Genetic Code Research Paper

Genetic Code Research Paper
What is the genetic code? The definition of the genetic code is best described as being a set of
rules by which genetic material like DNA or RNA is encoded and then translated into proteins. It is
the
basis of heredity in every living organism. There are many theories that attempt to explain the
origins of
the genetic code. Francis Crick, for example, basically described it as an accident and another theory
states that "modern genetic code grew from an earlier and simpler code through a 'biosynthetic
expansion' process; or that it resulted form information channels' "(Gillet, Mace). We now know that
the
genetic code is a set of three–letter combinations of nucleotides called codons. This essay will cover
the
potential ... Show more content on Helpwriting.net ...
In addition to quality control pathways, some genetic regulatory circuits use trans–
translation to control gene expression" (Web).
There have been many theories about an RNA world. One stated that before all other cells arose,
an RNA world existed on Earth. Another theory stated that "RNA, the compliment molecule to
DNA,
was the first to evolve naturally from materials already common in the pre–biotic Earth. Self–
replication
was achieved through catalytic actions in RNA–based molecules, called ribosomes, or possibly
through an
intermediary molecule" (Web). It has been said that DNA can be considered as a modified form of
RNA.

From what we have learned throughout time, we have found out that the DNA double helix replaced
RNA
as a more stable molecule for storing the increased amounts of genetic information required by cells.
All cells come from pre–existing cells is part of the cell theory. This is similar to how DNA
replaced RNA. It is believed theRNA existed before DNA was discovered. RNA was not as strong
as
DNA because RNA was only a single strand. DNA is more stable because of its double–helix.
... Get more on HelpWriting.net ...

The Change Of Hemoglobin Changes Essay
Homework #9
Chapter 11:
1. The change in hemoglobin changes as the change in the oxygen in the environment occurs. Each
globin usually has two polypeptide chains encoded by genes that attract oxygen molecules to
different degrees.
2. The pancreas which has two types of cell clusters. A transcription factor is activated and change
the expression of a gene in a way that stimulates some progenitor cells to divide.
3. Proteomics is an area where gene expression emerges. It identifies and analyzes all the proteins
that made in a cell, organ, or body.
4. The histone protein plays major role in interacting with other chemical groups which expose
DNA and shield some sections.
5. Acetyl plays role can start the transcription. Methyl groups binds to a specific amino acid in a
specific histone type. When the CH3 are added methylation spreads from the tail of one histone to
the adjacent histone. The addition of phosphate is example of epigenetic changes. The addition of
these three groups should be balanced.
6. MicroRNA's can affect the gene expression by preventing their translation onto protein. This
blocking function lead to enabling the cells to adapt to change condition.
7. Because the genes in pieces of exons and introns and alternate splicing make it possible for one
store of information.
8. By using different information in a gene, the proteins can be resulted. These information is called
isoforms where the driving force behind which version of a protein a cell makes is

Protein Coding Dna
A triplet is a group of 3 DNA nucleotides. A codon is a group of 3 RNA nucleotides. Triplets code
for codons, codons code for anticodons in the tRNA, which brings the amino acids.
Coding DNA is any DNA that codes for proteins or RNA molecules. This includes exons and certain
introns that code for RNA. Exons code for proteins in translation and are protein coding.
Non protein coding DNA is the "dark matter," including ancestral DNA, promoter regions, and
introns. This DNA does not leave the nucleus during protein synthesis and does not code for
proteins.
The promoter region is a start signal for the RNA Polymerase II. It marks the beginning of a gene
with two parts, a TATA Box, a sequence of repeating thymine and adenine bases, and the poly A
region, a sequence of repeating adenine bases. This is where the enzymes known as binding factors
attach and signal to the RNA Polymerase.
Exons and introns are found in the genes of DNA. Exons are the protein coding sections of the
genes, meaning they leave the nucleus and contain the codons that create the primary ... Show more
content on Helpwriting.net ...
There are four parts, initiation, elongation, translocation and termination. Initiation attaches the
mRNA to the ribosome and begins translation. Elongation is when new codons are exposed and new
amino acids are added to the polypeptide. Translocation is the movement of mRNA through the
ribosome and termination is when the stop codon is reached and the protein, ribosome and mRNA
detach from each other. Ribosomes are key to this process. They have a large and small subunit that
come together around the mRNA and provide a place for tRNA to meet mRNA. It also provides
enzymes needed to form the peptide bonds. mRNA is essential because it brings the genetic
information to the ribosome and tRNA is important because it carries the amino acids to the
corresponding codon. The amino acids bond to other amino acids in a specific order to create a

Cystic Fibrosis Case Study
Krickett Davis
Zachary Mock
Cystic Fibrosis Case Study:
Part I Questions: The Meeting
Consult your textbook and trustworthy Internet sites to answer the following questions:
1. Which organs are affected by cystic fibrosis? What are the disease symptoms?
Organs that are affected by cystic fibrosis include the lungs, pancreas, liver, sweat glands,
reproductive organs, nose and sinuses. The symptoms of cystic fibrosis include coughing with
mucus coming up, wheezing, breathlessness, decrease in ability to exercise, lung infections,
inflamed nasal passages, stuffy nose, bad growth, intestinal blockage, severe constipation and
greasy foul smelling stool.
2. Draw a pedigree showing the family history for CF in Sarah's and Michael's families. ... Show
more content on Helpwriting.net ...
40 mutations and 4 polymorphisms can be detected by the Tag–It 40+4 Luminex–based reagent
system. There were two mutations that were removed from the 25 mutation original panel though;
I148T and also 1078delT. There are 40 mutations that can be detected by this test, but two were
removed because one of the mutations was decided to be a polymorphism and the other was too rare
to test for.
12. What criteria did researchers use when determining which mutations to include in the Tag–It
test?
Researchers used a Luminex bead system which develops reagents for multiplex molecular analyze.
By using this bead system, the researchers were able to tell that this analysis showed that it detected
the 25 mutations on the original reagent. These 25 mutations were then looked at by researchers.
Two of the mutations were decided to be thrown off the original list. The reason was one of the
mutations turned out to be a polymorphism and the other mutation was so rare that the researchers
decided to throw it out. Then 15 of the mutations are considered to be supplementary mutations.
This means that they can be tested for by the Tag–It 40 + 4 test but, aren't on the ACMG screening
panel. So there are a total of 23 mutations on the revised Tag–It 40+4 carrier test.
13. What is the chance that Sarah is actually a carrier for a CFTR mutation, even though her Tag–It
test results came back negative? There

Gel Arabidopsis Case Study
RESULTS Agarose GE: Figure 1 shows the results of amplifying five types Arabidopsis thaliana
fwa gene. successful PCR was a result of nice bands showing in figure 1. Wild type undigested
(900bp), mutant undigested(860bp), and mutant digested (850bp) were all showing band in the same
location. On the other hand, Wild type digested did not show any bands meaning amplification did
not occur because McrBc digests fwa enzyme that is being methylated. Gel electrophoresis was
used to determine the size of the base pairs from the logarithmic equation. Digested and undigested
mutant genes showed hazy regions meaning they have less amount of amplification compared to
wild type undigested which shows a significant amplification. No band was shown for

