1. University of Aberdeen
School of Biological Sciences
Gene expression following chronic viral infection
suspected to be a natural outbreak of pancreas
disease in farmed Atlantic salmon (Salmo salar L.)
Seamus Frederick McKim
Supervisors: Dr. Samuel A. Martin & Dr. Jun Zou
“A thesis submitted to the School of Biological Sciences for the Project element of a taught
degree of Master of Science, Applied Marine and Fisheries Ecology at University of
Aberdeen, 2012”
Aberdeen, August 2012

2. STUDENT DECLARATION
I hereby declare that this thesis is my own work and effort and that it has not
been submitted anywhere for any degree application. Where other sources of
information have been used, they have been acknowledged.
Signature: ……………………………………….
Date: …………………………………………….

3. Gene expression following chronic viral infection suspected to be a natural
outbreak of pancreas disease in farmed Atlantic salmon (Salmo salar L.)
Seamus McKim
School of Biological Sciences, Zoology Building, University of Aberdeen, Tillydrone Avenue, Aberdeen, AB24
Email: shay.mckim@gmail.com
Abstract
Pancreas disease (PD), an economically important disease in farmed Atlantic salmon Salmo
salar L., is caused by salmonid alphviruses (SAV). A lack of convincing evidence detailing the
molecular responses following chronic viral myopathies exists. Clinical and gross
pathological findings were used to sort commercially farmed fish from a Scottish marine site
with a recurrent history of PD infection into two pools (1) Healthy/Asymptomatic, (2)
Diseased/’suspected PD’. Biometric data was used to determine condition factor and
evidence of feeding was analysed by creating a stomach fullness index. Condition factor (CF)
and stomach fullness rank for healthy fish was found to be significantly greater than that of
diseased fish. Few diseased fish (10%) showed signs of active feeding behaviour and
exhibited a significantly lower CF. Reverse transcription PCR and real-time qPCR assays for
the detection of the pathogen SAV in addition to the expression of the immune function
genes Mx and γ –IP and the protein degradation gene atrogin-1 were performed for heart
and skeletal muscle tissue. Attempts to confirm the presence and activity of SAV were
inconclusive. Gene expression analysis showed up-regulation of immune function genes
indicating stimulated immune response. Up regulation and expression was highest in
diseased heart tissues. Expression for atrogin-1 showed significant differences between
healthy and diseased heart tissue.

4. Introduction
Pancreas disease (PD), attributed to infection by Salmonid alphavirus (SAV) is a highly
significant disease in the production of farmed salmonids. The majority of cases affect
Atlantic salmon Salmo salar L. in the marine phase of culture occurring in their first or
second year at sea. Molecular analyses of salmonid alphaviruses show phylogenetic
relationships between isolates (Fringouelli et al., 2008). A total of six isolates, subtypes
SAV1-6. Subtypes 1, 4 and 5 are very closely related and are those to be confirmed to be
present in the British Isles and Ireland almost exclusively.
Histopathologically, the first indication of infection is observed in the pancreas with acute
necrosis of pancreatic tissues causing loss of exocrine pancreas. Concurrent damage occurs
in cardiac tissues (Ferguson et al., 1986a; McLoughlin & Graham, 2007). Lesions develop in
muscle tissues 3-4 weeks after the first observation of pancreatic and cardiac lesions
(McLoughlin & Graham, 2007). Under experimental conditions PD can affects a number of
other additional organs including the kidneys, liver and brain (McLoughlin et al., 2006). Focal
lesions forming in tissues may be highly localised or in extreme cases the entire organ(s)
may be affected. The heart is the first organ to recover morphologically after a PD outbreak
according to Jansen et al. (2010b).
One of the difficulties of studies regarding PD has traditionally been diagnosis which has
historically relied upon observations of the aforementioned histopathologies and clinical
signs. Severe complications exist with regard diagnosis due to the variability of associated
pathologies and also because of concomitant and secondary issues not exclusively or
consistently associated with PD being present (McVicar et al., 1987). These include other
diseases such as furunculosis, vibriosis and also the presence of and severity of affliction by
sea lice which may increase susceptibility. Real-time PCR tests are a far more sensitive
technique than serological analysis (Graham et al., 2003b; Hodneland & Endresen, 2006;
Christie et al., 2007). PD displays certain similarities, with pancreatic damage being a
common feature in cases of; infectious pancreatic necrosis (IPN) (Roberts & Pearson, 2005),
cardiomyopathy syndrome (CMS) (Ferguson et al, 1990) and heart and skeletal muscle
inflammation (HSMI) (Kongtorp et al., 2004a). While the aetiology of IPN, PD has been
confirmed, only very recently has the causative agent of CMS been identified and found to

