 The nanoparticle core (nanocore)
can be made from a variety of materials, such as, gold, silver, cadmium selenide, and ferroferric oxide. The nanocore material maintains its ... Show
more content on Helpwriting.net ...
They discovered that SNA's have a high propensity for cellular uptake and are highly stable in cellular environments. 5 SNA's biological applicability
lies in their oligonucleotide shell. Many diseases can be controlled via gene regulation (RNA interference therapeutics). To regulategene expression,
oligonucleotides can be introduced into a cell. Oligonucleotides can then bind complimentary sequence of RNA, inhibiting gene expression. However,
free RNA is not easily transported into the cell.
Furthermore, if RNA does enter a cell it is promptly degraded by nucleases. SNA's offer a solution to this problem. They are readily transported into
the cell via scavenger receptors and are immune to nuclease degradation. 3 This relationship is observed because of their dense oligonucleotide shells.
An example of a disease that can be treated with RNA interference therapeutics is glioblastoma.
Glioblastoma is a neurodegenerative disease that is primary side effect is the development of brain tumors. 6 Mirkin and co–worker's objective was to
develop a SNA that could simultaneously regulate oncogenes (genes that code for unregulated cell division) while being fluorescently active. Two
nanocore materials were utilized in this study: gold and gadolinium. The surfaces of these nanocores were functionalized with a sequence of nucleic
acids that was shown to down regulate the expression of
Bcl2L12–protein, a protein that's overexpression is an indicator of glioblastoma. This

Polymerase Chain Reaction Lab Report
Polymerase Chain Reaction (PCR) is a process that uses primers to amplify specific cloned or genomic DNA sequences with the help of a very
unique enzyme. In this experiment, PCR was used to amplify the cDNA inserts from three purified DNA plasmids, taking into consideration that the
cDNAs were all different in size, as predicted in the previous study, so there would be different sizedDNA bands on agarose gel as well. In PCR, a
primer and dNTPs are added along with a DNA template and the Taq DNA polymerase. The original template is melted (at 94oC), the primers anneal
(45–55oC) and the polymerase makes two new strands (72oC), doubling the amount of DNA present. This provides 2 new templates for the next
cycle. The DNA is again melted, primers anneal, and the Taq makes 4 new strands. The result is a dramatic amplification of the DNA that exists
between the primers. These cycles are repeated several times. The reaction is performed in a thermocycler, which is programmable heating block that
will cycle between melting, annealing ... Show more content on Helpwriting.net ...
This technique is essential to resolve the PCR products and analyze them. The DNA is determined in the gel by addition of ethidium bromide, which is
mutagenic, or non–mutagenic dyes such as GelRed. When these two bound to DNA fluoresce, meaning that they absorbe UV light. Therefore, DNA
images are available after gel is exposed to UV light from a UV transilluminator. Negatively charged DNA will move towards the positively charged
anode through the agarose gel, while the migration of DNA is dependent of molecular DNA size, agarose concentration, DNA conformation and
applied current. Plasmid DNA extracted from bacterial cells can exist in three different conformations of molecular size and will migrate at different
rates. The mobility of these forms will be influenced by agarose concentration and the strength of applied

How Mongersen Is Increase Anti Inflammatory Cell Signaling...
–1. Sketch how mongersen is expected to increases anti–inflammatory cell signaling. (10%) Since gut inflammation of Crohn's disease is characterized
by abnormal decreases in the activity of the immunosuppressive cytokine transforming growth factor (TGF)–ОІ1, which is induced by the increased
level of SMAD7 protein, because it would prevent TGF–ОІ1–associated and SMAD–associated signaling.[1] The formulation of Mongersen (formerly
GED–0301) contains a 21–base single–strand phosphorothioate oligonucleotide, which would hybridize to the human SMAD7 messenger RNA
(mRNA) complementary and then facilitate RNase H–mediated RNA degradation[1], thus it would reduce the translation product and help maintain the
level of SMAD7 protein in the normal range. –2. Find the structure of mongersen: ––what is the "backbone" of mongersen? (5%) Mongersen is a
21–base phosphorothioate oligonucleotide with the sequence 5вЂІ–GTC GCC CCT TCT CCC CGC AGC–3вЂІ.[1] The nonbonding oxygen in each
internucleotide linkage of phosphodiesters is replaced by a sulfur atom(shows as Fig1). Also, the cytosine residues at nucleotide positions 3 and 16 are
modified by 5–methylation.[1] Fig 1. The difference between phosphodiester linkage and phosphorothioate linkage. ––why might the developers have
chosen this backbone over other possibilities for antisense or siRNA molecules? (5%) The oligonucleotide antisense matches complementary to the
region 107–128 of the human Smad7 mRNA sequence, and its

Biological Processes Through Light Regulation Essay
Photolabile nucleobase protection has been used to achieve exquisite control over biological processes through light regulation, also referred as
photocaging. The concept was introduced by Engels (Engels and Schlaeger, 1977; Engels and Reidys, 1978) and independently by Hofmann (Kaplan et
al., 1978). Watson–Crick base pairing is blocked by caging groups, completely preventing oligonucleotide duplex formation. Duplex formation is
restored when irradiated by light at a specfic wavelength. Photolabile groups when introduced at specific locations render the molecule inactive;
however, upon irradiation with light at a particular wavelength, the molecules can be activated (See detailed review by Shao and Xing, 2010; Tang et
al. 2013; Liu and Deiters, 2014). Caging groups can also be introduced at phosphate, 2вЂІ–OH, and nucleobases (Tang et al., 2013); however,
nucleobase caging has been of particular interest.
Oligonucleotides containing NVOC protecting groups were used as the photocleavable protecting group at the N3 position of thymidine, and duplex
formation was achieved by photoradiation at 365 nm for 5 h (Iwase et al., 2003).
NPOM–caged dT (X) introduced by the Deiters group is of particular interest. Figure 2.1.39 shows the synthesis of NPOM–caged thymidine
phsophoramidite S.62 (Lusic et al. 2007) from nucleoside S.63 using reagent S.64, and DNA incorporating NPOM–caged thymdine was prepared by
standard phosphoramidite chemistry and irradiated at 365 nm to afford active

Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover therapeutic aptamers for VEGF165 and EGFR by high–fidelity pentamer condon set Dehui Kong, Department of Chemistry, University of
Georgia Introduction Aptamers are ssDNA or RNA oligonucleotides with very high affinity for their target. They bind to their target with high
selectivity and specificity because of their well–defined tertiary structures. Researchers speculate that aptamers have the potential to replace antibodies
as high–affinity reagents in medical diagnostics and therapy. SELEX (Systematic evolution of ligands by exponential enrichment) is often used in
evolve aptamers for various molecular targets[1]. The concept of using aptamers as therapeutic agents was first envisioned in the 1990s[2], with recent
advances enabling their translation into the clinic[3]. In 2005, the first aptamer therapeutic was approved by the FDA to treat the wet form of
age–related macular degeneration[4]. Aptamers have impressive advantages over antibodies[5]: (i) the in vitro selection process does not require the
use of animals or cell culture which enables toxic or non–immunogenic targets aptamer selection;(ii) their generation through in vitro selection enables
ready tuning of binding and specificity properties; (iii) their active structure can be reversibly formed by thermal denaturation and cooling; (iv) they
exhibit excellent chemical stability and shelf–life; (v) their chemical synthesis is predictable and scalable. Fig.1 Antibody/Aptamer– protein