Potential Benefits in Inequality? The Protective Role of...
Potential Benefits in Inequality? The Protective Role of U1 snRNP
Pre–mRNA in eukaryotes is spliced by the spliceosome, an RNA–protein complex, in which U1,
U2, U4, U5 and U6 snRNPs are equal components. However, U1 is more abundant than other
snRNPs in cells. U1 snRNP has been found to functions other than splicing, namely in protecting
pre–mRNA from premature cleavage and polyadenylation. This protective role may account for its
increased levels within cells.
In eukaryotic cells, pre–mRNA undergoes extensive post–transcriptional modifications to become
mature mRNA. The modifications to pre–mRNA include 5' end capping, 3' end cleavage and
polyadenylation, and the splicing of introns (Gu and Lima, 2005). The spliceosome is a large ...
Show more content on Helpwriting.net ...
It was seen that more introns were present in the U1 AMO cell transcripts than in the control,
showing that splicing was inhibited, and so that U1 is critical to spliceosome activity. U1 AMO
transfected cells were also compared to cells transfected with spliceostatin A (SSA), which inhibits
splicing. As splicing was inhibited in both sets of cells, it would be expected that the same intron
pattern would be seen, but this was not so. It was observed that in U1 AMO cells, introns tended to
terminate early, often within the first 3–5 kb, and that in these transcripts, a polyadenylation
sequence that is not encoded for by the genome was found at the 3' end. The polyadenylation
sequence was a consequence of a potential polyadenylation sequence (PAS) nearby. The differences
between U1 AMO cell and SSA cell transcripts suggest that U1 snRNP acts to protect pre–mRNA
from premature cleavage and polyadenylation (PCAP). To test this, a 5' splice site close to a cryptic
PAS was mutated. It was found that PCPA occurred both when U1 snRNP was available and when it
was not, suggesting that the binding of U1 snRNP to 5' splice sites directly helps to prevent PCPA.
Interfering with U1 snRNP within eukaryotic cells affects splicing, as would be expected, as it is a
key part of the spliceosome. However, it has been found that there are other, unexpected
consequences. It has been seen that as well as its role in splicing

The Casp8 Gene Encodes Caspase8
The CASP8 gene
Introduction
The caspases are a family of proteins that control inflammation, necrosis, and apoptosis. The
CASP8 gene encodes caspase8, which affects effector molecules. The mutation in this genes is often
linked with tumours and has hence evoked a general interest. In particular, the caspase8 protein is
linked with breast, lung and liver (hepatocellular carcinoma) cancer and more recently, caspase8–
deficiency.
Gene description
The CASP8 gene is located on chromosome 2 at band position q33–q34 (Flicek, et. al., 2014). In
terms of base pairs, on chromosome 2, it ranges from 201,233,443–201,287,711 base pairs on the
forward strand.
It has a total of 20 transcript variants (Table 1). The longest transcript being CASP8–002, ... Show
About 10% of the sequence is exonic and subjected to splicing. (Flicek, et. al., 2014) Exon / Intron
Start (bp) End (bp) Length (bp) 5 ' upstream sequence
1 ENSE00001406061 2012,58,036 2012,58,382 347 Intron 1–2 2012,58,383 2012,66,460 8,078
2 ENSE00003606605 2012,66,461 2012,66,791 331 Intron 2–3 2012,66,792 2012,71,515 4,724
3 ENSE00003641950 2012,71,516 2012,71,621 106 Intron 3–4 2012,71,622 2012,72,637 1,016
4 ENSE00003520750 2012,72,638 2012,72,776 139 Intron 4–5 2012,72,777 2012,72,897 121
5

Nucleotide Excision Repair And Translesion Synthesis Lab...
1.Explain the mechanisms of [nucleotide excision repair] and [translesion synthesis], and the main
differences between the two. Also include a concise comparison of the enzyme activities involved in
the two processes.
Answer:
Nucleotide Excision Repair: This mechanism can repair the large change caused by the damage in
the double helix of the DNA. The damage in the DNA is screened by the multienzyme complex,
these set of enzymes scrutinizes for any kind of lesions that may appear on the double helix. These
changes on the double helix are listed as; 1) Covalent Interaction of large hydrocarbons with DNA
bases (such as carcinogenic molecules found in the toxic substances like smoke, tar etc.), 2) Dimers
caused by the UV light from sun which causes pairing of pyrimidine bases, such as, T–T, T–C, and
C–C.
Once the enzymes find the lesion on the helix, it cleaves the phosphodiester backbone of the
abnormal strand on both sides of the strand. Then, the DNA helicase removes the single strand
oligonucleotide containing the lesion. The large gap produced as a result of the lesion is repaired by
the DNA polymerase and DNA ligase. The DNA polymerase adds new nucleotides and DNA ligase
seals the nick.
Translesion Synthesis: Translesion synthesis comes into play when DNA is further damaged beyond
the scope of repair by DNA polymerase. That is when a backup polymerase aides into the repair of
damaged DNA. They are mostly used when the need is necessary to avoid a potential danger to the

Eukaryotic Theory
Introns are nucleotide sequences universal amongst the Eukarya domain. Reconstructive models of
maximum parsimony and likelihood suggest introns were present in the last eukaryotic common
ancestor (LECA) (Csuros, 2005) and have since been gained, lost, and adapted to a multitude of
functions by separate lineages; any degree of intron conservation in modern eukaryotes is
suggestive of function, despite appearing to exist solely for removal. Although they possess many
valuable roles this does not explain the ubiquity of introns within eukaryotic genomes. To
understand their widespread presence despite their apparent deleterious effects it is necessary to
discern the evolutionary origins and conditions which impelled their prevalence. Structural ... Show
Per this theory, GpII invaded the eukaryotic lineage in its genesis via the mitochondrial
endosymbiosis and have been inserting themselves into coding genes continuously since; a
mechanism consistent with the high levels of GpII in some α–proteobacteria (Robart & Zimmerly,
2005) and the ability of yeast mitochondrial GpII to insert themselves into double stranded genomic
DNA (Zimmerly et al., 1996). Symbiosis–related selection pressure upon the α–proteobacteria
coupled with its bacterial nature of jettisoning unwanted genes caused the exchange of GpII and
cognate maturases (Schmitz–Linneweber et al., 2015) between the proto–mitochondrion and the
host cell which lacked the necessary control mechanisms to restrict their spread. Hence, the
proportion of introns in the LECA genome is considerably greater than in contemporary eukaryotic
lineages, excluding some vertebrates (Figure.1). Comparison of nuclear–encoded cytoplasmic
ribosomal proteins and mitochondrial ribosomal proteins showed that intron positions were
conserved (Yoshihama et al., 2006), suggestive of common descent between all eukaryotes.
However, the presence of introns presents significant problems to the host. Principally, random and
aggressive insertion of foreign gene elements is likely to disrupt essential coding sequences within
the host genome; hence, only neutral intron–insertions could persist. Additionally, splicing reactions
require the energetically expensive and complex machinery of the spliceosome, comprised of over
150 proteins and 5 snRNA units (Wahl et al., 2009), any fault in which would cause broad harm to
the cell (Chorev & Carmel,

Detection Using Principle Component Analysis And Case...
Splice site detection using principle component analysis and case based reasoning with support
vector machine
Srabanti Maji*1 and Haripada Bhunia2
1 Computer Science Department
Sri Guru Harkrishan College of Management and Technology, Raipur, Bahadurgarh;
Dist: Patiala,Punjab, India
2 Department of Chemical Engineering
Thapar University, Patiala–147004, India
*Address Correspondence to this author at
Dr. Srabanti Maji
Computer Science Department,
Sri Guru Harkrishan College of Management and Technology, Raipur, Bahadurgarh;
District: Patiala, Punjab, India
E–mail address: srabantiindia@gmail.com, srabanti9@gmail.com
Tel: +91–9356006454
ABSTRACT
Identification of coding region from genomic DNA sequence is the foremost step ... Show more
feature selection; and the final stage, in which a support vector machine (SVM) with Polynomial
kernel is used for final classification. In comparison with other methods, the proposed SpliceCombo
model outperforms other prediction models as the prediction accuracies are 97.25% sensitivity,
97.46% Specificity for donor splice site and 96.51% Sensitivity, 94.48% Specificity for acceptor
splice site prediction.
Keywords: Gene Identification, Splicing Site, Principal Component Analysis (PCA); Cased Based
Reasoning (CBR); Support Vector Machine(SVM)
*Correspondence to Srabanti Maji,
E–mail address: srabantiindia@gmail.com, srabanti9@gmail.com