5. be different to any salmon alphavirus, likely of the family totiviridae (Haugland et al, 2011).
No such information currently exists pertaining to HSMI.
A facet of our understanding of the pathogenesis of PD in salmonids which has been not
been investigated to any great extent, is the effect of the disease on the expression of genes
which control tissue or organ functionality. A poorly understood relationship even in this
generally little known area is PD and gene expression in muscle tissues (specifically heart
and skeletal) with which the disease is linked.
In the context of salmon culture, of paramount importance is the rate at which muscle mass
is grown through protein deposition. In general, fish are exceptionally efficient in this
process of converting protein consumed to growth when compared to terrestrial
endotherms (Houlihan et al., 1995). This efficiency is affected by a plethora of factors
including nutrition (Gomez-Requeni et al., 2005) and health status (Johansen et al., 2006).
Growth in farmed fish has been shown to be reduced or even to cease altogether following
an outbreak of PD (McLouglin et al., 2002) for up to 2 months after PD being diagnosed. Fish
infected with PD lose muscle protein, even when the virus is cleared they do not put on
weight at the same rate as before.
Laboratory trials and challenges examining necrosis of skeletal musculature have proven
difficult to recreate. This appears a feature of experimental PD when compared with those
of the naturally occurring disease (Murphy et al., 1995; McLoughlin et al., 1995b). In
challenged fish degenerative changes produced in skeletal myofibres are also less severe
than those which have been reported in the field (McLoughlin et al., 1996). These authors
have hypothesised that the reason for this is that less intense muscular activity is exhibited
in experimentally reared fish. This is supported by evidence that peak mortalities in the field
have been closely related to severe skeletal myopathies (McLoughlin et al., 1995a). The
relative lack of mortality under experimental conditions may be explained in this way. Sub-
clinical disease has also been observed where fish close to harvest are confirmed as positive
to SAV associated antibodies but have not had a reported clinical outbreak or suspicion of
disease, although in some cases growth and performance may have been less than expected
(Graham et al., 2006). A large number of molecular markers are now available to sample
both antiviral activity and aspects of muscle protein physiology, in particular protein

6. degradation and in this respect the marker atrogin-1 is seen as being key (Tacchi et al.,
2010).
A knowledge gap therefore exists in the understanding of muscle atrophy (protein
degradation) over an extended period of viral activity. To date, little focus of efforts has
been given over to the study of in particular the effects of longer-term chronic infection and
fish which are asymptomatic, displaying no visible signs of infection. The aim of the present
paper is to attempt to further explore gene modulation in fish which are present during a
natural outbreak of PD with special reference to the regulation of immune function genes,
genes responsible for protein degradation and to link these to growth patterns and the long
term effects of disease in the production of cultured fish.
Materials and Methods
Study site and sampling location
Atlantic salmon from a commercial Scottish marine farm with a history of recurrent PD
infection were sampled at a single time-point in May 2012. Data on both fish welfare and
health status and clinical observations was provided by local fish health services. The time
period from the first instance of confirmed infection by SAV to the time of samples obtained
for use in the present study is >10 weeks. This extended length of time reflects the aim of
the study to investigate chronic natural infection and pathogenesis. The site and cage
selected and sampled from was chosen on a number of criteria; the area being considered
to be endemic for the virus, recent case history is indicative of the high probability of
clinical PD. Fish at the specified location had not been vaccinated against pancreas disease
(SAV). Clinically diseased and asymptomatic fish were collected from the same cage with
autopsy and tissue sampling taking place immediately after euthanasia.

7. Sampling and diagnostic submissions
Fish selected for study were based on early clinical signs consistent with pancreas disease
and further gross post-mortem findings. Fish were defined as being healthy/asymptomatic
or diseased. For the purposes of analysis, fish classed as healthy will be used as the
experimental control with which comparisons are made. The diagnostic approach used in
the two pools created can be seen in summarised form in figure 1.
In terms of clinical signs of PD infection, and chronologically are a cessation in feeding
followed by a marked increase in morbidity, indications of feeding behaviour were
evidenced in reports made by local fish welfare services. Uptake of feed by fish on an
individual basis was assessed by examining stomach contents and whether or not casts were
present in the intestinal tract. Stomach fullness on a scale of 0-5 (0 = empty, 5 = distended)
was visually measured to semi-quantify feeding activity. Other differential clinical signs used
to categorise fish were those that appeared lethargic and were observed to drift near or on
the surface at the sides of the cage. Exhibiting an inability to maintain their position within
Healthy/Asymptomatic
Active
Swimming
behaviour
normal
Good body
condition
Body free from
damage
Diseased
Lethargic
Drifting/'whirling
at or near
surface
Poor body
condition
Lesions and
ulceration
Fig. 1. Summaries of the approach used in the formation of the two pools of fish used in the present study, namely sub-
clinical/asymptomatic healthy fish and those displaying clinical outward indicators of infection.

8. the water column, fish categorised as being infected present classic ‘whirling’. As opposed
to this behavioural characteristic, control (healthy/asymptomatic) fish swam in normal
patterns typical of farmed salmon and displayed the ability to change depth and position at
will. Lice counts for all fish sampled varied between 0-2 per fish.
Sampling
Fish were netted and killed by percussive impact to the back of the head. Necropsy was
performed following identical protocols for all fish and principal gross pathological
observations made and recorded detailing internal and external signs of infection including
presence and severity of lesions, signs of muscle myopathies and characteristic necrosis of
pancreatic tissues. Fork length (FL, mm) and total body weight (BW, g) were recorded and
used to calculate condition factor (K=100*BW/FL-3
). Condition factor, an indication of the
health/nutritional status of a fish was then used to assess growth and body fat component,
with diseased fish typically presenting both reduced growth and low body fat (Fig. 2). It is
also indicative of a decreased level of energy reserves. Lesions and muscle damage causing
predisposition to erosion and ulceration of fins and skin including scale loss are an additional
symptom and as such were also considered (Fig. 3).
A
B
Fig. 2. Fish 4 (A) and 7 (B) both typical pancreas disease showing poor condition factor fish with reduced body and caecal fat
compared to a healthy farmed fish.