A Short Note On The And Its Effects On Breast Cancer Tissue
3.1. MiR–206 was prominently downregulated in TNBC tissues and inversely correlated with VEGF Quantitative RT–PCR results show that
expression levels of miR–206 are obviously lower in TNBC cell lines than those in non–TNBC cell lines (Fig. 1A). Similarly, TNBC tissues express
prominently lower levels of miR–206 compared to non–TNBC tissue samples and normal breast tissues (Fig. 1B). It is worth noting that non–TNBC
tissues expressed lower miR–206 compared to normal breast tissues but miR–206 levels in non–TNBC tissues were higher than those in TNBC tissues
(Fig. 1B). Furthermore, we analyzed the expression levels of VEGF protein determined by immunohistochemical staining in breast cancer tissue
samples. VEGF expression levels were inversely correlated with those of miR–206 in breast cancer tissues (Fig. 1C). These results demonstrate that
expression levels of miR–206 are predominantly downregulated in TNBC tissues in comparison to non–TNBC tissues and normal breast tissue
samples inversely correlated with the levels of VEGF.
3.2. MiR–206 mimics predominantly inhibit the invasion of TNBC cells in vitro
To investigate whether miR–206 mimics block the invasion of TNBC cells, miR–206 mimics or control oligonucleotides were transfected into TNBC
MDA–MB–231 and non–TNBC MCF–7 cells. The invasive cells from treated groups were determined and compared to their controls by Matrigel
invasion assay. Fig 2A shows representatives of invasive cell photographs from

Optimization of Asymmetric PCR for Generation of a Single...
Aptamers are short DNA or RNA oligonucleotides with high, specific affinity to a special target. The name was originated from aptus that means "to
fit" and meros that shows the polymer identity of oligonucleotides (1, 2). Aptamer characteristics provide prominent potential applications in multiple
fields.These nucleic acid ligands are completely generated through in vitro process for a wide range of targets from small molecules and ions to large
proteins and cells and even whole organism or tissue. Their chemical modifications could be easily performed to improve the intended specificity.
Meanwhile, they keep their stability against various conditional stresses and show lower toxicity and immunogenicity than other specific ligands e.g.
monoclonal antibodies. Because of the high specificity, adaptability, and ease of modification, aptamers have been used in a broad range of
applications, including affinity purification, drug discovery, high–throughput screening, drug delivery, medical diagnostics and biosensors (3–5).
In molecular biology, there are several methods that could help researchers for in vitro evolution of single stranded oligonucleotide pools to high
affinity ligands like aptamers. In vitro evolution is the experimental process in which large random–sequence pools of RNA or DNA are used as the
starting point and particular nucleic acid sequences with higher affinity to an intended target are identified as aptamers. This type of selection and
evolution is termed

Lab Report
RESULTS
Airway epithelial cell PPARОі knockdown aggravates AAD induced lung resistance and inflammatory cell infiltration.
Previously we have shown that PPAR gamma activation in lung .......
To test whether airway epithelial cell PPARОі knockdown exaggerates AAD induced airway remodeling and inflammation, we have developed airway
epithelial cell specific PPARОі knockout mice (AEC–PPARОі–/–) and produced AAD with OVA sensitization and challenge as described previously
(PMID: 22617759 and PMID: 23913958).
To determine airway epithelial cell specific PPARОі knockdown resulted in pulmonary resistance, we obtained respiratory resistance (R) measurements
both at baseline and in response to increasing doses of inhaled methacholine. The AEC–PPARОі–/– mice ... Show more content on Helpwriting.net ...
Histological examination of lung sections from AEC–PPARОі–/– mice showed focal bronchiolar epithelial cell hyperplasia and sub epithelial fibrosis
(Fig. 2A, red arrow head). This epithelial cell' hyperplastic change was often accompanied by goblet cell hyperplasia. To investigate the changes in
goblet cell hyperplasia, we have stained the lung sections with periodic acid Schiff (PAS) stain. We have observed the goblet cell hyperplasia and
airways with PAS positive cells in both mice groups with AAD. Airways containing goblet cells and mucus plugs were profuse in AEC
–PPARОі–/–
mice than those of AEC–PPARОі+/+ mice (Fig. 2B).
Airway epithelial cell PPARОі regulates inflammatory cytokines
Figure 3
Airway epithelial cell PPARОі regulates inflammatory gene expression
Figure 4
The Muc5AC promoter contains a novel PPREs responsive to PPARОі
The possibility of Muc5AC regulation by PPARОі at the level of gene expression might be an important event of PPARОі in epithelial cells along with
its anti–inflammatory activities. To investigate the basis for Muc5AC repression by PPARОі, we analyzed the MUC5AC promoter for the presence of
putative PPARОі transcription factor binding elements that may mediate this response. As shown in schematic representation, our analysis identified a
novel PPARОі response elements (PPRE) between –3834 and –3821 bp (PPRE1: TGTTCAGAGGTCAA) and between –1207 and –1194 bp (PPRE2:
AGGACAAAGGGCC) in the MUC5AC

Western Blotting Of Camkii Е’Г And T 287
Western blotting of CaMKIIОІ and T–287 phosphorylated CaMKIIОІ Western blotting was performed as described previously (Chapter 3). In short,
Proteins were extracted from OLs using RIPA buffer with protease and phosphatase inhibitors. The concentration of extracted proteins was assessed
using the BCA assay. Target proteins were probed with primary antibodies for CaMKIIО
І (1:1000, Life Technologies) and phosphor–CaMKIIОІ (T287)
(1:1000, Abcam) at 4В°C overnight. Membranes were incubated with appropriate IRDye secondary antibodies (1:3000, Li–COR, Lincoln, NE) for 1 h
at room temperature, and imaged using an Odyssey Imager (Li–COR). Protein bands were quantified using Li–COR image studio software. RT–PCR
analysis of CaMKII transcription RNAs were extracted from OLs or cerebral cortex of P2 ICR mice using the miRNAeasy Mini Kit (QIAGEN Inc.
Valencia, CA). Concentration of RNAs from each sample was determined using NanoDrop ND–1000 spectrophotometer (Thermo Scientific). Equal
amount of RNAs were then used as template to transcribe cDNA using a High capacity cDNA reverse transcription kit (Life Technologies).
Gene–specific primer pairs were designed using NCBI Gene database and primer design web tool (http://www.ncbi.nlm.nih.gov). The web tool
generates a series of primer sets that fit the parameters defined by users. These parameters include size of the final product and the primers, whether
primers span the junctions between exons, GC contents of the primer etc. For each isoform

Origin Of Replication Is The Starting Point Of Dna...
BME–603 Exam 2 – Tao Xu (Nov–9–2016)
Origin of replication is the starting point of DNA replication. It cannot replicate in the host cells without this site.
Antibiotic resistance gene can be served as a select agent to find the right clone and then improve the plasmid transformation efficiency. Antibiotic
resistance gene can also give the bacteria a pressure to have the plasmid, because the bacteria would use more energy to replicate both the plasmid and
its own DNA.
(1) The protein needs complex eukaryotic post–translational modifications for structure.
(2) The eukaryotic proteins are not well folded in E. coli and form insoluble aggregates.
(3) Proteins are secreted, membrane or intracellular.
cDNA library is usually used to expressing eukaryotic gene in prokaryotes. There are no introns in E. coli DNA, so it does not have enzymes which
could cut it out in the transcription procedure. In cDNA library, there are no introns, so it could be expressed in E. coli cells.
Genomic DNA library have the non–coding and regulatory sequence while cDNA library doesn't, but genomic DNA library is hard to make and
maintain.
(1) 2–10 kb fragments: Plasmid
Reason: Plasmid is autonomous and self–replicating circular extra–chromosomal DNA molecule. The plasmid–based vectors is usual used to clone
small DNA inserts up to 15 kb.
(2) 15–20 kb fragments: Bacteriophage lambda
Reason: Bacteriophage О» is an E. coli virus. Insertion vector is usual used to clone inserts from 5–11 kb, while