Tel: +91–9356006454
Splice site detection using principle component analysis and case based reasoning with support
vector machine
1. INTRODUCTION
Research in the genome sequencing technology have been creating an enormous amount of genomic
sequencing data as its main objective is gene identification. In the eukaryotes, the prediction of a
coding region depends upon the exon–intron structures recognition. Whereas its very challenging to
predict exon intron structure in sequence due to its complexity of structure and vast length. Research
analysis on the human genome have nearly 20,000–25,000 protein–coding genes [1]. Still, there are
nearly 100,000 genes in human genome. Which indicates a huge number of genes are still
unidentified [2,3]. Most of the computational techniques

Virulence Factors Of Cryptoccus Neoformans
Cryptococcus neoformans (Cn) is a basidiomycete fungus that causes cryptococcosis worldwide in
immunodeficiency and healthy individuals. In this pathogen, the elaboration of virulence factors
including melanin and the capsule depends on intact intracellular trafficking, an essential cellular
process also required for nutrient uptake, ion homeostasis, and receptor recycling. Our previous
studies have found that Cn evolves a cryptococcal intersectin (Cin1)–regulated endocytic pathway
essential for growth and virulence. We have also obtained evidence linking Cin1 to extracellular
RNA through RNA–Seq and to CNS survival through co–infection of a mouse model of
cryptococcosis. However, how Cin1 governs the transport network affecting ... Show more content
on Helpwriting.net ...
Specifically, we will find if Cin1 orchestrates the only endocytic pathway and how it affects host–
parasite interaction through regulating exRNA transport and mouse CNS survival. We propose three
specific aims: Aim 1 is to determine if Cin1 mediates the sole endocytic pathway in Cn through
identification and characterization of pathway components. Aim 2 is to examine the role of Cin1 in
exRNA export through continued annotation and analysis of RNA–Seq data. Aim 3 is to further
explore the CNS survival advantage of Cin1–S by generating the Cin1–L strain using one–step
CRISPR–Cas9 mutagenesis method we recently developed and testing it through co–infection.
Our central hypothesis is that intracellular trafficking is important in pathogen growth and
interaction with a host resulting pathogenesis (our long–term goal). We propose those specific aims
to test the hypothesis that Cn evolves a distinct Cin1 endocytic pathway necessary for pathogenesis
(short term goal). Through studying a fundamental cellular process and its adaptation to
pathogenesis of Cn, our investigation could lead to the discovery of novel antifungal targets. 2.
Specific Aims
Cryptococcus neoformans (Cn) virulence depends on active transport of vesicles that contain
melanin and capsule precursors, proteinases, and other macromolecules. We found that Cin1 is
critical in mediating intracellular trafficking affecting growth and virulence and that Cin1–S isoform
exhibits a marked survival advantage in the

Spinal muscular atrophy (SMA) is a generic, lethal...
Spinal muscular atrophy (SMA) is a generic, lethal condition characterized by an inability to will
voluntary muscles as desired. The motor neurons responsible for exciting muscular contractions are
deficient and loss of usage in voluntary muscles results in their atrophy. Characterized early in life,
children with SMA exhibit difficulty in early voluntary muscular activities such as crawling,
sucking, imitation of facial expressions, and breathing. Three stage of SMA exist: SMA I for
children younger than six months, SMA II for children between 6–18 months of age, and SMA III
for all remaining children. For many affected individuals, life expectancy depends upon the time in
which symptoms began. The longer it takes for SMA ... Show more content on Helpwriting.net ...
Genetics of Spinal Muscular Atrophy
In 1995 a French group of researchers discovered that SMA is autosomal recessive disorder due to
loss of the survival motor neuron protein gene (SMN) (Lefebvre et al., 1995). Through
experimentation the researchers discovered two copies of the SMN gene in chromosome five [chr
5q13.2]: telomeric and centromeric SMN copies. Experimentation proved that loss of the telomeric
SMN (today known as SMN1) and not loss of its centromeric counterpart, SMN2, resulted in SMA.
It took an additional six years for researchers to glimpse at the functions provided by SMN1.
Meister et al. categorized the SMN1 protein an essential to promote correct assembly of U12 small
ribonucleoproteins (snRNPs). In genetics, snRNPs are nucleic proteins responsible for the splicing
of premature ribonucleic acid chains (pre–mRNA) derived from genes. Without correct splicing,
mature ribonucleic acid chains (mRNAs) produce dysfunctional proteins when translated. In this
case, splicing functionality of U12 – intron containing transcripts is lost, and because the transcript
is wrongly coded, its translation will produce a functionless protein. Hence, loss of SMN1 results in
an inability form U12 snRNPs splicing complexes, and reduced splicing functionality results in loss
of U12 – intron splicing functionality (Patel and Steitz, 2003). Only recently (2012) did researchers

Science Behind Technology : How It Was Discovered And...
3. How it was discovered & Science behind technology (455) (6)
SCRaMbLE (synthetic chromosome rearrangement and modification by loxP–mediated evolution)
is a method used to increase the phenotypic and genotypic diversity of organisms1. It relies on the
Cre–loxP system which consists of a Cre recombinase enzyme and a loxP site that directs the Cre
recombinase, making the system site–specific2. The Cre–loxP system was isolated from
bacteriophage P1 where it was described as being a mechanism used by the bacteriophage to insert
plasmid DNA into specific sites of the bacterial chromosome3, as well as recombination amongst
bacteriophages2. The Cre–loxP system was first tested in Saccharomyces cerevisiae (S. cerevisiae)
in 1987 and determined ... Show more content on Helpwriting.net ...
Using SCRaMbLE, it can be determined which combinations of S. cerevisiae genes produce viable
organisms by inserting loxP sites and sequencing the organisms produced as a result. The Sc2.0
project is being undertaken by many scientists across the world, each focusing on a separate
chromosome6. The SCRaMbLe system is utilised to make modifications in the created genome, as
without these induced modifications, the chromosome would be a duplicate of existing non–
synthetic chromosomes6, thus it would not be classified as a synthetic chromosome.
Sc2.0 has not been fully completed as of yet, however many of S. cerevisiae's chromosomes have
been synthetically made, the first of which was synIII, a synthetic version of Yeast Chromosome III,
which is 86.5% shorter than its naturally–occurring counterpart8. Overall 30% of the yeast
chromosomes have been entirely synthesised10, and there is still a large amount of work needed to
be completed to finish synthesising the incomplete synthetic chromosomes, as well as putting all of
the synthetic chromosomes together to make a synthetic yeast organism, where the synthetic
chromosomes have a minimal impact on function and viability. Experiments have been conducted to
determine if they can combine the function of three synthetic yeast chromosomes, synIII, synVI,
and SynIXR, which resulted in a slightly slower growth rate of the cells with all three synthetic
chromosomes11.
SCRaMbLE can be used as a genome

Rna Essay : Rna Self Splicing
Project I: RNA Self–Splicing
Kit Fung (Klaus) Chan
TA: Christopher Kampmeyer, Henry Sillin
Lab Section: 1B T/R 4pm–7:50pm
Group Member: Phuong (Nhu) Huynh
Group Number: 13
Date Submitted: 4/23/2015
This is my own original work. If any portion of found not to be my own original work, I will accept
zero points for this report in addition to whatever the Dean dictates. Abstract mRNA bears the role
of accurately conveying genetic information from DNA into protein (Nature), but there is an extra
crucial molecule between DNA and mRNA, which is the pre–mRNA. Pre–mRNA is the immature
single strand of complete transcript of the DNA which contains the exon and intron. In order to
become a mature mRNA, splicing has to occur to excise out the non–coding sequence (intron) and
connect the coding sequences (exons) to render the correct targeted product. There are two groups in
splicing reaction, in this project, the self–splicing reaction that is catalyzed by group I intron from
the plasmid of Twort bacteriophage, along with the role of arginine in the self–splicing reaction will
be closely examined using gel electrophoresis. The plasmid was linearized by restrictive enzyme
and was loaded into a 0.8% agarose gel to confirm the presence of digested DNA. Upon
confirmation, sample solution with different arginine concentration were mixed along with the
digested DNA and loaded into the 2% agarose gel to confirm if self–splicing has occurred. The
image from the 2% agarose gel confirmed

