Breaking the Code
How Do  Cells   Reproduce ? Identical copy http://waynesword.palomar.edu/lmexer2a.htm   http://luigigalvani5.blogspot.com/...
Mix ing  of Genes CROSSING OVER
From  Gene   to  Protein :  An  exercise  in  breaking  the  code
<ul><li>DNA COPIES ITSELF : Base pairings:  A- T  C – G DNA molecule   unzips breaking  the base pairs  forming 2 sides </...
A:  TACCGGATGCCAGATCAAATC What is the other side? __________________________ 1. Given the code of a  DNA molecule , what w...
2.   CODE IS READ .  The code of the new strand (DNA copy) is  READ   with the   T replaced with a new base Uracil or  U ....
A:  ____________________________________ B:  ____________________________________ 3.  CODE IS TRANSLATED . The code is  re...
4. Find the  Amino Acid sequence  that is coded:   A:  ____________________________________ B:  __________________________...
 
Genes(DNA) Make copies of itself New copy (RNA) is read and translated Crossover (mixing of code) Amino acids (protein) ar...
DNA RNA PROTEIN Cracking  the  Code VC: Cracking the code http:// entomology.wisc.edu/~goodman/wgr ... rch.html copied and...
While the copying of  DNA  is a very  accurate process , what happens when a letter is  altered ? VC: DNA Mutation
Upcoming SlideShare
Loading in …5
×

Breaking the code

881 views

Published on

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
881
On SlideShare
0
From Embeds
0
Number of Embeds
71
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Breaking the code

  1. 1. Breaking the Code
  2. 2. How Do Cells Reproduce ? Identical copy http://waynesword.palomar.edu/lmexer2a.htm http://luigigalvani5.blogspot.com/2008/... ary.html Different copy
  3. 3. Mix ing of Genes CROSSING OVER
  4. 4. From Gene to Protein : An exercise in breaking the code
  5. 5. <ul><li>DNA COPIES ITSELF : Base pairings: A- T C – G DNA molecule unzips breaking the base pairs forming 2 sides </li></ul>VC: DNA Replication
  6. 6. A: TACCGGATGCCAGATCAAATC What is the other side? __________________________ 1. Given the code of a DNA molecule , what would be the code of the new DNA strand? B: TACGGGGGCGTAACCACAACT What is the other side? __________________________
  7. 7. 2. CODE IS READ . The code of the new strand (DNA copy) is READ with the T replaced with a new base Uracil or U . A: ____________________________________ B: ____________________________________
  8. 8. A: ____________________________________ B: ____________________________________ 3. CODE IS TRANSLATED . The code is read in groups of 3 called codons ).
  9. 9. 4. Find the Amino Acid sequence that is coded: A: ____________________________________ B: ____________________________________
  10. 11. Genes(DNA) Make copies of itself New copy (RNA) is read and translated Crossover (mixing of code) Amino acids (protein) are formed A trait is expressed VC: What is phenotype www.squidoo.com/geneticsresearch
  11. 12. DNA RNA PROTEIN Cracking the Code VC: Cracking the code http:// entomology.wisc.edu/~goodman/wgr ... rch.html copied and read translated
  12. 13. While the copying of DNA is a very accurate process , what happens when a letter is altered ? VC: DNA Mutation

×