9. Tissue harvest
Ten healthy and 10 ‘PD’ fish sampled. A portion of tissue (~ 200mg) from both heart and
skeletal muscle was taken using individual sterile scalpels for both tissue types. Tissues were
transferred to labelled 2 ml tubes containing 1.5 ml of RNAlater (Ambion) for subsequent
RNA extraction. This resulted in 2 organ samples for each fish used in the study. Samples
were immediately chilled post removal at 4°C for 24h then transported to the laboratory for
storage at -80°C prior to further testing.
A
B
Fig. 3. Fish 2 (A) and fish 3 (B) showing extreme levels of erosion to skin and sub-dermal regions of flanks showing exposed
myomeres.

10. RNA Extraction
Total RNA was isolated from fish tissues following storage at -80°C. RNA extraction was
performed from ~ 100 mg of tissue which was homogenised using TRIZol (Invitrogen) and
tungsten carbide beads (2mm, Qiagen) as per the manufacturer’s instructions. The resultant
pellet after centrifugation was washed in 900 µl 80% ethanol then air dried and
resuspended in RNase-free H2O. The quality and purity of the RNA and the concentration
were assessed by Agilent Bioanalyser 2100 and spectrophotometry (NanoDrop). RNA
produced was then stored at -80°C to await further processing and cDNA synthesis.
RT-PCR and qRT-PCR
cDNA synthesis was completed by denaturing 2 µl of dissolved total RNA in the presence of
1µl random hexamer primer (Bioline) and RNase –free water (Sigma) (70 °C, 5 min). The RNA
was then placed on ice to cool. cDNA was then synthesised from the total RNA using 1µl of
Bioscript reverse transcriptase (10000 U, Bioline) in the presence of 5 μL of 5× Reaction
Buffer, 1 μL of dNTP (deoxynucleoside triphosphate mix 12.5 mM each), (Bioline) made up
to a final volume of 25 μl with water and incubated at 42 °C for 1.5 h.
Standard reverse transcription-PCR
Initially viability of cDNA was assessed by PCR with the housekeeping gene elongation
factor-1α (EF-1α) using the following protocol. The PCR was performed in a 50 µl reaction
volume containing 2 µl cDNA template, 2.5 µl 10×Taq buffer, 1 µl (10uM) of each PCR
primer, 2 µl (10 mM) dNTP mix, 0.5 µl BioTaq DNApolymerase and 38 µl H2O. The PCR
profile was as follows: one cycle at 95 °C for 3 min; then 35 cycles at 94 °C for 30 s; 55 °C for
45 s; and 72 °C for 90 s; followed by one final extension cycle at 72 ◦Cfor 10 min. PCR
products were visualized on a Web Green DNA (Web Scientific) stained agarose (2%) gel
using UV illumination. The protocol was then used to carry out standard PCR using the
QnsP1 primer set (Table 1) to detect the presence of SAV cDNA.

11. qRT-PCR
Real-time PCR analysis was performed with 2x SYBR Green Master Mix (Applied Biosystems).
2 µl of cDNA template was used in a final volume of 20 µl. qPCR was carried out in a 96-well
plate using the DNA engine OpticonTM system (MJ Research, Inc.) using the following
protocol: 95 °C for 5 min, then 35 cycles of 94 °C for 30°s, 55 °C for 30 s and 72 °C for 30 s,
with a final extension of 72 °C for 5 min. For each primer pair a negative control (template
replaced by same volume with RNA/DNA-free H2O) was also performed. For detection of
SAV a positive control was also carried. Endogenous control (normalisation of cDNA) was
provided by EF-1α, a housekeeping gene which has been developed for the purposes of
routine examination of salmonid tissues (Moore et al., 2005, Olsvik et al., 2005, Snow et al.,
2006, Bower and Johnston, 2009). The specificity of the PCR products produced from the
primer pairings was assessed by analysis of melting curves across the range 82 °C to 95 °C to
ensure that a single identifiable product had been identified. The efficiency of the
amplification procedure was calculated for each primer pair using a series of ten-fold
dilutions of pooled cDNA which were carried out on the same well plate used for each
experimental sample. The calculation for efficiency used the following equation: E = 10(-1/s)
in which s is the slope of the line produced from the dilution series when the log of dilution
is plotted against threshold cycle number (ΔCT). Relative expression of the gene transcripts
was determined using the arbitrary number allocation method. Measurements resultant
from qPCR were analysed by t-test. P-values of < 0.05 were considered to be significant with
the data generated from expression shown as mean ± the standard error. All primers used in
the present study were provided by Sigma.
Gene Name Primer Name Primer Sequence (5’-3’)) Accession
Number
Amplicon
Length
Annealing Temperature
EF-1 α (F)
EF-1 α (R)
EF-1aF
EF-1aR
CAAGGATATCCGTCGTGGCA
ACAGCGAAACGACCAAGAGG
AF321836 327 bp
327 bp
55°C
55°C
Mx-1 (F)
Mx-1 (R)
SS MX1F1
SS MX1R2
TGAGGACTCGGCAGAAAGGATGTA
GGTCTTTCACCATCACCTCAAAGG
U66475 287 bp
287 bp
55°C
55°C
γ -IP (F)
γ -IP (R)
IP10F
IP10R
TGGTCAAGTTGGAGACGGTCA
TGGAACGCATGGACACATTG
DR696064 360 bp
360bp
55°C
55°C
QnsP1 (F)
QnsP1 (R)
Q nsP1 F primer
Q nsP1 R primer
CCGGCCCTGAACCAGTT
GTAGCCAAGTGGGAGAAAGCT
AY604235 107 bp
107 bp
60°C
60°C
Atrogin-1 (F)
Atrogin-1 (R)
SS Fbx32Int F
SSFbx32RcF5
GCACTAAAGAGCGTCATGGTTACTG
GTCTGAAGGAGCTCCTTGATGG
DN165813 247 bp
247 bp
55°C
55°C
Table 1. Primers used for real-time PCR to assay gene expression of cDNas.