Length Polymorphisms
Restriction enzymes recognize repeated or double stranded sequences in the DNA, which are also
known as palindromes (meaning that they read the same in opposite directions)
Polymorphisms are when one gene has multiple alleles and cause morphs in different organisms.
RFLP stands for Restriction Fragment Length Polymorphisms. RFLPs are used to distinguish
between people's DNA. This is because since the distance between the repeated palindromic
recognition sites vary from person to person, the amount of repeats within all the DNA differs too.
When the enzymes cut at these sites, it results in fragments of different size and length. Except for
identical twins, every person has a unique set of these fragments, so the RFLP can help to tell
people apart.
The RFLP banding pattern of each person is different because ... Show more content on
Helpwriting.net ...
This is because when samples of DNA are obtained from the mother and father, the child's DNA
will be a composite (or a combination) of its parents. Also, the bands in the child's DNA fingerprint
that are not present in the mother's DNA is present in the father's DNA, so it can be distinguished
which parents created which child.
Procedure Questions:
Agarose is a polysaccharide that is used especially in gels for a process called electrophoresis. It is
used in DNA fingerprinting because it slows down the speed at which the DNA migrates from the
negative pole to the positive pole so that the process is easier to visualize and to gather results from.
In addition to this, the agarose also creates the actual gel that is being manipulated.
The percent of agarose gel used in the lab is .8%. The amount of agarose used makes a difference in
the fingerprinting procedure because since agarose gel is the environment around the polymers, (aka
the matrix) then the higher the percentage of agarose, the denser the matrix. Also, the denser the
matrix, the harder it is for the DNA to pass it when it travels to the positive

Phenylketonuria (PAA)
Introduction
Phenylketonuria (PKU, OMIM 261600) is an autosomal recessive metabolic disorder primarily
caused by a deﬁciency of the hepatic phenylalanine hydroxylase (PAH, EC 1.14.16.1) enzyme
responsible for converting phenylalanine (Phe) to tyrosine in the presence of cofactor
tetrahydrobiopterin (BH4) and molecular oxygen. (Viecelli et al 2014) Definitive characteristic of
the disease is the impaired postnatal cognitive development resulting from a neurotoxic effect of
phenylalanine accumulation also known as hyperphenylalaninemia (HPA) (Scriver 2007). The
disease is caused primarily by mutations in the phenylalanine hydroxylase (PAH) gene, encoding for
(PAH) enzyme. Phenylalanine hydroxylase converts L–phenylalanine (Phe) to L–tyrosine ... Show
Proximal region of the PAH promoter contains necessary and important cis–elements for its tissue–
specific expression. During embryonic development, transcription of the PAH gene and its
expression begins at a very early stage in human. Whereas in rats and mice, it begins as late as 2–3
days before birth. Mutations in the PAH gene result in the deficiency of phenylalanine hydroxylase
(PAH) enzyme, a main characteristic of PKU). More than 500 different PAH mutations have been
identified in the PAH gene (Fazeli et al 2011) making it difficult to come up with a universal
treatment for the

Mechanisms for mRNA Degradation
Messenger RNA (mRNA) is extremely important in expression of protein–coding genes. mRNA
molecules contain the genetic code for synthesis of particular polypeptides during translation.
(Lewin's Genes XI, 624) Messenger RNAs are unstable molecules due to the fact that cells have
ribonucleases. These ribonucleases can specifically target mRNA molecules in the cytoplasm. There
are two types of ribonucleases. Endoribonucleases cut the center of the RNAs, and exoribonuleases
detach the ends of RNAs. (Lewin's Genes XI, 625) The stability of mRNA is essential in controlling
gene expression. Less stable RNAs are more likely to undergo changes in transcription rates, and the
more stable RNAs are able to go through translation for longer periods of time. (Lewin's Genes XI,
626)
There are several pathways in which mRNAs are degraded. However, the two most common
pathways are deadenylation dependent. This means that the degradation process is originated by
breaching their protective poly(A) tail. The new poly(A) tail produced is covered in poly(A)–
binding proteins (PABP). Certain poly(A) nucleases catalyze the steady shortening of the poly(A)
tail as it enters the cytoplasm. The PAN2/3 complex originally shortens the poly(A) tail. Then,
CCR4–NOT complex degrades the rest of the poly(A) tail more quickly, only leaving 10 to 12 bases
remaining. (Lewin's Genes XI, 629–30)
The first of the two common pathways is the 5' to 3' pathway. First, decapping enzymes comprising
of

Histones In Research Paper
Histones are proteins that are found in the nucleus of the Eukaryotic cells. Histone proteins function
is to condense and package DNA in units called nucleosome. There are four core histones known as
H2A, H2B, H3, and H4. Core histones can be paired up with each other to form H2A–H2B dimers
and two copies of each H3 and H4 histones can paired up to form a H3–H4 tetramer. The histone
octamer is form when a H3–H4 tetramer is combined with 2 H2A–H2B dimers.
Aside from the four core histone proteins, there is also histone H1 and H5. Histone H1 serve as a
linker protein and keep the piece of DNA that is wrapped around a nucleosome in place.
Furthermore, histone H1 also help in condensing and maintaining the chain of nucleosomes into
higher order ... Show more content on Helpwriting.net ...
Exon are regions that contain that can code for proteins, on the other hand, intron are non–coding
regions of an RNA. From 5' to the 3' direction on a premRNA there are GU and AG regions
respectively that signal where the beginning and end of an intron are. The 5' end of an intron is also
known as the donor site and the 3' end of the intron is known as the acceptor site. At the beginning
of the splicing process, snRNPs and other RNA–proteins combine to form a spliceosome at the
donor site or 5' GU region. The spliceosome folds the premRNA so that the exons are closer
together, then the 5' GU region between the intron and exon is cleave, then the guanine locate on the
cleaved 5' end of the intron will get attracted to a hydroxyl group on the adenine group at the 3' end
of the intron. This will cause the intron to form a loop with itself called the Lariat loop. The point
where the intron is connected to itself is call the branching site. Once a Lariat loop is formed, the 3'
end of the intron is cleaved and the two exons is join together, both process is done by a
spliceosome. The final product is an

What Is Transactive Response Rna Binding Protein 43 )?
Transactive response DNA binding protein 43 (TDP–43) has a molecular mass of 43 kDa and a
multidomain structure that is composed of 414 amino acids, which is encoded by TARDBP (Bozzo
et al., 2016; Chang et al., 2012; Igaz et al., 2011; Koyama et al., 2016). TDP–43 is a highly
conserved DNA binding protein located in the nucleus for gene transcription (Chang et al., Igaz et
al., 2011; 2012; Koyama et al., 2016; Neumann et al., 2006; Xu et al., 2012). However, a large
number of RNA binding sites have been identified for TDP–43 that allow for pre–mRNA splicing
and translational regulation including its own 3' untranslated region 3'UTR (Ayala et al., 2011;
Chang et al., 2012; Koyama et al., 2016; Xu et al., 2012). Similar to SOD1, TDP–43 is ... Show
Approximately 3% percent of patients with familial ALS have a mutation in the TARDBP gene,
however, TDP–43–positive cytoplasmic inclusions have been observed in approximately 97% of
ALS as well as 45% of FTLD cases (Bozzo et al., 2016; Liu et al., 2014, 2015; Yamashita et al.,
2012). 3.1. Affect of TDP–43 knockout and loss of nuclear TDP–43 on RNA processing. The gain–
of–function models have reported to achieve affects of neurodegeneration and ALS–like symptoms
from TDP–43 overexpression in dose–dependent manner experiments (Bendotti et al., 2012; Broeck
et al., 2014; Xu et al., 2012). However, the amplitude of the loss–of–function experiments also
achieves a similar neurodegenerative affect through knockdown of TDP–43. Although gain–of–
function experiments support evidence for cytoplasmic inclusions resulting in toxicity, it remains
insufficient in the explanation of the depletion of nuclear TDP–43 (Bendotti et al., 2012; Broeck et
al., 2014; Xu et al., 2012). The loss–of–function and the gain–of–function proposal support the
neurodegenerative affects of ALS pathogenesis but the intrinsic mechanisms are still largely
unknown and each result in the accumulation of insoluble protein aggregates (Bendotti et al., 2012;
Yamashita et al., 2016). Both ALS and FTLD feature a depletion of TDP–43 and the accumulation
of cytoplasmic inclusions. TDP–43 silencing allows researchers to better understand the effect of its
depletion on the cell.