Huntington's Disease Research Paper
Huntington's disease is an autosomal dominant disorder in which cells of the brain deteriorate and eventually die. The disease does not currently have
a cure. Currently, there are researchers studying the effects of mutations and possible ways to silence them. Antisense therapy provides a form of
treatment for genetic disorders or infections. If a certain genetic sequence is known to cause a particular disease, the nucleic strand can be synthesized
to bind to the messenger RNA (mRNA) produced to the gene to inactivate and thus silence the gene. Upon the expansion of the CAG tract in the
huntingtin gene (HTT), a toxic huntingtin protein (HTT) forms with an elongated polyglutamine tract. Wild–type HTT is quite critical during the
during early

What Is The Role Of FXI As A Therapeutic Strategy For...
FXI play a crucial role in coagulation, thromboembolism, and peripheral vascular disease mediated by venous thrombus growth in an endothelial
denudated vessel and/or blood stasis. Promotion of the platelet aggregation and fibrin formation at low shear stress by the interaction of FXI and
thrombin signify the role of FXI in thromboembolism [47]. Further, reduction in the thrombus formation in a denuded vessel with anti–FXI antibody
indicates FXI to be a promising target in coagulation cascade to prevent thromboembolic events [47,48]. Many studies has demonstrated the reduced
thrombus formation without increasing the risk of bleeding with antisense oligonucleotide (ASO) along with increased number of fluorescent platelets
shed from the... Show more content on Helpwriting.net ...
Factor XII inhibition and atherothrombosis
The role of FXII and FXIIa in atherothrombosis and inflammation has been documented in various studies. Since inflammation does play a role in the
pathogenesis of plaque formation and plaque rupture resulting in thrombus formation, inhibiting FXII/FXIIa might abrogate the ongoing inflammation
and thrombus formation [7,29]. The findings of substantially less infarcted brain without an increase in infarct–associated hemorrhage in
FXII–deficient and FXII inhibitor treated mice after transient middle cerebral artery occlusion suggest FXII to be dispensable for hemostasis but
instrumental in fibrin formation. This effect was due to impaired pathological fibrin formation after FXII inhibition without increased bleeding [53].
Additionally, minimized trauma–induced microvascular thrombus formation and ischemic injury with factor XII inhibitor rHA–Infestin–4 in mice
signify the thromboprotective effect of FXII inhibition [54] (Figure 2). These studies support that FXII inhibition might be a safe and selective
thromboprotective strategy [15].
To date, several classes of inhibitors of FXII and FXIIa including antibodies, biological inhibitors, recombinant proteins, synthetic peptides, and
antisense oligonucleotides along with their mode of action, concurrent side–effects and the animal models in which

Personalised Medicine: A Case Study
Why does the European commission get involved with introducing such measures? For the most part it's to protect certain aspects of the industry like
personalised medicine. Personalised medicine or targeted therapy can be described as medical exemplary using molecular caricature technologies to
tailor the right curative design for the right individual at the right time. (European Commission, 2010) There may be some challenges that face the
current European pharmaceutical regulatory system that are likely to arise from development of anti–sense oligonucleotides for example, (Johnston et
al. 2014) will companies be able to fund proper research into clinical trials in order to customize anti–sense oligonucleotides for boys suffering from
Duchenne

A summary analysis of the article вЂњMicroarray detection of...
Introduction:
In the field of public health, food–borne illnesses are a major concern because it has been estimated that each year 76 million cases occur in the
United States causing 5,000 deaths (Suo et al., 2010). In 2008, the Center for Disease Control and Prevention's FoodNet surveillance program reported
over 18 thousand cases of food–borne illnesses occurred in 10 states (Center for Disease Control and Prevention [CDC], 2008). According to estimates
from the CDC (2011), the most common food–borne pathogens that maybe seen in the United States are Norvovirus (58%), Clostridium perfringens
(10%), Salmonella (11%), Campylobacter spp. (9%), and Staphylococcus aureus (3%). Among the other 9% (not published) include Escherichia coli ...
Show more content on Helpwriting.net ...
The emergence of DNA based technologies such as the polymerase chain reaction (PCR) and microarray analysis have been utilized in the rapid
detection and identification of many pathogenic bacteria (Mothershed & Whitney, 2006; Versalovic & Lupski, 2002). The expansion of these
technologies has significantly enhanced the sensitivity, specificity and the rapid detection of microorganisms (Suo et al., 2010). Microarray
technologies have the potential to perform high–throughput detection of multiple pathogens. Recent work with specific oligonucleotide probes
suggests that pathogen detection can be performed on a sample that contains a mixed culture of bacteria (Kim et al., 2008). This paper will
Purpose of Research:
Previous work with DNA based technologies to accurately detect and identify human pathogens has been demonstrated. Furthermore, three methods
have been utilized: 1) amplification of one or more universal genes (16S rRNA and 23S rRNA) through PCR, 2) amplification of pathogen–specific
markers (toxins, virulence factors) using multi–plex PCR and 3) amplification of random DNA fragments (Kim et al., 2008). Kim et al. (2008) state
that the first two methods is flawed due to the limited number of probes utilized and that the amplification of universal genes would not discriminate
below species level due to the fact that these genes are highly conserved within the genus. On the other hand, Kim et al. (2008) reported that

Solid Phase Peptide Synthesis And Solid-3 Synthesis Of A...
In this essay, solid phase peptide synthesis and solid phase synthesis of a primer will be compared and contrast. Solid phase peptide synthesis is the
production of peptides, whereas the solid phase synthesis of a primer involves the production of oligonucleotides. A brief summary of each will be
discussed in this essay. With understanding the processes involves, there are two similarities and differences that will also be discussed in this essay.
In the solid phase peptide synthesis, a protected amino acid with a tert–Butyloxycarbonyl protecting group is anchored to a chlorinated reactive resin.
Afterwards, the amino acid is deprotected with trifluoroacetic acid. After this is done, another protected amino activated with DCC is coupled to the
last amino acid at the N–terminal. Whenever all of the amino acids are done being added, the peptide is released from the resin using hydrofluoric acid.
In the solid phase synthesis of primers, a Гџ–cyanoethyl (ГџCE) group is added to the 3'–phosphoryl oxygen atom, while a dimethoxytrityl (DMT)
protecting group is attached to the 5'–oxygen atom. Moreover, the 3' amine group of the activated monomer is coupled to the 5' hydroxyl group of a
nucleotide base attached to resin, creating a phosphite trimester intermediate. Next, the molecule is oxidized with I2, adding a carbonyl oxygen atom to
the phosphoryl group. Lastly, the molecule is deprotected with dichloroacetitc acid, which helps remove the DM, but leaves the ГџCE intact.
To begin,

Eukaryotic Genome Editing
INTRODUCTION
With the development of biological technologies, a new era of making and manipulating DNA sequences has come. Molecular biologists have gained
the ability to delete, insert, isolate DNA sequences and gene fragments, as well as to make targeted modifications to the genome in vitro, in cells, and
in model organisms. These technologies have made it possible to study genes and DNA fragments by dissecting the functions of complex genes and
specific regulatory elements. For biological research, powerful genome editing tools will contribute to the understanding of genes, proteins, and
biological systems networks. The genome engineering also benefits a broad range of applications, such as: stimulating new generations of drug
development and medical therapeutics, increasing agricultural crop products.
Ever since the discovery of DNA double helix structure, Eukaryotic organisms genome editing has attracted widespread attention, and biologists have
been attempting different techniques to introduce site–specific modifications to the genomes of cells and model organisms. However, it is difficult to
manipulate Eukaryotic genomes as they usually contain billions of DNA base pairs. Different genome editing methods, including specific designed
oligonucleotides or cross linking reagents (1), peptide nucleic acids ... Show more content on Helpwriting.net ...
This easy–to–use technique will facilitate understanding genome functions and their relationships. It has sparked a revolution in genome engineering
field since 2012. Below we review the history of CRISPR–Cas9 system development, reveal its underlying molecular mechanism and discuss its
applications, challenges and future avenues of this novel