12. Results
Stomach fullness and condition factor
All fish (n=20) used for the present study (Table 2) were in the range 758g – 2925g ± 219 g in
weight, range attributable to condition/growth as all fish are from the same age cohort.
Significant differences between healthy and diseased fish with regard both weight and
condition factor (p-values of 0.002 and 0.01 respectively). No significant differences were
seen for fork length between the two pools of fish. Although total body weight is influenced
by whether food is present in the stomach and gut, the findings coupled with the significant
difference in condition factor indicate that a relationship exists in growth between diseased
and ‘healthy’ fish. Of the 10 fish characterised as being infected by PD 8/10 did not appear
to be feeding and had yellow casts present in the gut which is an indicator in the clinical
diagnosis of PD. For the 10 fish showing no clinical signs of infection 9/10 had food
particulates present in the stomach with yellow casts present in all fish.
Gross Pathology
Gross post-mortem observations found that all moribund fish (10/10) swimming near the
surface and close to the net were affected by both scale-loss and 9/10 had moderate to
extreme lesions upon their flanks both indicative of abrasion (Fig.3.). Fish not presenting
behavioural signs of disease were largely free from such indicators with 3/10 fish showing
minimal scale loss and only one fish with lesions (minor) on the flanks in the area
immediately forward of the caudal fin. Loss of exocrine pancreatic tissue is a characteristic
indicator of PD and close attention was paid to its status. In all fish sampled, necrosis was
found with a good number of fish almost completely lacking it. Petechial haemorrhaging
was observed on the surface of the pyloric caeca and associated fatty tissues in 6/10
n Fork length (mm) Body weight (g) Condtion factor Stomach fullness (0-5) Empty stomachs (%)
Healthy fish 10 578 ± 1.12 2652 ± 75.8 1.36 ± 0.08 1.9 ± 0.38 10
Diseased fish 10 539 ± 1.75 1751 ±232.4 1.07 ± 0.09 0.2 ± 0.13 80
All fish 20 559 ± 1.57 2242 ± 219 1.21 ± 0.09 1.05 ± 0.4 45
Table 2. Biometrical means and stomach fullness rank for pooled data recorded for farmed Atlantic salmon (± SE).

13. diseased fish and 3/10 health/asymptomatic fish. The kidneys and livers of the fish sampled
appeared to be enlarged in many cases with the release of haemorrhagic fluids common
upon dissection of both organs during tissue sampling. In clinically diseased pool, severe
necrosis of heart tissues (ventricle) was observed in 4 fish while only one fish displayed no
macroscopic lesions within the heart. For asymptomatic fish, only one was observed to have
lesions in heart tissues. Mild to moderate lesions in skeletal muscle tissues were found in
8/10 clinically diseased fish. Of the remaining fish within the pool, in one, severe lesions
affecting muscle tissues were observed and in one fish no lesions were observed. It was not
within the design of the present study to investigate further by histopathological analysis,
merely to make generalised observations of the health status of the fish and to categorise as
being either clinically diseased or healthy/asymptomatic.
Gene Expression Analysis
Twenty fish were screened for the presence of SAV by use of PCR detection using the QnsP1
primer set. Initially attempts were made to detect the virus by standard PCR using
numerous PCR protocols, however in all cases no viral presence could be detected in any of
the fish sampled from. Positive and negative controls performed as expected confirming the
integrity of cDNA used (Fig. 4a.) and that the SAV assay protocol utilised functioned
correctly and without contamination (Fig. 4b.). The range of EF-1α Ct values obtained for
both pools of fish was 14.38 to 26.35 with a mean of 18.73 ± 0.04 (SE).
1 2 3 4 5 6 7
300bp
200bp
100bp
4a
Fig.4a. Gel electrophoresis showing expression of EF-1α housekeeping gene (amplicon 327bp) in farmed Atlantic salmon
indicating consistent quality and quantity of RNA. Lanes 1-3 heart tissue, 4-5 muscle tissue from diseased altantic salmon.
Lane 6 +ve control using muscle tissue from PD challenge study where fish were experimentally infected with SAV (Z. Heidari
2012, pers. comm). Lane 7 –ve control (no template).