Sarcoidosis Research Paper
As previously stated, Sarcoidosis is a disease of unknown cause, and scientists are continuously
researching its exact origins. Scientists know that immune cells emit chemicals that signal other
cells to come protect an organ from a toxic substance. Subsequently, this causes inflammation in
one's body. In Sarcoidosis patients, this swelling does not recede but forms granulomas of immune
cells on an organ. Some scientists theorize that an external trigger such as bacteria or dust may lead
to the onset of symptoms. Also, research strongly supports that Sarcoidosis occurs from the genetic
inheritance of mutations in multiple genes. Gene mutations are changes in one or few nucleotides in
a single gene. One gene affiliated with Sarcoidosis is gene

Crouzon Syndrome Research Paper
Crouzon Syndrome is an autosomal dominant disorder of the first branchial arch, which acts as a
precursor to the maxilla and mandible. The disease was originally known as craniofacial dysostosis,
referring to the malformation of bone around the face. The malformation of bone is due to early
fusing of an infant's skull and facial bones, or the bones' inability to expand correctly. Common
symptoms that arise from the disease include low–set ears, bulging eyes, relatively large distance
between the eyes, and a beak–like nose. The major genetic cause of Crouzon Syndrome is a
mutation occurring in a gene known as the fibroblast growth factor receptor 2 (FGFR2) gene that
resides on chromosome 10, which encodes for the FGFR2 protein. This protein is involved in many
bodily processes such as wound healing and embryonic development. Due to the widespread
importance of the FGFR2 gene, mutations can have morbid and fatal consequences.
The Disease
Crouzon Syndrome is a genetic disorder causing first branchial arch impairment, resulting in the
skull and facial bones fusing prematurely (craniosynostosis). Early fusion results in the inability to
adopt regular ... Show more content on Helpwriting.net ...
Additionally, reduced growth of the midface (hypoplastic maxilla) results in the chin appearing to
protrude further than normal (mandibular prognathism). One symptom that is not representative of
the failure of the first branchial arch, is that those with Crouzon Syndrome tend to have shorter
humerus and femur bones, compared to those without the disease. In more severe forms of the
disease syndactyly (fusing of digits) can also

The Roles Of DNA : The Development Of Complex Proteomes
The development of complex proteomes without a comparable increase in gene number is due to the
different patterns of splicing by the spliceosome machinery. Not only are there mechanics to
consider with the spliceosome complex, but there is a kinetic component to splicing as well
(Larochelle, 2017). When a DNA sequence is transcribed into a pre–mRNA sequence, it includes
exons and introns, which are coding sequences and noncoding sequences respectively. The introns
are removed through a two–step cleavage–ligation reaction using a spliceosome. 5′ and 3′ splice site
(SS) consensus sequences outline the intron–exon boundaries. In the first step, the 2' hydroxyl group
on the nucleotide on the branch site strikes the 5' splice site, and the ... Show more content on
Helpwriting.net ...
Whether a transcript is degraded or translated into product is linked to ATP hydrolysis, but fidelity
of the sequence also plays a role. This "kinetic proofreading" is especially utilized in mRNA
splicing. Kinetic proofreading allows for additional specificity to the regulation and creation of an
accurate product through an irreversible step that causes the reaction intermediate to leave the
pathway of splicing to become degraded if a mutation is detected. If that step occurs quickly in
relation to the rest of the pathway, then the specificity can increase greatly (Hopfield, 1974). The
mutant prp–16 is created through a single nucleotide polymorphism, as an A nucleotide is
exchanged for a C nucleotide, interchanging one different amino acid in the product (Burgess,
1993). The mutant product acts slower in the kinetic proofreading process occurring during mRNA
splicing by decreasing the activity of the ATPase, which can allow mutant mRNA products to
proceed through the pathway to become a protein by not sending them down the discard pathway.
Currently, there is a gap in knowledge about the importance of molecular clocks and the possible
effects of alterations to them. Molecular clocks regulate several processes, such as the circadian
rhythm and the immune system, that occur within an organism, so changing them could cause a
multitude of effects (Curtis 2016). A possible and detrimental effect of slowing down

Genetic Dna And Bioinformatics ( Accession No. Xp Essay
RESULTS
Isolation of BbovM17LAP gene
The BbM17LAP gene available in GenBank (accession no.
XP_001609968) was accessed through the National Center for
Biotechnology Information (NCBI), and its sequence was retrieved for further analysis. The
genomic DNA of BbM17LAP was found in chromosome 2, extending between 1,045,409 bp and
1,047,164 bp of the genome. The ORF of the corresponding mRNA encoding BbM17LAP consists
of 1,578 bp. Alignment of the mRNA sequence with genomic DNA using Genetyx revealed that the
gene has 4 introns within its ORF. The first one was a 33– bp intron (50–
ggtatgtttgtttgaatactgctgaatctgtgta–30) situated near the 50 end of the gene. The other nucleotide
sequences included a
35–bp (50–agatacttacagtaacgatacaagttcatgtaggt–30) intron, a 34–bp
(50–tgggttacactctttatgctatatttgttatagg–30) intron, and a 40–bp (50–
gtaagttaattgggctacaagaagcgtaatatacatacag–30) intron all located close to each other near the 30 end.
Isolation of BbovM17LAP cDNA and bioinformatics analysis
A pair of primers targeting the ORF of BbM17LAP was used to amplify and sequence the gene from
a B. bovis cDNA expression library. This BbM17LAP cDNA encoded a predicted
55–kDa protein without a signal peptide. The translated
BbM17LAP polypeptide shared significant homology with B. gibsoni M17LAP, having 71% amino
acid identity and similarity
(E value¼0). The other significant homologues included Theileria parva and Theileria annulata M17
LAPs, both having 61% amino acid identities. The polypeptide

The Over Expression Of Nad
Is the over–expression of NAD(P)H Quinone Oxidoreductase–1 (NQO1) good or bad for the cell?
Abstract:
NAD(P)H quinone–acceptor oxidoreductase (NQO1) is an enzyme that is responsible for reducing
quinones to hydroquinones in the cell. This minimizes the generation of reactive oxygen
intermediates by redox cycling and also depletes the intracellular thiol pool. NQO1 consists of 2
catalytic sites which uses NAD(P)H as an electron donor in order to form hydroquinones. The
metabolic activation of a variety of quinone–based anticancer agents occurs, in part, as a result of
the bioreductive activation by NQO1. Its association with p53 gene results in proteosomal
degradation in the nucleus, thereby broadening the cyto–protective role far beyond ... Show more
So this reaction prevents cells from being a victim of oxidative stress and acts as a defence
mechanism for the cell (2). Figure 1 shows the two, single electron reductions of benzoquinone to
form benzo–semiquinone and benzo–hydroquinone, respectively. NQO1, directly, reduces
benzoquinone by adding 2 electrons at the same instance, effectively skipping the step that forms
semiquinone(2).
NQO1 plays a dual role in the detoxification of quinones by preventing the formation of reactive
oxygen species (ROS) and activation of pro–carcinogens that leads to cancer chemoprevention.
Semiquinones are excellent free radical generators, initiating a redox cycle causing O2−formation
[2]. O2− dis–mutates to H2O2 and molecular oxygen, and H2O2 is further reduced to the hydroxyl
radical and OH: via the Fenton reaction, shown in fig 2. Figure 2 shows the Hydroxyl radical
generation from Fenton and Photo–Fenton reactions.
Hydroxyl radical, product of the Fenton reaction, the most destructive species among oxygen
radicals, is highly toxic and capable of attacking DNA, and oxidizing guanine bases resulting in the
formation of mutagenic 8–hydroxy–2 '–deoxyguanosine (8–oxo–2dG) lesions. Among the purine
and pyrimidine bases of DNA, guanine is the most sensitive base to oxidation. During an oxidative

