5. Types of Errors Incorrect pairing of nucleotide base Only changes onecodon so only one amino acid protein is changed Delete/ Add entire pair Changes every codon after the mistake so many amino acid proteins are changed VC: DNA Mutation
6. Original: TACGGGGGCGTAACCACAACTHere is the other side (copy). 1) Find the error: ATGCGCCCGCATTGGTGTTGA ATGCGCCCGCATTGGTGTTGA 2) Write the new RNA 3) Form the new codons (you can draw lines on RNA code above to separate) 4) Translate into the new amino acids AUGCGCCCGCATTGGTGTTGA Methionine-Arginine-proline-histadine- tryptophan-cysteine-stop
7. What’s the difference from the original (example B on your worksheet)? Methionine-Arginine-proline-histadine-tryptophan-cysteine-stop
9. How does mutations work? DNA is very accurate when making copies of itself, however, sometimes it makes a mistake. Here’s a DNA sequence AGCCCTTATAGGCTC What are the corresponding base pairs? TCGGGAATATCCGAG Now when it’s being copied it replaces the T with a U. Rewrite the your answer with U’s instead of T’s. UCGGGAAUAUCCGAG What amino acids will this be coded for? Serine, Glycine, Isoleucine, Serine, Glutamic Acid
10.
11. The Mutation Here’s our original DNA sequence AGCCCTTATAGGCTC ATCCCTTATAGGCTC we replaced the G with a T Now what are the corresponding base pairs? TAGGGAATATCCGAG Now when it’s being copied it replaces the T with a U. Rewrite the your answer with U’s instead of T’s. UAGGGAAUAUCCGAG What amino acids will this be coded for? Stop, Glycine, Isoleucine, Serine, Glutamic Acid You can see how replacing 1 base will change everything!
17. Evolution the change in the inherited traits (passed on from parents to offspring) of a populationover many generations. These traits could be: physical (teeth shape) chemical (ability to use sun for energy) behavioral (run fast). This change is caused by mutations in the genes. http://www.youtube.com/watch?v=yVqJ_mQazik
18. PHYSICAL: This moth mimics an owl’s eyes BEHAVIORAL: This monkey is using tools to get food CHEMICAL: this orchid smells like a female bee
19. Common Ancestor- We did not come from monkeys, we just had a common ancestor
20. Theories on Life Theory of Evolution Science Based on evidence Creationism Religion Based on faith
21. Adaptation the evolutionary process where a population becomes better suited to its environment. This process takes many generations. A featurewhich is especially important for an organism's survival. For example, the adaptation of horses' teeth to the grinding of grass Flat teeth (due to genetic mutation) chew grass better
22.
23. How does Evolution Work? Natural Selection- survival of the fittest Organisms best suited to their environment Natural selection is the result of four features of living systems: 1) variation – differences in the population because of genetic mutation 2) inheritance- parents pass on their genetic mutations to their offspring 3) selection- some organisms reproduce more (fittest) than others 4) time – happens over time, takes many generations
24. There are 2 variations of the beetles, green and red. The birds prefer eating the green beetles. Over generations the red beetles increase in population because they are not eaten by the birds. More survive to produce more offspring. Generations later…. Over time the red beetles have been selected over the green beetles So what happens to the birds now?
27. Why does this not work? Change through use and disuse
28. Natural Selection’s Explanation Ancestors had different neck lengths Through natural selection, longer necks survived and passed on their genes. Eventually all giraffes had long necks.
29.
30. What could cause all the variety?http://www.youtube.com/watch?v=sCEeefdaRcw
31. Common Ancestor- We did not come from monkeys, we just had a common ancestor
