Successfully reported this slideshow.

Large-scale data in life science

1,949 views

Published on

Bigdata meetup in Tokyo at 8 Dec. 2011 by Tazro Inutano Ohta

Published in: Technology
  • Be the first to comment

Large-scale data in life science

  1. 1. G E S C AL ELAR D A TA IN E SC IE N CE
  2. 2. Update( new_suffix ){  current_suffix = active_point  test_char = last_char in new_suffix  done = false;  while ( !done ) {    if current_suffix ends at an explicit node {      if the node has no descendant edge starting with test_char        create new leaf edge starting at the explicit node      else        done = true;    } else {      if the implicit nodes next char isnt test_char {        split the edge at the implicit node        create new leaf edge starting at the split in the edge      } else        done = true;    }    if current_suffix is the empty string      done = true;    else       current_suffix = next_smaller_suffix( current_suffix )  }  active_point = current_suffix}
  3. 3. photo by http://www.photoxpress.com/stock-photos/1814937
  4. 4. photo by @meguu
  5. 5. Large-scale data in Life Science Contentsfontin sans fonts by Jos Buivenga (exljbris). Thank You! -> www.exljbris.com
  6. 6. NOW IS THE TION T-G ENERANEX ED ATA CAL NCE L ES ARG FE SCIE LI
  7. 7. NOW IS THE TION T-G ENERANEX ED ATA CAL NCE L ES ARG FE SCIE LI
  8. 8. DBCLS:DATABASE CENTER FOR LIFE SCIENCE
  9. 9. Tazro Inutano Ohta @iNut/ Technical Specialist
  10. 10. Large-scale data in Life Science
  11. 11. or or ?ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAGCATGCATGCATGCATGCATGCATGCATGCAT or or ?GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT photo by Togopic, Licensed under CreativeCommons 2.1 JP Attribution
  12. 12. ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC Data ID : 000001ATGCATGCATGCATGCATGCATGCATGCATGATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA organism : mouseTGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA cell : nervous cellTGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA sequencer : 454TGCATGCATGCATGCAGCATGCATGCATGCATGCATGCATGCATGCAT date : 2011 12 08GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT photo by Togopic, Licensed under CreativeCommons 2.1 JP Attribution
  13. 13. Next-generation sequencing data
  14. 14. grazie per le informazioni @ma_ko * DNA exon
  15. 15. *illumina HiSeq 2000
  16. 16. https://twitter.com/#!/dritoshi/status/121817788200390656
  17. 17. short read from NGSde novo assemble reference genome reference alignment
  18. 18. short read from NGS de novode novo assemble reference genome reference alignment
  19. 19. Velvethttp://www.ebi.ac.uk/~zerbino/velvet/SOAPdenovohttp://soap.genomics.org.cn/soapdenovo.htmlsequence assembly in wikipediahttp://en.wikipedia.org/wiki/Sequence_assembly
  20. 20. short read from NGSde novo assemble reference genome reference alignment
  21. 21. Chr1 Chr2 Chr3CPU1 CPU2 CPU3
  22. 22. Troubles not yet shooted
  23. 23. https://twitter.com/#!/dritoshi/status/110559890413600768
  24. 24. https://twitter.com/#!/dritoshi/status/113546074760822784
  25. 25. https://twitter.com/#!/dritoshi/status/114675417998311425
  26. 26. http://bcbio.wordpress.com/tag/galaxy/
  27. 27. ITPro http://itpro.nikkeibp.co.jp/article/NEWS/20110927/369510/
  28. 28. grazie per le informazioni @yag_ays! asahi.com http://www.asahi.com/digital/bcnnews/BCN201111240007.html

×