Dr Lab Report
Introduction
Maintenance of genomic integrity is crucial for cell survival in resistance to endogenous and exogenous environmental insults to the genetic material.
Multiple DNA repair pathways coordinate the response to such genotoxins and protect our genome [1]. Endogenous insults may be generated as a
byproduct of cellular metabolism in the form of reactive oxygen species or during physiological processes such as meiotic recombination, mating–type
switching in yeasts, V(D)J recombination and DNA replication–transcription collision [2–5]. Exogenous stresses include hypoxia, radiation and dietary
carcinogens [6, 7]. Depending on the nature of damage to the DNA structure which, may range from breaks in phosphodiester bonds such ... Show more
content on Helpwriting.net ...
NER is a highly conserved DNA repair pathway that is the primary pathway responsible for the removal of bulky DNA lesions i.e., helix–distorting
lesions such as UV– induced photoproducts, environmental mutagens, and some chemotherapeutic agents. NER has two distinct subtypes: global
genome repair (GG–NER), which can occur anywhere in the genome and transcription–coupled repair (TC–NER), which removes distorting lesions
that obstruct transcription [20, 21]. Following lesion recognition, the damage–containing oligonucleotide is excised from DNA by a dual enzyme
incision step mediated by ERCC1–XPF, which makes the first incision and XPG which incises the 3' end of single/double strand junction [22]. This
results in the release of lesion–containing oligonucleotide with TFIIH bound to it [23]. The gap–filling step in NER relies on the concerted action of
DNA ligase and its cofactors DNA polymerases Оґ and Оµ, the sliding clamp PCNA, the clamp loader RFC and RPA [24]. MMR is a is a highly
conserved post–replication repair pathway that corrects DNA mismatches generated during DNA replication that escapes the proofreading function of
DNA polymerases thereby preventing mutations and tumorigenesis [25–27]. MutSО± recognizes the mismatches and MutLО± forms nicks at the
3вЂІ– or 5вЂІ–end of the mismatched base that are substrates for the EXOI exonuclease that excises resulting DNA segment is excised by the EXO1
exonuclease in association with the single–stranded

A Study On Using Enhanced Efficeincy
In order to improve photolytic deprotection with enhanced efficeincy, several other photoremovable groups have been developed. Figure X.X.X shows
o–nitrobenzyl protecting group together with other common photolabile protecting groups such as 1–(o–nitrophenyl)ethyl (NPE),
2–(o–nitrophenyl)–propyl (NPP), 6–nitroveratryloxycarbonyl (NVOC), 2,2–bis(2–nitrophenyl)ethoxycarbonyl (diNPEOC),
4–N–[2–(2–nitropehnyl)–propoxy]carbonyl (NPPOC), 1–(3–nitrodibenzofuran–1–yl)ethyl (NDBF), 6–nitropiperonyloxymethyl (NPOM),
p–hydroxyphenacyl (pHP), 7–(diethylaminocoumarin–4–yl)methoxy carbonyl (DEACM), and 6–bromo–7–hydroxycoumarinyl–4–yl–methyl (Bhcmoc)
and 6–bromo–7–methoxycoumarinyl–4–yl–methyl (Bmcmoc). A combination of NPOM and NDBF caging group... Show more content on
Helpwriting.net ...
Rodrigues–Correia et al., 2013 and 2014
Ohtsuki et al., 2016 R = H, 6–bromo–7–hydroxycoumarinyl–4–yl–methyl (Bhcmoc)
R = Me, 6–bromo–7–methoxycoumarinyl–4–yl–methyl (Bmcmoc)C(N4)
A(N6)Furuta et al., 2007 and references therein 1–(3–nitrodibenzofuran–1–yl)ethyl (NDBF)T(N3)UV irradiation at 365 nmLusic et al., 2010
Figure X.X.X. Photolabile nucleobase protection.
Photolabile nucleobase protection has been used to achieve exquisite control over biological processes through light regulation, also referred as
photocaging. The concept was introduced by Engels (Engels and Schlaeger, 1977; Engels and Reidys, 1978) and independently by Hofmann (Kaplan et
al., 1978). Watson–Crick base pairing is blocked by caging groups, completely preventing oligonucleotide duplex formation. Duplex formation is
restored when irradiated by the light at specfic wavelength. Photolabile groups when introduced at specific locations render the molecule inactive;
however, upon irradiation with light at particular wavelength, the molecules can be activated (See detailed review by Shao and Xing, 2010; Tang et
al. 2013; Liu and Deiters, 2014). Caging groups can also be introduced at phosphate, 2п‚ў–OH, and nucleobases (Tang et al., 2013); however,
nucleobase caging has been of particular interest.
Oligonucleotides containing NVOC protecting groups have used as the photocleavable protecting group at the N3 position of

The Viological Structure Of G-Protein Coupled Receptorss
INTRODUCTION
G–protein coupled receptors (GPCRs) are highly specialised proteins responsible for the transmission of signals across the cell membrane. They sense
signaling molecules such as hormones and neurotransmitters, and thus play a very important physiological role in the human body (Venkatakrishnan et
al., 2017). GPCRs are also known as metabotropic receptors, which indicates that they are involved in intracellular signaling.
Scientific Background
The results from numerous research were combined to create a model for the structure of GPCRs and the heterotrimeric G protein, which aided our
understanding of the molecular nature of GPCRs and its functions. GPCRs are proteins that span the plasma membrane 7 times, hence the name "7 ...
Show more content on Helpwriting.net ...
De Lean and Lefkowitz carried out competitive binding experiments to investigate the interaction between extracellular ligands (both antagonist and
agonist), GPCRs and X – a membrane component.
Method
The antagonist [3H]DHA and the agonist [3H]HBI were incubated with freshly prepared plasma membranes and appropriate unlabeled ligand for 60
minutes at 25oC. The reaction was stopped by the addition of ice–cold buffer, and filtered on glass fibre filters. After additional washings with 5ml of
buffer, the concentration of radioactive ligands (antagonists / agonists) trapped on the filters was measured. Agonist binding is reversible, thus the
regular incubation period (60 minutes) was doubled to ensure that the conditions were compatible with true equilibrium. The binding of [3H]DHA and
[3H]HBI to the frog erythrocyte ОІ–Adrenergic receptor were plotted in saturation and competition curves.
Results
It had been observed that the binding competition curve for antagonists are steep, and express low affinity, On the other hand, binding competition
curves for agonists are shallow, showing 2 distinct binding states: high and low affinity state. They discovered that the addition of guanine receptors
could convert the high affinity state to low. This observation was also described in numerous other GPCRs, such as