14. Existing studies using the same protocol (Z. Heidari 2012. Pers. comm) found that in a PD
challenge study, detection of SAV was confirmed in fish experimentally infected with SAV up
to 4 weeks post infection. Highlighted is the possibility that SAV may be present in such a
low concentration that a more sensitive methodology must be employed in order to detect
its presence. Given that real-time PCR is far more sensitive than end-point PCR, the use of
qRT-PCR was adopted. The results from qPCR were inconclusive. The virus was detected in
both tissues (heart and skeletal muscle) of all twenty fish sampled from, however the very
high Ct values generated suggest a very low viral presence and as such deemed to be
insufficiently reliable for further analysis.
The expression of the immune function gene Mx and γ –IP (also named IP-10/ CXCL10) and
in addition to the protein degradation gene Atrogin-1 was examined in heart and skeletal
muscle tissues from ten salmon defined as clinically afflicted with SAV and ten fish defined
as being subclinical or otherwise healthy. The relative expression of each gene was
normalised with EF-1α. Genes selected for expression analyses were expressed in both
tissue types (Table 1).
Immune function genes
The expression of data for the immune function gene Mx and the chemokine γ -IP (an IFN- γ
inducible protein) was very similar showing strong upregulation. Expression of Mx (Figure
Fig.4b. Gel electrophoresis showing PCR products amplified using QnsP1 primer set, confirming successful amplification of viral
DNA in positive control. Gel plate includes sample from the present study. Amplicon size is 107bp. Lanes 1,2,5,6 +ve control
muscle tissue from PD challenge experiment 4 weeks after initial infection(Z. Heidari 2012, pers. comm). (*) denotes –ve control
(no template). Lanes 7-12 are a selection of heart (7-9) and muscle tissues from fish used in the present study. Gel
electrophoresis confirms assay funtions correctly and that both positive and negative controls performed as expected.
1 2 * * 5 6 7 8 9 10 11 12
4b
400bp
300bp
200bp
100bp

15. 5a, b), a major antiviral protein was shown to be significantly (P < 0.05) upregulated in both
the muscle and heart tissue of clinical fish when compared to control
(healthy/asymptomatic) fish (6 and 2 fold increase respectively). The expression was also
characterised by very high individual variances among fish. Expression of Mx was found to
be significantly greater in muscle tissue than in heart tissues. γ -IP expression (Fig. 5c, d)
broadly mirrored the expression of Mx. Significant upregulation was seen in both muscle
and heart tissue of diseased fish compared to control fish. A discernible and significant
difference is apparent when comparing the tissue types of both healthy and diseased fish. γ
–IP more highly expressed in muscle tissue than in heart with a very large increase in
expression seen in muscle (11 fold), whereas an only a two fold increase was seen in heart
tissue.
Fig 5a-d. Gene expression tissue distribution of Mx (a,b), γ –IP (c, d) in farmed Atlantic salmon during an outbreak of pancreas disease.
Heart and muscle tissues of healthy/asymptomatic fish from the same location were treated as a control Relative expression of each gene
was normalised with the expression of EF-1α.

16. Atrogin-1
The expression analysis for the protein degradation control gene atrogin-1 (Fig. 6a, b)
showed no significant difference in muscle tissue between the control and diseased fish,
however for heart tissue a significant downregulation of the gene was seen in diseased fish
(4 fold decrease). In common with both of the immune function genes examined, a very
high degree of individual variation characterised in terms of gene expression.
Discussion
The difficulties in detection of SAV in sample pools used for PCR assay can perhaps be
explained by the virological characteristics if SAV. Virological decreases in terms of viral
loading over time have been evidenced in a number of experimental challenge studies. For
PD, viral loading has been seen to peak early after infection but drop away rapidly to levels
which were undetectable by PCR (Z. Heidari 2012, pers. comm) (Fig.7).
Fig. 6a,b. Gene expression tissue distribution of atrogin-1 in farmed Atlantic salmon during an outbreak of pancreas disease. Heart and
muscle tissues of healthy/asymptomatic fish from the same location were treated as a control Relative expression of each gene was
normalised with the expression of EF-1α.

17. From additional studies of the relative quantification of viral RNA load (Andersen et al,
2007) the period between 3-5 weeks post infection is regarded as the optimal time to
achieve detection in all major organs and tissues of the fish. In view of this and the facts
concerning the present study, we could expect that we have sampled at a sub-optimal time
in which to detect SAV. However, while the results suggest that SAV activity is low, a
population could represent a potential viral reservoir for the rest of the production cycle
whereby a cyclic pathogenesis is present. In this model the most severely affected
percentage of fish die early (early mortality), close to the time initial infection whereas fish
unaffected in the initial outbreak are infected at that later date by carrier fish. In the interim
a period of viral clearance and recovery may be in effect. A number of studies have
however, illustrated that viral detection is possible at all stages of pathogenesis. Fish
sampled up to 6 months after initial infection have been shown to allow positive detection
(Desvignes et al., 2002; Andersen et al., 2007). In these prolonged chronic and largely sub-
clinical cases fish outwardly may display few clinical signs. The reason why subclinical
outbreaks occur is poorly understood, however Weston et al. (2005) attributed such
instances as being the result of infection by different SAV subtypes. This raises an interesting
question namely to what extent do subtypes affect gene expression with regard immune
function and the protein balance between deposition and degradation. As such, this area
warrants consideration and could form the basis of further studies. Given the stage of
pathogenesis present in the fish used in the present study it is also possible that survival
times, whether early or late mortality are characterised phenotypically perhaps indicating
Fig. 7. (Adapted from Z. Heidari, unpublished) Viral loading following experimental infection with salmon alphavirus