The Process of Gene Expression
The process of gene expression is used by all known life known as eukaryotes which include
multicellular organisms, prokaryotes like bacteria and Achaea, and viruses which generates the
macromolecular machinery for life. Gene expression is what "turns on" the genes and makes a
product. The products made could be an enzyme, a protein, or a control molecule. These products
are often proteins, but in non–protein coding genes such as mRNA genes or tRNA genes, the
product is a functional RNA. The order of gene expression is transcription, RNA processing, then
translation. The control of transcription: this is the first step of gene expression when a particular
segment of DNA is copied into RNA by the enzyme RNA polymerase and is then a joined
mechanism. During transcription, a DNA sequence is read by an RNA polymerase, which produces
a corresponding, antiparallel RNA strand called a primary transcript. The order that transcription
goes in would start with the initiate transcription from a gene by binding the RNA polymerase to the
promoter DNA. A promoter is a region of DNA that initiates transcription of a particular gene. The
RNA polymerase then splits the double helix DNA molecule into two nucleotides. When doing this
the breaking down of the hydrogen bonds between DNA nucleotides occurs. The RNA and DNA
helix's break apart and the new RNA strand is complete. If the cell has a nucleus, it will then be
processed again which will then exits to the cytoplasm. During this process a

Hint1 Lab Report
Design, synthesis and in vitro characterization of an 5′–OH nucleoside carbamate inhibitor of Hint1.
Our lab has shown that Hint1 can hydrolyze acyl–adenylates and nucleoside phosphoramidates
substrates to generate nucleoside monophospates. We were also the first to design a nucleoside
inhibitor of Hint1 by replacing the phosphoramidate backbone in the substrate with a non–
hydrolysable carbamate backbone. The designed inhibitor contains guanosine nucleobase instead of
an adenosine to avoid off target effects associated with inhibiting other adenylating enzymes in
vivo. The designed inhibitor contains a tryptamine side chain coupled to a 5′–OH gunanosine
nucleoside with a carbamate backbone or linker (TrpGc). The reported synthesis of the inhibitor ...
Show more content on Helpwriting.net ...
Nevertheless, our initial attempts with the reported procedure to isolate the intermediate were
proven futile and low yielding due to high reactivity and instability of the intermediate. To
circumvent this problem, I revised the synthesis under one–pot reaction condition without the need
for the isolation of the intermediate. Activation of the protected guanosine with 1.2 equivalent of the
chloroformate and subsequent addition of an excess amount of the tryptamine (4 eqvi) resulted in
the coupled product. Isolation and deprotection of the coupled product resulted in the final product
with more than 70% yield. Next, we investigated the effect of TrpGc on the activity of hHint1 using
a fluorescence assay described previously.3 At a fixed saturating substrate concentration, TrpGc
exhibited a dose dependent decrease in the activity of hHint1 with maximum half inhibitory
concentration (IC50) values of 25.5 ± 6.0 μM (Fig 1). We next employed isothermal titration
calorimetry (ITC) to investigate the nature of non–covalent interactions on the inhibitory activity of
Bio–AMS on hHint1. The ITC studies provided an experimental dissociation

Lmna (C1824T). Patients Who Suffer From Hgps Are Mostly
LMNA (C1824T) Patients who suffer from HGPS are mostly affected by the same single base
substitution mutation within the LMNA (C1824T) gene. 90% of these patients suffer from this
particular mutation (Prokocimer 2013). A single base substitution mutation is where one "letter" is
not copied right and it in turn throws off the entire sequence, which could result in coding different
amino acids and also could code to "stop" and form an incomplete protein of which may not
function correctly, or at all. This mutation in LMNA (C1824T) is created by abnormal splicing in
exon 11. This creates a cryptic splice cite where 50 internal amino acids are deleted (Swahari 2016).
The result of this internal deletion of amino acids is the permanent ... Show more content on
Helpwriting.net ...
Before leaving the nucleus the pre–mRNA may go through a process called RNA splicing
(Brooker). During this process the undesirable introns are disposed of while the coding sequences,
exons, are spliced together to form messenger RNA (Brooker). Understanding RNA splicing, the
most important process that may alter a protein's shape is alternative splicing (Brooker). This
process allows one strand of pre–messenger RNA to produce several different polypeptide
sequences (Brooker). One pre–mRNA can create multiple polypeptide sequences which in turn
creates proteins that are distinctive from each other. Alternative splicing is seen in the LMNA gene,
it produces Lamins A and C (Swahari). Although they are different proteins, they are believed to be
functionally redundant (Swahari). During the formation of these proteins a farnesyl group, which
embeds into the cell membrane, is added to one end and later the protein is cleaved at a recognition
site in exon 11 removing the tip and the farnesyl group (Swahari). Due to the point mutation linked
to HGPS 50 amino acids are removed, within these is the recognition site (Swahari). As a result the
protein is permanently farnesylated and known as progerin (Swahari). This protein imbeds and
accumulates in the cell membrane creating the symptoms of HGPS (Swahari).
Gene Mutation
All adults and even children produce the protein called progerin. Progerin is a

Similarities Between Prokaryotic And Eukaryotic Cells
Cells were divided into two, which are, prokaryotic and eukaryotic cells. Examples of prokaryotic
cells are Bacteria and Archae, while the examples of eukaryotic cells are Protists, Fungi, plants and
animals. All cells share certain basic features, but the major difference between prokaryotic and
eukaryotic cells is their DNA. Thus, these two cells have different features on DNA transcription
and protein synthesis mechanisms. The general processes of transcription may be applied to both
prokaryotic and eukaryotic cells as their basic biochemistry was the same. But, they are differs in
their specific mechanisms and regulation of transcriptions. In all species, the process of
transcriptions begins with the binding of RNA polymerase complex to a special DNA sequence at
the beginning of the gene, which named promoter. The activation of RNA polymerase leads to
initiation of transcription and followed by elongation of transcription. And these two cells were
different in these elements. ... Show more content on Helpwriting.net ...
In contrast, eukaryotic cells are more complex than prokaryotes as their transcriptions process are
utilize by three different types of RNA polymerase. These polymerases differ in number and type of
subunits they contain and also the class of RNA they subscribe. RNA polymerase I, which located in
the nucleolus, transcribe ribosomal RNA (rRNA), RNA polymerase II, which located in the
nucleoplasm, transcribe messenger RNA (mRNA) and RNA polymerase III, which also located in
the nucleoplasm, transcribe both ribosomal and transfer RNA (tRNA). All eukaryotic RNA
polymerases are homologous to one another and to prokaryotic RNA