Exam 2 Answers Essay example
Biol 385: Biotech. and Gen. Eng.Name___________________________
Exam #2 – 100pts06 April 2012G #_____________________
=======================================================================
If necessary, use the back of the exam pages for the rest of your answers. Do not use other sheets of paper. Please write legibly; if I cannot read your
answer, I will count it wrong. * BY TAKING THIS EXAM, YOU HAVE AGREED TO ABIDE BY THE SPIRIT AND THE LETTER OF THE
HONOR CODE OF GEORGE MASON UNIVERSITY. INITIAL HERE
=======================================================================
1. (6pts) Expression of eukaryotic proteins in prokaryotic cells occasionally results in instability or ... Show more content on Helpwriting.net ...
Draw a schematic of the vector and include all of the genetic loci that will permit this two–gene vector to function as a shuttle vector between human
cells and E.coli cells. (For your convenience, I have put the A and B polypeptide coding regions on the two–gene vector schematic.)
See Figure 7.20 on page 184, Chapter 07 of the text.
A two gene vector will have a two promoters and two polyA sites to permit expression of both coding regions, which will be on two mRNAs. As a
shuttle vector it will also have an E.coli ori and selectable marker, and a eukaryotic selectable marker and either a eukaryotic ori or sequences to permit
homologous recombination into the chromosome.
7. (3pts) A technician from the BIOtique, Ltd.Protein Engineering Group comes to you for advice regarding her protein of interest. She needs to
improve the enzyme in order for Biotique, Ltd. to compete effectively in a new commercial market area. What are three properties of her enzyme that
you could suggest that might be useful to change by directed mutagenesis in order to improve her enzyme?
1) kinetic property – Vmax kinetic property – Km Thermal stability pH optimum
2) altered allosteric regulation increased resistance to degradation removal of co–factor requirement increased reactivity in non–aqueous solvent
3) altered specificity of substrate binding
8. (6pts) BIOtique, Ltd.'s Molecular Genetic Diagnostics

The Structural Domains And Mechanism Of Action Of Ribozymes
1)Describe the structural domains and mechanism of action of ribozymes. How can ribozymes be useful as therapeutic agents? (10 points)
RNA molecules that act as enzymes are called ribozymes. They are capable of catalyzing the cleavage of their own RNA or other RNA substrates
(Missailidis, 2008). Ribozymes are involved in viroid replication, RNA splicing and protein synthesis. (Clark & Russel, 2005) The structure of
ribozymes consist of a catalytic domain and a substrate binding domain. (Ebrahimian, 2015)
The substrate binding domain has a specific sequence antisense to the target mRNA. This sequence recognizes and hybridizes specifically to its
substrate. (Missailidis, 2008). Alteration of the substrate binding domain can be done so that the substrate specifically cleaves any mRNA sequence.
The RNA catalytic domain cleaves the substrate at a target site recognized by the ribozyme (Glick &Pasternak, 2003). The resultant products are then
degraded by ribonucleases and the ribozyme dissociates itself from the RNA products and binds to another mRNA to be cleaved. (Missailidis, 2008)
Therapeutic ribozymes can be designed to target almost any RNA sequence and decrease the amount of a particular protein that is synthesized (Glick
& Pasternak, 2003). This can be done by incorporating the catalytic domain of ribozyme into short oligonucleotides antisense to the target mRNA
(Missailidis, 2008). Ribozymes can be used to identify specific sites and introduced into the system to

Gel Electrophoresis Lab Report
Gel electrophoresis is a simple technique that allows us to determine the charges and molecular weights of all sorts of macromolecules. The basic
theory is a simple one: more negatively charged molecules will migrate in an electric field, toward the positively charged cathode. A matrix (such as
agarose or polyacrylamide) must be used to conduct heat evenly and provide an extra sieving effect. In particular, agarose gel electrophoresis is
generally used to separate DNA (single–stranded, double–stranded, and supercoiled) and RNA. Since DNA is negatively charged, it migrates in an
electric field toward the positively charged cathode. The agarose matrix retards DNA migration roughly proportionally to DNA length. Longer
oligonucleotides have a harder time traveling through the matrix, while shorter oligonucleotides breeze right through it. The concentration of agarose
in the gel can be fine–tuned to achieve optimal separation for a specific range of sizes. The higher the concentration of the gel, the lower the pore
size will be. So, when the target DNA size is small, higher concentration of agarose gel is used. Usually 1 to 2% gels are used for detecting plasmids
(several kb long) or their fragments (i.e. from digestions). For ... Show more content on Helpwriting.net ...
This buffer contains chaotropic salts which remove all DNA binding proteins and nonspecific DNA strands from PCR products. This is done through
disruption of protein structure by destabilizing hydrophobic interactions. High salt existence decreases the negativity of DNA and increases binding
affinity and stronger interaction with the column membrane. Ethanol added washing buffer efficiently removes dNTPs, primer dimers, salt, buffer or
anything except DNA from the column. For complete removal of residual ethanol, extra centrifugation is done. Finally, DNA is eluted utilizing
nuclease free water as binding affinity of DNA with nuclease free water is

The And Pka Values Of Nucleobases
NUCLEOSIDE TAUTOMERISM AND pKa VALUES
The nucleophilicity of nucleobases (Figure 2.1.1) is dictated by the pKa of the amino and amido functions and their tautomeric forms. Table 2.1.1 lists
the pKa values of nucleobases. The amide–like nitrogens (N3 of uridine and N1 of guanosine) are acidic in character, whereas the ring nitrogens are
basic. Therefore, at strongly alkaline pH, the proton at N3 of uridine and thymidine and that at N1 of guanosine are removed. Under acidic
conditions (at pH ~3), the sites of protonation are N1 of adenosine and N3 of cytidine. At more acidic pH, the N7 of guanosine and adenosine and the
O4 of uridine are protonated. Thus, all the bases remain mostly uncharged in the physiological range of pH 5 to 9 ... Show more content on
Helpwriting.net ...
Quite clearly, protecting groups and the protocols for their installation and removal should be designed to avoid various side reactions.
Nucleobases undergo substitution reactions with electrophilic reagents. For example, both N– and O–alkylation of the imide and lactam groups occur
with alkylating agents. The N7 position of purines is also a potential site for electrophilic attack (Figure 2.1.5). Because of these competing reactions,
simple alkylation of exocyclic amino function is not a viable protection strategy for nucleobases. On the other hand, it is possible to chemoselectively
acylate the exocyclic amino group. Thus, acyl–type protecting groups are widely used for the protection of the exocyclic amino groups of nucleosides
(Figure 2.1.7).
The imide/lactam NH of thymidine, uridine (pKa, 9.38), and guanosine (pKa, 9.42) is weakly acidic and can deprotonate under basic conditions. The
resulting nucleophilic anion can react with a variety of reagents such as activated phosphates, dicyclohexylcarbodiimide (DCC), mesitylene sulfonyl
chloride, 1–(mesitylene–2–sulfonyl)–3–nitro–1,2,4–triazole (MSNT), acid chlorides, phosphitylating reagents, and electrophilic reagents that are
employed during coupling reactions. These side reactions result in nucleobase–derived N– and O–products.
Nucleosides also react with a variety of nucleophilic reagents. For example,

Are Antisense Oligonucleotides and Effective Trearment for...
Introduction The concept of an Antisense oligonucleotide (an ASO) was first introduced by Stephenson and Zamecnik, who used an antisense
nucleotide to stop viral replication in cell culture[1]. The effectiveness of ASOs as treatments has already been seen in other disease, such as
Vitravene (or Fomivirsen), which was the first ASO made publicly available, and is used to treat cytomegalovirus retinitis, as well as Isis 3521 which
when given to lung cancer patients in addition to combination chemotherapy has been seen to raise life expectancy by as much as 50%[2]. From these
past successes, many have hypothesised that they might make an effective treatment for Huntington's disease (HD) as well, which currently we are
only able to treat the... Show more content on Helpwriting.net ...
From the effectiveness of the application of antisense oligonucleotides in other disease of a similar pathology, it stands to reason that ASOs should be
a viable therapeutic for treating Huntington's disease. Issues with the use of ASOs as therapeutics While a promising target, the use of antisense
oligonucleotides in treating Huntington's disease has not been without its issues. The first issue that using ASOs in the treatment of HD that we face
is the lack of stability found in ASOs in their normal state. Without modification, most ASOs are broken down immediately upon entrance into the
host body by intracellular endo and exonucleases. This is a huge fault in therapeutics, as if the ASO is broken down it will be unable to produce its
desired effects, but also as one of the by–products created by its degradation– dNMP2 mononucleotides– is cytotoxic and so could cause further
potential harm to the patient [2]. This problem has been resolved in many cases through modifications to the structure of the ASOs. One such
modification is it's methylation to form a methylphosphonate backbone, which has a far superior stability to the original ASO, but has itself faced
issues due to the reduction in charge that occurs after methylation, which reduces the ASOs stability in the body. Another, far more widely used
modification in