18. that resistance to disease at different stages of pathogenesis is explained by different
molecular host determinants. It is known that subtypes of infectious salmon anaemia virus
(ISAV) exist which are particularly pathogenic measured in terms of rate of replication and
scale of innate immune function up-regulation in addition to cellular stress (Jorgensen et al.,
2008). Several weeks are needed to develop acquired immune responses and until such a
time, the innate advantages possessed by some phenotypes are surely of high importance.
Our studies seem to indicate limited presence of SAV, however observed clinical signs and
gross pathological indicators seem at odd with such a conclusion. The assays for the
detection of are designed to amplify across all known subtypes of SAV Hodneland et al.,
2006) however they are specific to that pathogen and we cannot rule out the presence of
another virus with similar pathologies such as CMS or HSMI. If this were the case, it may
explain our findings that an immune response was found to be present in all fish sampled
from.
The findings of this report regarding the significantly lower CF in ‘diseased’ fish is supported
by Lerfall et al. (2012) who found a lower CF in salmon afflicted by PD. The elongate,
slimmer body shape seen in PD fish is an observation well supported by Einen et al. (1998,
1999) in studies of salmon deprived of feed. The issue of condition factor (CF) and
individuals showing poor growth in the period following initial infection is an area which has
generally received little attention. The loss of pancreatic tissue is seen as a primary feature
of PD as evidenced in the present study and the poor CF seen empirically for diseased fish in
this coupled with the stomach fullness rank are indicative that diseased fish have had a
decreased food intake or an inability to derive nutrition from feed in an efficient manner.
The ability to absorb and metabolise nutrients is seen as an explanation for evidence that
cages and farms with outbreaks and or chronic problems with PD produce fish with on
average a lower CF than locations where PD is either not present or at a lower intensity. It
may take several months to develop changes of this magnitude due to PD (Taksdal et al.,
2007). As it cannot be easily verified exactly the period of time since initial infection in the
the cage/location investigated in this report to the time sampling took place it is difficult to
evaluate the findings of this report in supporting this observation.

19. Whilst attempts made to detect SAV were inconclusive, the genetic markers used to indicate
a heightened immune response showed that the fish were responding to some immune
trigger. The up-regulation of Mx which is an important antiviral protein indicates that an
interferon induced antiviral response was occurring in both tissues, as is the expression of
γ–IP (IP-10) a chemokine which has been shown to be strongly induced by IFN-γ. The
induction of certain cytokine genes including IFN-γ has recently been shown to cause
apoptosis in host cells and also growth inhibition in mouse stellate cells (Dogra et al., 2006;
Fitzner et al., 2007). The physiological implications of such a relationship are not yet fully
understood.
Tropism which is the way in which viruses/pathogens have evolved to preferentially target
specific host species, or specific cell types within those species has been investigated
recently (Andersen et al., 2007). Recently (Jorgensen et al., 2008) reported similar findings
for infectious salmon anaemia virus (ISAV) where viral loading was also found to be higher in
certain tissues. Interestingly and perhaps a highly significant result of the paper was the fact
that viral load was markedly reduced when comparing the early mortalities (EM) of the
challenge to that of late mortality individuals. The paper went further still, hypothesising
that the dramatic innate immune responses seen in EM fish are linked to the fact that many
genes exhibiting heightened levels of expression such as the two genes assayed in the
present study (Mx & γ –IP) are known to be IFN dependent and consequently are
characterised by low tissue specificity. The heart while often the first tissue other than
pancreas to be affected in cases of PD is often the first organ to recover morphologically
after the peak in infection during PD outbreak Jansen et al. (2010b), and the higher
expression of antiviral and inflammatory transcripts in hearts tissue compared to skeletal
muscle might be expected in addition the speed of recovery of the cardiac tissues may be
indicative of prioritisation given over to the preservation critical to sustaining life. Indeed
findings from the present study are that a down-regulation of atrogin-1 a muscle
degradation protein occurs in cases of disease which lends support to this hypothesis.
However, it could also be viewed as the effect of a clinically affected fish entering the final
stages of pathogenesis immediately prior to death where a terminal outcome is assured and
there is a complete destruction of protein control mechanisms. The difference in expression