Ecrna Synthesis Essay
Currently, circRNAs consist of three subclasses based on their generating pathways (Figure 1). The
most popular circRNA is the exon–derived circRNA (ecRNA), containing only exons and
completely lacking introns [16]. Two mechanisms, including both exon skipping and direct
backsplicing, have been proposed to explain ecRNA biogenesis [13,25,36]. In terms of exon
skipping, the downstream exon turns around to link the upstream exon, producing a circular and
exon–skipped transcript [13,37,38]. By contrast, the direct backsplicing first generates alternatively
spliced RNA and a lariat intermediate regulated by the intron–pairing mechanism. The introns in the
lariat are then removed by the canonical splicing process [7,21,39–41]. Recent evidence indicates
that direct backsplicing, not exon skipping, may be the primary mechanism regulating ecRNA
formation [42]. ... Show more content on Helpwriting.net ...
However, the mechanism regulating the migration of mature ecRNAs into the cytoplasm remains
unclear. The linear counterparts of circRNAs, such as mRNAs or lncRNAs, can penetrate the
nuclear membrane through the nuclear pore complex. Therefore, some researchers put forward the
hypothesis that ecRNA export may be regulated by a mechanism similar to the regulatory
mechanism of linear RNA migration [18]. The degradation pathway of circRNAs is another
unanswered question. The expression level of circRNA is dynamically modulated by the balance
between biogenesis and degradation of circRNAs. CircRNAs may be degraded by short interfering
RNAs [13]. A recent study found that circRNAs may be cleared by extracellular vesicles or
microvesicle release in mammalian cells [43]. However, this conclusion is based on an in vitro
study. Whether circRNAs are degraded in vivo by a similar mechanism still needs further

Glt2 Task 2
MBG110 04.12.2015
HOMEWORK II
Name: İsmail Serdar Taşkafa
ID: 21501927
1– (30 pts) There are many stages after transcription which regulate gene expression. What are these
additional regulatory mechanisms? Describe each of these stages.
1– RNA processing: In eukaryotic cells, introns, non–coding regions of RNA, are removed and a tail
and a cap is added to RNA to help its movement.
2– RNA transport: RNA is transferred from nucleus to ribosome to initiate translation.
3– Translation: According to the genetic information of mRNA, polypeptide is synthesized.
4– mRNA degradation: After translation, the used mRNA is degraded by miRNA's.
2– (20 pts) a) What are DNA microarrays? In which areas are they used?
DNA microarray is a grid that is composed of spots that contains uniform DNA strands. DNA
microarrays are used to identify which genes are expressed on a given cell type. ... Show more
RNA–Seq ( RNA sequencing) or whole transcriptome shotgun sequencing and serial analysis of
gene expression (SAGE or superSAGE) can be used to detect changes in gene expression.
3– (30 pts) miRNAs, which are a class of small RNAs, can function as oncogenes or tumor
suppressors in cancer. Explain one disease, other than cancer, that can be associated with miRNAs
or other small RNAs.
MS (Multiple sclerosis) can be associated with miRNAs. Multiple sclerosis is a chronic, mostly
progressive neurodegenerative disease that involves damaging of nerve cells' covering. In MS,
microRNAs are disregulated in the immune

Mitosis And Eukaryotic Analysis
Life starts out in organisms that are so small and complex even the naked eye can't see. It starts from
the zygote and ends up becoming the person you are today! It all starts from a cycle, when
fertilization, the fusion of two haploid gametes, (the sperm and the egg) forms a diploid zygote. This
is how the chromosome number in a life cycle changes from haploid to diploid (23 to 46). A lack of
chromosomes or having more than 23 chromosomes can cause syndromes like Down Syndrome or
Turner Syndrome, which will be discussed later. Mitosis is the division of a haploid or diploid cell
into two duplicate daughter cells. Mitosis is basically the division of a nucleus into two duplicate
cells, and both have the same number of chromosomes. These identical cells are called totipotent
cells, which have the ability to develop into new organisms. A good example of cell division in
haploid cells is how the male honey bee develops from an unfertilized haploid cell. For humans,
each cell contains 50% DNA from mom and other 50% from dad. Since these cells are eukaryotic,
they include both introns and exons. Exons are the nucleotide segments in genes and introns are non
coding regions. In ... Show more content on Helpwriting.net ...
5'3' Frame 1
X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X
X X X X X X D X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X
X X X X
5'3' Frame 2
X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X I
X X
5'3' Frame 3
X X X
3'5' Frame

Hemophila Mutation
A large number of mutations for Hemophilia A have been detected and identified. The most
common mutation found is the intron twenty–two inversion and intron one inversion of the Factor
VIII gene. This mutation occurs in 40–50 percent of people with Hemophilia A. It is caused by the
homologous recombination between copies of a DNA sequence. One copy is located on the intron
22 region of factor VIII and the other copies are distal to the factor VIII. Intron one of the factor
VIII gene occurs when the factor VIII gene is split which results in the production of two chimeric
mRNAs. One of the mRNA has have the exon of the factor VIII and the exons 2–6 on the exon gene
of the VBP1 gene, which codes for the subunit of prefolding. The second mRNA has all exons
except the last exon of the BRCC3 gene. Other patients that have Hemophilia A acquire the ... Show
According to Keeney, Mitchel, & Goodeye (2010), this is done through PCR amplification. PCR is
a method used to amplify a copy of a piece of DNA, which will result in millions of copies of a
specific sequence. To detect the intron 1 inversion of factor VIII, the specific sequence is amplified,
which is the intron 1 homologous sites. When the amplification occurs, the fragments are separated
through electrophoresis and scientists can determine if there is a problem in the gene responsible for
Hemophilia. The gold standard method for Hemophilia A is DNA sequencing. It will detect the
mutation in the affected male and the female carrier. In using direct sequencing, analyze a single
nucleotide polymorphism to track the defective X–chromosome in the family. In addition, scientists
can detect the essential regions of factor VIII, such as the promoter region, and all the exons and
intron/exon boundaries. This method is cost effective and provides sufficient results (Keeney,
Mitchell, & Goodeve 2010). Treatment of Hemophilia

Advantages And Disadvantages Of Retinitis Pigmentosa
Inherited retinal disorders affect millions of people worldwide (1). With more than ten types of
diseases and around 200 identified genes, is considered a complicated disease (2). As a member of
inherited retinal disorders, retinitis pigmentosa (RP) is a progressive rod and cone photoreceptor
degradation that leads to tunnel vision, night blindness and finally complete blindness. Disease
prevalence range from 1 in 3000 to 1 in 7000 individuals (3).
The disease inherit in autosomal recessive (50–60%), autosomal dominant (30–40%) and X–linked
(5–15%) forms. Although, non–mendelian inheritance like digenic and mitochondrial patterns have
been observed (4–6). Syndromic RP includes 20–30% of patients and is defined when, retinal
degradation is ... Show more content on Helpwriting.net ...
PCR reaction was carried out in a 25 μl reaction mixture under standard condition, contained 1x
buffer, 0.2 mM of four dNTPS, 1.5mM mgcl2, 1 pM of forward (sequence) and reverse (sequence)
primers and 50ng of genomic DNA. Initial denaturation at 95˚C for 4 min was followed by
denaturing at 94˚C for 30 seconds, annealing at 60˚C for 30 seconds and extension at 72˚C for 30
seconds for 32 cycles. The final extension was 8 min. The amplicons were run on an ABI 3130x
(Applied Biosystems, Foster City, California,

Differentiated Fern Research Paper
Differentiated fern cells can regrow the entire organism. Every plant cell contains all the genetic
information needed, and differentiation doesn't permanently change the DNA.
Most genes in plants and animals contain regions that code for polypeptides, called exons, with
noncoding sequences called introns in between. Both introns and exons are transcribed from DNA
to RNA, then RNA splicing occurs to remove the introns. Introns can contain nucleotide sequences
that regulate gene activity. The splicing process may contribute to controlling the flow of mRNA
from nucleus to cytoplasm. Sometimes splicing occurs in different ways, to produce different
mRNA molecules from the same transcript. A homeotic gene controls most of the functions during
development. It regulates the other genes, switching them on ... Show more content on
Helpwriting.net ...
When lactose is present, it will bind to the repress or and change the repressor's shape so it cannot
bind to the operator. This allows gene transcription and the creation of lactase enzymes. If a
mutation occurred that changed the shape of the repressor, the genes for making lactose would never
stop undergoing transcription.
Liver cells are small and the make/break down many substances. Liver cells also create fibrinogen,
a protein that forms blood clots. Muscle cells are long and thin so they can contract and shorten.
Salivary gland cells secrete saliva. Genes for making fibrinogen are active in liver cells, but not in
any of the cells named above. All of the named cells preform glycolysis, as they all break down
sugar. The gene that codes for hemoglobin would not be active in any of these cells.
The minimum number of nucleotides needed to code for the the protein is 777(258x3 + the stop
codon). There are many codons before the start codon and after the stop codon, only the 751
between the two actually come for a