Nucleic Acid Measurements
Lecture 8
Nucleic Acid–Based Measurements Text Chapter 13
Wednesday, July 24, 2013
Total community DNA
Extract DNA from soil
– – – – remove cells from soil separate cells from soil lyse cells separate DNA from cells – purify DNA
Extract DNA from soil
– Extract DNA from cells in presence of soil
Bead–beating chemical or enzymatic treatment
– Sodium dodecyl sulfate or lysozyme
DNA purification
Cesium chloride gradient centrifugation Kits
Low density DNA
High density
Visualizing nucleic acidsBlotting
Southern blotting

– DNA
Northern blotting
– RNA
Agarose gel electrophoresis
–
Stain gel with ethidium ... Show more content on Helpwriting.net ...
ednesday, July 24, 2013
50 Вµm
Combining ELF and CF319a probes to determine what portion of the PO4aseactive cells in floc fall within cytophaga–flavobacteria group
ELFTM PO4ase CF319a FISH probe activity FISH probe & PO4ase activity
17% of total community PO4ase activity contributed by cytophaga
Summary
FISH provides information on
– Presence of specific populations – Morphology of specific populations – Relative numerical contribution of specific populations to total community –
Spatial relationships between populations – Functions associated with specific populations
Gene probe detection of a DNA sequence
Digoxigenin (DIG) Probes range in size from 18–100bp ssDNA
Denatured ssDNA from suspect bacterium

Alternative gene probe detection of a DNA sequence
Exploring microbial activity
Need to know sequence of gene being expressed Alternatively, use random hexamer primers, then sequence cDNA product to identify gene being
expressed
Reverse transcriptase PCR (RT–PCR)
Make single–strand cDNA from mRNA– downstream antisense primer or random hexamer and RT to make complete cDNA copy of RNA molecule
Use cDNA, DNA polymerase, and a downstream primer in conventional PCR – extension leads to double–stranded DNA Regular PCR of dsDNA
Applications of RT–PCR
Detection of

An Analysis Of The Stanford Understudy Space Activity
OSM remains for Oligonucleotide Synthesizer intended for use in Microgravity, implying that it's a gadget that makes discretionary DNA strands
(of direct length) in space. Cool eh? I've been taking a shot at this venture throughout the previous eight months with a brilliant group of kindred
programmers as a feature of the Stanford Understudy Space Activity, and I'd get a kick out of the chance to share what we're doing, what we've
effectively done, and where we're going. Why space? All things considered, above all else, space is cool. Be that as it may, all the more genuinely,
access to self–assertive DNA in space could quicken investigate in a plenty of fields, and the capacity to hereditarily design microbes to create
substances (say... Show more content on Helpwriting.net ...
What's more, one more note: DNA has two distinct finishes: a three prime (3вЂІ) end and a five prime end (5вЂІ). Oligonucleotide
(Ah–li–go–new–klee–o–tide) Oligonucleotides are short DNA or RNA atoms and are super valuable when all is said in done research, hereditary
testing, and bioengineering. The length of an oligo (short for oligonucleotide) is generally indicated as 30–mer or d30 on account of an oligo with 30
bases. How short does a strand of DNA must be to be viewed as an oligo? All things considered, back when we were... suppose not very great at DNA
union, oligonucleotides were immovably in the 2–50 territory. Be that as it may, with the appearance of phosphoramidite (an inorganic DNA union
technique), oligonucleotides can run from 2–1000+ bases long. Homopolymer An oligonucleotide included just a single sort of base (eg AAAAAA
instead of AGTCTG) is known as a homopolymer. Terminal Deoxynucleotidyl Transferase (TdT) Terminal Deoxynucleotidyl Transferase, ordinarily
shortened to TdT, is a polymerase–like protein that can add self–assertive nucleotides to the 3вЂІ end of a DNA strand when certain conditions are met.
TdT can affix each of the four nucleotides however demonstrates an inclination for guanine (G) and cytosine (C). TdT can be discovered normally in
youthful, pre–B, and pre–T lymphoid cells where it performs hereditary enhancement for our invulnerable frameworks by including bases onto the 3вЂІ
(three prime) end of

Essay On Duchenne's Muscular Dystrophy
Duchenne's muscular dystrophy is one of the most common forms over childhood muscular dystrophy and primarily affects boys; in total there are 30
different forms of muscular dystrophy 50% being duchenne's muscular dystrophy (NIH, 2013). This type of muscular dystrophy usually begins to show
symptoms around the pre–school age and affects the lower extremities first. By the age of twelve, most boys are in a wheelchair as the trunk muscles
being to weaken leading to scoliosis and kyphosis. Eventually the diaphragm begins to weaken and young men with Duchenne's muscular dystrophy
will need assistance with breathing through the use of a ventilator (Naff, C. 2012). According to the 1st Edition of Perspectives on Disease and
Disorders Muscular Dystrophy by the age of eighteen most young men would have experienced a cardio myopathy (weakening or the heart muscle)
(Naff, C. 2012). Duchenne's muscular dystrophy (DMD) is a chromosome X–linked and genetically inherited neuromuscular disease. The New England
Journal of Medicine reports that Duchenne's muscular dystrophy affects 1 in 3500 new born baby boys. Duchenne's ... Show more content on
Helpwriting.net ...
Both research articles focused on the production of viable dystrophin protein in test subjects. Throughout the research I feel as though the most
promising treatment between the two studies would be the study where the patient subject that were taking ataluren. The end result of the trial that
included ataluren showed that more than half of the young men that participated in this study ended up having a positive result. That positive result
was the increase of dystrophin, so they had a pretty positive result. The other treatment type where the subjects received injections in the tibialis
anterior muscle was not necessarily where they wanted their study to be at the time, but it showed

Hepg2 / C3a Cells : The Choice Of Cell Lines
The choice of cell lines
HepG2 / C3A cells: HepG2 / C3A cells are a hepatocellular carcinoma cell line provided by Baylor College of Medicine, maintained by ATCC
(American Type Cell Culture) in the United States. HepG2 / C3A strongly express telomerase and secrete almost all proteins normally found in normal
serum and also the AFP. These cells are cultured in our laboratory as recommended by ATCC (American Type
Cell Culture). Indeed, HepG2 / C3A are
cultured in DMEM + 10% FBS (Fetal bovine serum) + 1% P / S (penicillin / streptomycin) + 1% NEAA (Non Essential amino acids) and incubated at
37 В° in an incubator at 5% CO2PLC / PRF / 5 cells: PLC / PRF / 5 cell line is another hepatocellular carcinoma maintained by the ATCC in the USA.
PLC / ... Show more content on Helpwriting.net ...
Cell viability test
Cell viability was determined using the tetrazolium salt 3– (4,5–dimethylthiazol–2–yl) –5– (3–carboxymethoxyphenyl) –2– (4–sulfophenyl) –2H as
reported by the manufacturer's instructions (Sigma–Aldrich, USA ). The tetrazolium salt is cleaved to formazan by succinate– reductase, an enzyme
that exists only in the mitochondrial respiratory chain and is active only in viable cells. Formazan production is proportional to the number of living
cells in culture. Briefly, HepG2 / C3A and PLC / PRF / 5 were seeded at 104 cells per well in 96 well plates. At 80% confluence, the cells were treated
with IL–6, PI3K/Akt/mTOR or telomerase inhibitor for 48 h. After treatment, 10 ul of tetrazolium salt were added to 100 uL of culture medium, and
the plate was incubated for 45 min at 37ВєC. Absorbance was then measured using an ELISA reader at 450 nm.
RNA extraction and RT–PCR
Total RNA from HepG2 / C3A and PLC / PRF / 5 was extracted using the kit "GenElute Mammalian Total RNA Kit" from Sigma
–Aldrich (USA)
according to manufacturer's instructions. The cDNA was synthesized from 1 ug of RNA using the kit "iScript cDNA Synthesis" (Bio
–Rad, USA).
Quantitative PCR was performed using the kit REDTaq Ready Mix PCR Reaction Mix (Sigma–Aldrich, USA). The PCR primers have the following
sequences:
AFP forward 5'–ACCCTGGTGTTGGCCAGT'–3'; AFP reverse 5'–GCAGCGCTACACCCTGAGT–3'; hTERT forward
5'–TGAACTTGCGGAAGACAGTGG –3 ' hTERT reverse