20. for atrogin-1 in skeletal muscle where it was significantly great could be an indicator of the
utilisation of muscle tissues and a catabolic fuel source.
Conclusion
Further evidence is provided for the relationship between growth and condition and
immune system status. The results from the present study have demonstrated farmed
Atlantic salmon can display significant variation in both biometrics and gene expression
during and as a result of viral immune challenges. Further work is required to understand
the influence SAV subtypes have in the pathogenesis of PD. While it is likely that the
regulation of the protein degradation gene atrogin-1 is influential in the growth of farmed
salmon its role in the determination in the growth rates salmon is not yet fully understood
and represents only a part of an expansive and very complex feedback system.
Acknowledgements
The author wishes to thank his supervisors for their contribution in this study. Thanked is
also the commercial fish farm from where all fish sampled originated. Zeynab Heidari and
Nick Pooley are also thanked for their invaluable assistance in the completion of this
manuscript.
Literature Cited
L. Andersen, A. Bratland, K. Hodneland, A. Nylund. 2007.Tissue tropism of salmonid alphaviruses (subtypes SAV1 and
SAV3) in experimentally challenged Atlantic salmon (Salmo salar L.) Arch. Virol., 152 (2007), pp. 1871–1883
Boonyarom, O., Inui, K. (2006). Atrophy and hypertrophy of skeletal muscles: structural and functional aspects. Acta
Physiol. 188, 77–89.
Bower, N.I., Johnston, I.A. (2009) Selection of reference genes for expression studies with fish myogenic cell cultures. BMC
Mol. Biol. 10.
Christie, K. E., Graham, D. A., McLoughlin, M. F., Villoing, S., Todd, D., & Knappskog, D. (2007). Experimental infection of
Atlantic salmon Salmo salar pre-smolts by i.p. injection with new Irish and Norwegian salmonid alphavirus (SAV) isolates: a
comparative study. Diseases of Aquatic Organisms 75 (13-22).

21. Desvignes L., Quentel C., Lamour F., Le Ven A. (2002)Pathogenesis and immune response in Atlantic salmon (Salmo salar
L.) parr experimentally infected with salmon pancreas disease virus (SPDV). Fish and Shellfish Immunology 2002;12:77-95
Dogra C, Changotra H, Mohan S, Kumar A. (2006) Tumor necrosis factorlike weak inducer of apoptosis inhibits skeletal
myogenesis through sustained activation of nuclear factor-kappaB and degradation of MyoD protein. J Biol Chem
2006;281:10327–36.
Einen, O., Waagan, B., Thomassen, M.S. (1998. Starvation prior to slaughter in Atlantic salmon (Salmo salar) — I. Effects on
weight loss, body shape, slaughter- and fillet-yield, proximate and fatty acid composition. Aquaculture 166, 85–104.
Einen, O.,Mørkøre, T., Rørå, A.M.B., Thomassen,M.S. (1999). Feed ration prior to slaughter— a potential tool for
managing product quality of Atlantic salmon (Salmo salar). Aquaculture 178, 149–169
Ferguson H.W., Roberts R.J., Richards R.H., Collins R.O. & Rice D.A. (1986a) Severe degenerative cardiomyopathy
associated with pancreas disease in Atlantic salmon, Salmo salar L. Journal of Fish Diseases 20, 95–98.
Ferguson, H. W., Poppe, T., & Speare, D. J., (1990). Cardiyomayopathy in farmed Norwegian salmon. Diseases of Aquatic
Organisms 8 (225-231).
Fitzner B,Brock P, Nechutova H et al. (2007) Inhibitory effects of interferon-gamma on activation of rat pancreatic stellate
cells are mediated by STAT1 and involve down-regulation of CTGF expression. Cell Signal 2007;19:782–90.
Fringuelli, E., Rowley, H. M., Wilson, J. C., Hunter, R., Rodger, H., & Graham, D. A., (2008). Phylogenetic analyses and
molecular epidemiology of European salmonid alphaviruses (SAV) based on partial E2 and nsP3 gene nucleotide sequences.
Journal of Fish Diseases 31 (811-823).
Gomez-Requeni, P., Calduch-Giner, J., de Celis, S.V.R., Medale, F., Kaushik, S.J., Perez- Sanchez, J. (2005). Regulation of
the somatotropic axis by dietary factors in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 94, 353–361.
Graham, D. A., Rowley, H. M., Walker, I. W., Weston, J. H., Branson, E. J., & Todd, D., (2003b). First isolation of sleeping
disease virus from rainbow trout, Oncorhynchus mykiss (Walbaum), in the United Kingdom. Journal of Fish Diseases 26
(691-694).
Graham D.A., Jewhurst H., McLoughlin M.F., Sourd P., Rowley H.M., Taylor C. & Todd D. (2006a) Sub-clinical infection of
farmed Atlantic salmon Salmo salar with salmonid alphavirus – a prospective longitudinal study. Diseases of Aquatic
Organisms 72, 193–199.
Haugland O, Mikalsen AB, Nilsen P, Lindmo K, Thu BJ, Eliassen TM, Roos N, Rode M, Evensen O., (2011) Cardiomyopathy
syndrome of Atlantic salmon (Salmo salar L.) is caused by a dsRNA virus of the Totiviridae family. J Virol 2011.
Houlihan, D.F., Carter, C.G., McCarthy, I.D. (1995). Protein turnover in animals. In: Wright, P., Walsh, P. (Eds.), Nitrogen
metabolism and excretion. CRC Press, Boca Raton, pp. 1–29.
Hodneland, K. & Endresen, C., (2006). Sensitive and specific detection of Salmonid alphavirus using real-time PCR
(TaqMan®). Journal of Virological Methods 131 (184-192).
Jansen, M.D., Wasmuth, M.A., Olsen, A.B., Gjerset, B., Modahl, I., Breck, O., Haldorsen, R.N., Hjelmeland, R., Taksdal, T.,
2010a. Pancreas disease (PD) in sea-reared Atlantic salmon, Salmo salar L., in Norway; a prospective, longitudinal study of
disease development and agreement between diagnostic test results. Journal of Fish Diseases 33, 723–736.
Johansen, K.A., Sealey, W.M., Overturf, K.( 2006). The effects of chronic immune stimulation on muscle growth in rainbow
trout. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 144, 520–531
Jorgensen, S.M., Afanasyev, S., Krasnov, A. ( 2008). Gene expression analyses in Atlantic salmon challenged with infectious
salmon anemia virus reveal differences between individuals with early, intermediate and late mortality. BMC Genomics 9,
179.
Karlsen M, Hodneland K, Endresen C, Nylund A (2006) Genetic stability within the Norwegian subtype of salmonid
alphavirus (family Togaviridae) Arch Virol 151: 861–874
Kongtorp, R. T., Kjerstad, A., Taksdal, T., Guttvik, A., & Falk, K., (2004a). Heart and skeletal muscle inflammation in
Atlantic salmon, Salmo salar L.: A new infectious disease. Journal of Fish Diseases 27 (351-358).