Group 2 Intron Synthesis
1.1.2 Group 2 introns
After the discovery of group 1 introns group 2 introns were found in Azotobacter vinelandii which is
a proteobacteria, in Calothrix cyanobacteria spp (Ferat and Michel 1993) and also in Escherichia
coli (Ferat et al,. 1994). Previously group 2 introns were known to be existed only in mitochondria
and chloroplast of plants and fungi, because of the similarity of group 2 splicing mechanism to the
nuclear pre–m RNA introns. So it is believed that group 2 introns are the evolutionary ancestors of
the nuclear pre–mRNA introns (Sharp 1991).
Like nuclear pre–mRNA splicing, even the group 2 splicing start when 2' OH of a stick out
nucleotide attacks the 5' splice site, this result in the formation of a 2'–5' bond and a lariat ... Show
2005). It has at least 3 open reading frames that can encode reverse transcriptase and DNA/RNA
hybrid molecule– msDNA (multicopy single stranded DNA). Of this ORF product, the amino acid
sequence can be range from 298 to 586 amino acids, this is an easily recognizable RT that is similar
to RTs of eukaryots(Lampson et al,. 1989b).
This msDNA is usually small single–stranded cDNA molecule bound covalently to an RNA
molecule which can fold into a stable secondary structure. Eventhough still there are no proof to
conform retrons as mobile elements, copies of inserted msDNA can be found in bacterial genome
(Lampson and rice 1997). In E. coli overexpression of some msDNAs has increased the number of
base substitution mutations and frameshift mutations (Maas et al,. 1994). When most cellular
mismatch repair proteins bind with mismatches on msDNA molecules it increase the mutagenic
level. During matings of E. coli and Salmonella cells when some msDNAs are overexpressed it
increase the recombination between donor and recipient DNA sequences, because of the action of
mismatch repair usually the interspecific recombination frequency is normally reduced (Maas et al,.
1996). Even though the function of msDNA is still unknown it helps the bacteria to increase their
mutations when the mutations are required for their survival. These retrons

The Physics Of Splicing And Splicing
3. Conclusions
Compared to the molecular methods, the optics–based method offers several advantages such as the
kinetic study of splicing and splicing inhibition, study of cis–trans alternative splicing, and rapid
measurement of RNA splic–ing. The kinetics of pre–mRNA splicing and the effect of isoginkgetin
on the splicing kinetics of the pre–mRNA at the single molecule level were analyzed. Because of
their high temporal resolution and the ability to follow the splicing of individual pre–mRNA
molecules, the optics–based methods provide the evidences about the relative stabilities of weakly
stabilized RNA molecules and their lifetimes. This observation attributed to the formation of mRNA
molecules that are the results of the splicing of pre–mRNA. The kinetics and course of monitoring
of pre–mRNA splicing was directly reached by 10 min, and are not able to be monitored by the
conventional assay. The appearance of scattering intensity and SERS spectra indicates the success in
monitoring RNA splicing; and the RNA splicing inhibition assay confirms that the optics–based
methods can be used in study of RNA splicing inhi–bition. Moreover, the optics–based methods are
able to detect alternative splicing, the RNA splicing for multi exon–intron pre–mRNA, generation of
microRNA from intron of RNA processing events (e. g., maturation of microRNAs), and the siRNA
maturation from the processing of host mRNAs, which are hot topics for the re–search of cancer,
molecular immunology, and

Symptoms And Treatment Of Xeroderma Pigmentosum
Xeroderma Pigmentosum is also known as XP and is a disease where the skin of a person is
sensitive to UV light. The biological process that isn't functioning correctly in XP is the ability of
cells to repair damage to DNA caused by the sun and UV radiation. UV damage to DNA of cells
must be removed during DNA repair. Patients with XP have a mutation to a gene that is required in
DNA excision. It is this mutation that leads to clinical symptoms observed in patients. The clinical
symptoms of Xeroderma Pigmentosum include skin lesions and pigementation. In addition, many
patients also show symptoms of ocular manifestations and mental diseases.
Nucleotide excision repair genes are related to Xeroderma Pigmentosum. These are the genes that
repair DNA damage caused by mutagenic agents such as UV. Previous studies have shown that
mutations to these specific set of genes are highly related to clinical symptoms in XP patients. These
genes are: DDB2, ERCC2, ERCC3, ERCC4, ERCC5, POLH, XPA and XPC.
One of the genes that causes the most severe cases of the disease Xeroderma Pigmentosum is the
XPA gene. Previous studies have shown that mutations in this gene cause clinical symptoms of
Xeroderma Pigmentosum predominantly in the Japanese population where 1 in every 40,000 people
have XP1. These studies showed that there is a possibility of 25 mutations that can occur to the XPA
gene to cause XP. Experiments2 previously carried out involved the cloning of the XPAC gene from
a mouse and

Biochemistry, Metabolic Processes, Homeostasis, Molecular...
In biology, we learn a lot of information that we can use later on in life, no matter what field of
study we go into. During this course, we learned about biochemistry, metabolic processes,
homeostasis, molecular genetics and population dynamics. Throughout the learning process, we've
had many questions or INTUS, which we use to expand our knowledge later on and determine the
answers to those specific questions. The point of this assignment is to relate questions that we have
developed on our particular topic we chose; to these five units we studied in biology.
(MyScienceAcademy, Sept.21, 2012) (Glogster, 2012) (Tay Sachs Disease, May 2013) Cherry red
spot" in the eyes Infant with Tay Sachs Disease If two parents are carriers for this disease, then the
offspring will have a 1 in 4 chance of having t of h this disease, 2 in 4 chance of b b being a carrier,
and 1 in 4 c

Otosclerosis Essay
Juvenile otosclerosis
Otosclerosis is a unique bone disorder of the otic capsule and ossicles, that affects human beings
only. [1] The disease is characterised by alternating phases of bone resorption and redeposition of
new, mainly spongy bone with greater cellularity and vascularity in the active phase and reduced
vascularity and cellularity in the inactive phase. [2]
Otosclerosist frequently involves the stapedio–vestibular joint resulting in fixation of footplate of
stapes and subsquently causing conductive hearing loss of variable degrees. It may extends to
involve the cochlea causing sensorineural or mixed hearing loss.[3] clinical otosclerosis is
commonly observed in the third decade; however, some cases of otosclerosis begin in early
childhood or as late as at 60 years of age.[4]
Temporal bone of 1,161 patients of all ages were studied by Guild and found that in patients under
the age of 5 years, otosclerosis was rarely detected , occurring in less than ... Show more content on
Helpwriting.net ...
Polymorphisms in the COL1A1gene have been found to alter bone strength by altering binding
affinity for the transcription factor Sp1.[23]
There are many researches about the genetics of otosclerosis and the possible role of COL1AI in
adults , yet only few studies focus on juvenile Otosclerosis.Therefore, the aim of the study was to
investigate if there is an association between the G/T polymorphism at Sp1 binding site in first
intron of COL1A1gene and the predisposition to in clinically and histologically confirmed juvenile

Genetic Code Research Paper

Recommended

Recommended

More Related Content

More from Jessica Briggs

More from Jessica Briggs (12)

Recently uploaded

Recently uploaded (20)

Genetic Code Research Paper