Creating an E. Coli Strain to Produce Antivenom Essay example
Background Each year snakes envenomate 421,000 people, 20,000 of whom die. These injuries are especially concentrated in developing countries,
where snake bites are an occupational hazard. (Kasturiratne et al. 2008). The negative impact of this could be alleviated by the creation and production
of a low–cost, human–compatible universal antivenom. Lethal Toxin Neutralizing Factor, henceforth LTNF, is a substance that has been isolated from
opossum (Didelphis virginiana) serum, liquid component of blood. LTNF can neutralize nearly all venoms, by a mechanism not yet understood,
including those never before encountered by the opossum (Menchaca & Perez 1981, Shier 2008). The active site of LTNF has been isolated into a 15
amino acid–long... Show more content on Helpwriting.net ...
Currently, antivenoms are produced by injecting non–lethal doses of the venom into other animals, typically large mammals, and collecting the
antibodies produced in response (Domont et al. 1991). In contrast, our project produces LT–15 using genetically manipulated E. coli. There are
immense benefits to our project. Primarily, the benefits derive from the use of LT–15 as a universal antivenom in medical settings. With LT–15,
medical facilities can carry fewer venom–specific antivenoms and more LT–15, reducing storage costs. Additionally, LT
–15 could be used as an initial
or booster antivenom, for when the active venom cannot be immediately identified. Furthermore, use of LT–15 could decrease the per–unit cost of
antivenom. Because production of antivenom has high fixed costs but low variable costs, economies of scale exist and the average cost falls as
production quantity rises. Since LT–15 could be used universally, we anticipate a large demand for it, leading to a lower cost for per–unit of LT–15
than for each antivenom it replaces (Chen et al. 1995). Finally, the use of an E. coli to produce antivenom would nearly eliminate the allergic reactions
many patients experience with antivenoms produced in large mammals (Lipps 2000). Current antivenom production yields a large quantity of animal
serum with many antibodies, only some of which are venom–specific. In order to achieve adequate levels of specific antivenom in the bloodstream, a
large

The Discovery Of Site Directed Mutagenesis
Site–directed mutagenesis, also known as oligonucleotide–directed mutagenesis, is a technique that is used to intentionally modify a DNA sequence of
a gene by introducing a site–specific mutation. The general method for producing the defined oligonucleotide mutation was developed from a
combination of observations on nucleic acids, and it was in the 1978s where enzymatic extension was used as an approach to SDM, using
oligonucleotides as primer (Hutchinson, et al., 1978). Since then, this technique has then been improved in efficiency in later studies which has
stemmed from this initial mutagenesis experiment, and thus novel methods of inducing site–specific mutagenesis has been improved in later years.
The discovery of site–directed mutagenesis has played a significant role in scientific research because its ability to change regions of DNA sequences
enables precise molecular studies of genes and proteins whose function is not yet known. In the past, UV (Scott, et al., 1976) and chemical methods
were used in biological research to induce mutations in attempt to study biological processes. However, such methods were not site–specific in
producing the mutations.
In this essay, I will be describing about the approaches and development of site–directed mutagenesis over the years and also mention about its role in
molecular research as well as its importance in industry.
General method for site–directed mutagenesis
The general method for producing a defined point mutation

What Are The Significance Of Long Non-Coding Rnas In...
1.Beermann J, Piccoli M–T, Viereck J, Thum T. Non
–coding RNAs in development and disease: background, mechanisms, and therapeutic approaches.
Physiological reviews. 2016;96(4):1297–325.
2.Chandra Gupta S, Nandan Tripathi Y. Potential of long nonв
Ђђcoding RNAs in cancer patients: From biomarkers to therapeutic targets. International
journal of cancer. 2017;140(9):1955–67.
3.Dykes I, Emanueli C. Transcriptional and Post–transcriptional Gene Regulation by Long Non–coding RNA. Genomics, Proteomics & Bioinformatics.
2017.
4.Chen Z–H, Wang W–T, Huang W, Fang K, Sun Y–M, Liu S–R, et al. The lncRNA HOTAIRM1 regulates the degradation of PML–RARA
oncoprotein and myeloid cell differentiation by enhancing the autophagy pathway. Cell Death & ... Show more content on Helpwriting.net ...
Genomic classification and prognosis in acute myeloid leukemia. New England Journal of Medicine. 2016;374(23):2209–21.
13.Zeng C, Yu X, Lai J, Yang L, Chen S, Li Y. Overexpression of the long non
–coding RNA PVT1 is correlated with leukemic cell proliferation in
acute promyelocytic leukemia. Journal of hematology & oncology. 2015;8(1):126.
14.Bassett AR, Akhtar A, Barlow DP, Bird AP, Brockdorff N, Duboule D, et al. Considerations when investigating lncRNA function in vivo. Elife.
2014;3:e03058.
15.Cheetham S, Gruhl F, Mattick J, Dinger M. Long noncoding RNAs and the genetics of cancer. British journal of cancer. 2013;108(12):2419–25.
16.Yao Y, Li J, Wang L. Large intervening non
–coding RNA HOTAIR is an indicator of poor prognosis and a therapeutic target in human cancers.
International journal of molecular sciences. 2014;15(10):18985–99.
17.Castanotto D, Lin M, Kowolik C, Wang L, Ren X–Q, Soifer HS, et al. A cytoplasmic pathway for gapmer antisense oligonucleotide–mediated gene
silencing in mammalian cells. Nucleic acids research. 2015;43(19):9350–61.
18.Soifer HS, Koch T, Lai J, Hansen B, Hoeg A, Oerum H, et al. Silencing of gene expression by gymnotic delivery of antisense oligonucleotides.
Functional Genomics: Methods and Protocols. 2012:333–46.
19.Fazil MHUT, Ong ST, Chalasani MLS, Low JH, Kizhakeyil A, Mamidi A, et al. GapmeR cellular internalization by macropinocytosis induces

Disadvantages Of Oculocutaneous Albinism
ALBINISM, OCULOCUTANEOUS, TYPE II; OCA2
Referance: PubMed: #8723691 Oculocutaneous albinism is set of disorders that affect pigmentation of the skin, hair, eyes; owing to autosomal
recessive inheritance of derangement of melanin biosynthesis. There are 4 varieties of oculocutaneous albinism including type I, type II, type III, type
IV. Second type of oculocutaneous occurs in the presence of mutations in the OCA2gene as known as BOCA, Pink–eyed dilution protein homolog, P
gene. OCA2 encodes P protein that takes the role of the passage of tyrosine which is the precursor of melanin, whereat we can reach the fact that OCA2
involves melanin synthesis process, therefore flaws in OCA2 causes disorders associated with melanin metabolism. The main characteristics of
oculocutaneous albinism type II are nystagmus, reduced iris pigment with iris transillumination, reduced retinal pigment with visualization of the
choroidal blood vessels, foveal hypoplasia1 and common ocular alterations seen in the every type of albinism. Additionally some of the OCA2 patients
can obtain small amounts of melanin with age, consequently there could be ... Show more content on Helpwriting.net ...
OCA2 is aoutosomal disorder that has been associated with partial deletion in 15q11–q13 segments which makes some flaws in P protein metabolism,
OCA2 is the most prevalent form of the OCA.2 OCA2 found more frequently in people from sub–Saharan Africa and African Americans (OCA2 found
in 0.1 percent of African Americans which is almost 4 times prevalent