22. Jørgen Lerfall, Thomas Larsson, Sveinung Birkeland, Torunn Taksdal, Paw Dalgaard, Sergey Afanasyev, Målfrid T Bjerke,
Turid Mørkøre. 2012. Effect of pancreas disease (PD) on quality attributes of raw and smoked fillets of Atlantic salmon
(Salmo salar L.) Aquaculture (2012) v. 324-325, s. 209-217 doi: 10.1016/j.aquaculture.2011.11.003
McLoughlin, M. F., Nelson, R. T., McCormick, J. I. & Rowley, H. (1995b). Pathology of experimental pancreas disease in
freshwater Atlantic salmon parr. Journal of Aquatic Animal Health 7, 104–110
McLoughlin, M. F., Nelson, R. T., Rowley, H. M., Cox, D. I., & Grant, A. N., (1996). Experimental pancreas disease in
Atlantic salmon Salmo salar post-smolts induced by salmon pancreas disease virus (SPDV). Diseases of Aquatic Organisms
26 (117-124).
McLoughlin M.F., Nelson R.T., McCormick J.I., Rowley H.M. & Bryson D.G. (2002) Clinical and histopathological features of
naturally occurring pancreas disease in farmed Atlantic salmon, Salmo salar L. Journal of Fish Diseases 25, 33–43.
McLoughlin, M., Graham, D. A., Norris, A., Matthews, D., Foyle, L., Rowley, H., Jewhurst, H.,
MacPhee, J., & Todd, D., (2006). Virological, serological and histopathological evaluation of fish strain susceptibility to
experimental infection with salmonid alphavirus. Diseases of Aquatic Organisms 72 (125-133).
McLoughlin, M. F. & Graham, D. A., (2007). Alphavirus infections in salmonids - a review. Journal of Fish Diseases 30 (511-
531).
McVicar A.H. (1987) Pancreas disease of farmed Atlantic salmon, Salmo salar, in Scotland: epidemiology and early
pathology. Aquaculture 67, 71–78.
Moore LJ, Somamoto T, Lie KK, Dijkstra JM, Hordvik I (2005) Characterisation of salmon and trout CD8a and CD8b. Mol
Immunol 42: 1225–1234
Murphy, T. M., Drinan, E. M. & Gannon, F. (1995). Studies with an experimental model for pancreas disease of Atlantic
salmon Salmo salar L. Aquaculture Research 26, 861–874.
Nylund A, Plarre H, Hodneland K, Devold M, Aspehaug V, Aarseth M, Koren C, Watanabe K (2003) Haemorrhagic smolt
syndrome (HSS) in Norway: pathology and associated virus-like particles. Dis Aquat Org 54: 15–27
Olsvik, P.A., Lie, K.K., Jordal, A.E.O., Nilsen, T.O., Hordvik, I. (2005. Evaluation of potential reference genes in real-time RT-
PCR studies of Atlantic salmon. BMC Mol. Biol. 6, 21.
Roberts, R. J. & Pearson, M. D., (2005). Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. Journal of Fish
Diseases 28 (383-390).
Snow M, McKay P, McBeath AJA, Black J, Doig F, et al. (2006) Development, application and validation of a taqman® real-
time RT-PCR assay for the detection of infectious salmon anaemia virus (ISAV) in atlantic salmon (Salmo salar). Dev Biol
(Basel) 126: 133–145.
Tacchi L, Bickerdike R, Secombes CJ, Pooley NJ, Urquhart KL, Collet B, Martin SAM (2010) Ubiquitin E3 ligase atrogin-1
(Fbox-32) in Atlantic salmon (Salmo salar): sequence analysis, genomic structure and modulation of expression. Comp
Biochem Physiol B Biochem Mol Biol 157(4):364–373
Taksdal, T., Olsen, A.B., Bjerkås, I., Hjortaas, M.J., Dannevig, B.H., Graham, D.A., McLoughlin, M.F., (2007). Pancreas
disease (PD) in farmed Atlantic salmon Salmo salar L. and rainbow trout Oncorhynchus mykiss W. in Norway. Journal of
Fish Diseases 30, 545–558.
Weston JH, Graham DA, Branson E, Rowley HM, Walker IW, Jewhurst VA, Jewhurst HL, Todd D (2005) Nucleotide
sequence variation in salmonid alphaviruses from outbreaks of salmon pancreas disease and sleeping disease. Dis Aquatic
Org 66:105–111