Tomato Production Essay
Tomato production is affected by various bacterial, fungal and viral diseases which resulted in considerable yield losses. Among those diseases,
damping off, early blight, late blight, powdery mildew, bacterial leaf spot, bacterial canker, buck eye rot, fusarium wilt, tomato spotted wilt, tomato big
bud, tomato bunch top , tomato mosaic and tomato leaf curl affect tomato production. Among all the diseases of tomato, leaf curl disease of tomato
(ToLCD) is the most devastating one as its incidence and severity is increasing worldwide. A review suggested that there are more than 55
tomato–infecting geminiviruses throughout the world (Fauquet et al., 2008). ToLCD is caused by viruses belonging to the genus begomovirus
within the family Geminiviridae. In India also, ToLCD is the major constraint to tomato production and causes serious yield loss (Vasudeva and
Samraj, 1948; Banerjee and Kalloo, 1987; Saikia and Muniyappa, 1989; Rataul and Barar 1989; Varma and Malathi, 2003; Chakraborty, 2008; Borah
and Dasgupta, 2012; Kanakala et al., 2013). Infected tomato plants infected exhibit severe reduction in leaf size, upward and downward curling of
leaves, crinkling of interveinal areas, interveinal and marginal chlorosis and in some cases purple discolouration of the abaxial surface of the leaves.
The disease induces severe stunting, development of small branches that causes bushy growth, reduced fruiting or partial to complete sterility if
infection takes place at early stage of

Site Directed Mutagenesis ( Sdm ) Technique
Site–directed mutagenesis (SDM) technique is commonly used to induce desired change in DNA plasmid sequence by mutation, insertion or deletion
with oligonucleotide primers (1). This SDM usually cooperate with ploymerase chain reaction (PCR) as to amplify the concentration of mutated
template (2). PCR, a temperature–based cycle reaction, is completed with three initial steps including denaturing the DNA template, anneal the mutated
oligonucleotide primers and elongating the mutated primer with ploymerase (1). One of the special comment in the PCR–based SDM is the DnpI
endonuclease (restriction enzyme for digest meth ylated DNA) digestion that is removing parent DNA templates which are methylated (1). Following,
the step is transformation of the mutated DNA into bacterial system which allows the gene undergo nick repair, and further the antibiotic selection with
ampicillin resistance (1). The antibiotic resistance aims to select the the bacterial that are successfully transformed with desired mutated DNA (shown
in Figure 1) (1). After being transformed into bacterial system and grow overnight, the mutated plasmid needs to be isolate from the system which is
based on the different denatured stage of bacterial genome and mutated plasmid DNA (3). With this step, the first centrifugation allows the separation
of the growth media and bacterial cells; the added lysis solution is able to denature the bacterial genome and mutated plasmid DNA; the neutralization
solution is

The Method Of Detection Of Dna
1.Primer Annealing – temperature is lowered so that primers attach to DNA strands
2.Extension – DNA polymerase (e.g. Taq) helps to make new DNA strands.
The PCR cycle continues as DNA is copied exponentially. The original PCR methods allowed detection of DNA growth at the end of the process;
however the introduction Real Time–PCR (RT–PCR) has allowed DNA amplification progress to be monitored throughout the assay (6).
RT–PCR is often confused with reverse–transcriptase PCR (rt–PCR), however rt–PCR is a method of detecting RNA by utilising reverse transcriptase
to synthesise cDNA by. cDNA is then amplified and detected by PCR techniques (6).
RT–PCR has now advanced so that assays can now screen several viral DNA/RNA at once (Multiplex PCR). The Roche– Cobas TaqScreen MPX Test
v2.0 encompasses an rt–PCR stage to allow detection of:
HIV–1 Group M (RNA)
HIV–1 Group O (RNA)
HIV–2 (RNA)
HCV (DNA)
HBV (DNA)
(5)
MPX PCR uses several gene specific primers (forward and reverse strands) within a reaction mix. Internal controls are present within the testing kit,
making the process highly efficient. By combining several tests on one platform, this is a very lean method testing; however there is a small risk of
cross–hybridisation due to the volume of different primers used (5,6).
An added benefit of using RT–PCR to screen viral targets is that they shorten the detection window period of some viruses. This means, even if a viral
marker can be detected serologically

The Mechanical Basis Of Transcription Coupled Repair
DNA repair in motion: The mechanical basis of transcription–coupled repair in prokaryotes
Proper gene expression is crucial for normal physiological development. Unfortunately, the structural and functional integrity of cellular DNA is
constantly at risk by intrinsic and extrinsic factors, from mistakes in metabolic processes to radiation damage. DNA repair pathways are critical
processes that address these offenses by maintaining the level genomic integrity necessary for accurate cellular division and function. These pathways
involve the seamless integration of repair with processes that operate on DNA, such as replication and transcription [1]. However, the coordination of
these various pathways in DNA repair and the mechanisms by which specific sites of damage are recognized remain poorly characterized.
Transcription–repair coupling factors (TRCFs) link DNA repair and transcription with a mechanism known as transcription–coupled repair (TCR). The
best characterized TCR pathway is found in the prokaryotic system, which involves the TRCF Mfd. Mfd is a double–stranded DNA translocase that
recognizes stalled RNA polymerases (RNAPs) in transcription elongation complexes [1]. Stalled RNAPs act as beacons of DNA damage, nucleotide
deprivation, and protein roadblocks in transcription. Once Mfd associates with a stalled RNAP, its translocation activity is activated and it pushes
RNAP downstream. This process can lead to two possible outcomes. If RNAP is able to bypass the lesion,

Exploring Antisense Based Therapeutics 's Therapeutic...
This research project will aim to explore antisense–based therapeutics in two key areas, it's therapeutic potential and it's utility as a research tool.
Antisense technology uses a single stranded molecule that is complementary to a specific sequence and binds to that sequence to ultimately silence it.
With two antisense based therapies being approved by the FDA, antisense based therapeutics have been shown to hold potential in both research
development and therapeutics. A literature search will be undertaken comprising of books, journals, review articles, news articles and clinical trials.
The evidence will then be categorised against the aims of the project. The evidence will be assimilated through critical analysis using research
methodology assessing the quality of research papers and systematic reviews using tools such as PRISMA. A descriptive summary and tables will be
used to present the evidence using objective statistical tools where possible and meta–analysis will be applied if the data is homogeneous. The project
aims to critically evaluate the available evidence highlighting the therapeutic potential of antisense treatments in specific disease areas as well as its
future potential. The research potential of antisense as a tool will also be evaluated using an evidence based approach. Background Antisense–based
therapeutics have attracted much interest as a novel class of agents for the treatment of 'viral infections, cancers and genetic disorders due to their

Anti Sense Therapy ( Lnp ) Essay

Recommended

Recommended

More Related Content

Similar to Anti Sense Therapy ( Lnp ) Essay

Similar to Anti Sense Therapy ( Lnp ) Essay (20)

More from Juanita Conklin

More from Juanita Conklin (20)

Recently uploaded

Recently uploaded (20)

Anti Sense Therapy ( Lnp ) Essay