Cell Biology, Molecular Biology

1. Telomeres Relation with cell
Division and Aging
Reading: Handbook
of Aging, Ch 9
A&S300-003 Jim Lund

2. Telomeres & Aging
Healthy human cells are mortal because
they can divide only a finite number of
times, growing older each time they divide.
Thus cells in an elderly person are much
older than cells in an infant.
Ontogeny:
[
•The developmental history of an organism within its own life time
•Individual organisms DEVELOP
Phylogeny:
[
•Evolutionary history of a species (population)
•Species EVOLVE
Gerontology:
[
•The scientific study of old age, the process of ageing, and the particular
problems of old people

3. The main factors acting in aging process and the
functional relationship between them
The aging of higher organisms is multi-factorial process. It is influenced and
modified by various genetic, biochemical, regulation and other systems
working at once in close contact.
Each system can make direct impact on aging process or act indirectly
(e.g. through other pathway).
• Decline in mitochondrial quality and activity contribute to aging and
age related diseases

4. Chromosome End Replication Problem
DNA replication and Telomere Shortening
• Synthesis of Okazaki fragments requires RNA primers attaching
ahead on the lagging strand
• The DNA could not be duplicated all the way to the end of a
chromosomosome
• So in each duplication the end of the chromosome is shortened

5. The
chromosome
End
Replication
Problem
DNA
polymerases
add bases
5' -> 3' and
require a
primer
template

6. CHROMOSOME
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
AATCCCAATCCC
5’
3’
TELOMERE
Telomeres:
•The terminal parts of eukaryotic
chromosomes.
•G-rich simple repeats and end with 3‘ single
stranded tails.
•Protect the ends of the chromosome
from deterioration or from fusion with
neighboring chromosomes
Telomeres are persistent
in the not aging cells:
cancer and germ line.

7. They are called "molecular clock" of the cell. Cell division times are
correlated with telomere length.
After each cell division telomeres get shorter. When telomere shortens to
the critical stage, the intensity of cell division significantly decreases, and
then cell differentiates and ages.

8. Consequences of the end replication
problem
One strand replicates to the end
The other strand has a 8 - 12 bp gap at the 5’ end.
Each chromosome in a cell that divides repeatedly will
progressively shorten.
This will lead eventually to chromosomes shorting until
genes are lost from the ends.
Described by Olovnikow,1973.
Telomeres/telomerase maintain chromosome ends

9. Provide protection from enzymatic degradation
and maintain chromosome stability
Organization of the cellular nucleus by serving as
attaching points to the nuclear matrix
Allows end of linear DNA to be replicated
completely
Telomeres protect chromosome end from DNA repair
pathways
Telomeres - Functions
• Standard DNA repair mechanisms must be suppressed or modified at telomeres to
prevent their being recognized and processed as DNA double stranded breaks
• In addition to duplex telomeric DNA, telomeres end in G-rich overhangs (also known
as G tails) usually present at both ends of the chromosome
• Long G-tails can fold back and invade the duplex region to form a specialized
displacement loop called a t-loop (telomere loop). T-loop is thought to provide a
protective cap

10. What are telomeres?
Telomeres are…
Repetitive DNA sequences at the ends of all human
chromosomes
They contain thousands of repeats of the six-
nucleotide sequence, TTAGGG
In humans there are 46 chromosomes and thus 92
telomeres (one at each end)
Senescent cells have shorter telomeres
Length differs between species
In humans 8-14 kb long
Telomere replication occurs late in the cell cycle

11. Repeated G rich sequence (G tail) on one strand
in humans: (TTAGGG)n
Repeats can be several thousand base pairs long. In
humans, telomeric repeats average 5-15 kilobases.
Telomere specific proteins, e.g. TERF1 & TERF2 bind to
the repeat sequence and protect the ends.
Telomeres
TERF1: Telomeric repeat-binding factor 1
TERF2: Telomeric repeat-binding factor 2, protection against end-to-end fusion of
chromosomes. Bind to double stranded repeat

12. How are telomeres linked to aging?
Telomeres are also thought to be the
"clock" that regulates how many times an
individual cell can divide. Telomeric
sequences shorten each time the DNA
replicates.
Once the telomere shrinks to a certain
level, the cell can no longer divide. Its
metabolism slows down, it ages, and dies.
Shelterin Complex:
•Also known as TELOSOME. Involved in the regulation of telomere length and
protection.
•Without Shelterin, telomeres is no longer hidden from DNA damage surveillance
and the chromosome ends are inappropriately processed by DNA repair pathways

13. How Does Telomerase Work?
Telomerase works by adding back
telomeric DNA to the ends of
chromosomes, thus compensating for
the loss of telomeres that normally occurs
as cells divide.

14. Telomerase
Telomerase is a ribonucleoprotein enzyme complex (a cellular
reverse transcriptase).
TERT (Telomerase Reverse Transcriptase): RNA directed DNA
polymerase.
TERC (Telomerase RNA Component): RNA template.
Telomerase is not active in most human somatic cells because
transcription of TERT, is repressed by several tumor
suppressor pathways.
Beta-catenin, a central player in WNT signaling, acts directly to activate TERT
transcription in embryonic and adult stem cells as well as in human cancer cells

15. Telomerase is composed of both RNA
and protein

16. 21-16
Telomere Maintenance
At the ends of eukaryotic chromosomes are special structures
called telomeres
One strand of telomeres is composed of tandem repeats of short,
G-rich regions whose sequence varies from one species to another
G-rich telomere strand is made by enzyme telomerase
Telomerase contains a short RNA serving as template for
telomere synthesis
C-rich telomere strand is synthesized by ordinary RNA-primed
DNA synthesis
This process is like lagging strand DNA replication
This mechanism ensures that chromosome ends can be rebuilt
and do not suffer shortening with each round of replication
https://www.youtube.com/watch?v=U0fRAr-ZHCo

17. 21-17
Telomere Formation
Figure 21.25 Forming telomeres in Tetrahymena.
(a) Telomerase (yellow) promotes hybridization
between the 3'-end of the G-rich telomere strand and
the template RNA (red) of the telomerase. The
telomerase uses three bases (AAC) of its RNA as a
template for the addition of three bases (TTG,
boldface) to the 3'-end of the telomere. (b) The
telomerase translocates to the new 3'-end of the
telomere, pairing the left-hand AAC sequence of its
template RNA with the newly incorporated TTG in the
telomere. (c) The telomerase uses the template RNA
to add six more nucleotides (GGGTTG, boldface) to
the 39-end of the telomere. Steps (a) through (c) can
repeat indefinitely to lengthen the G-rich strand of the
telomere. (d) When the G-rich strand is sufficiently
long (probably longer than shown here), primase
(orange) can make an RNA primer (boldface),
complementary to the 39-end of the telomere’s G-rich
strand. (e) DNA polymerase (green) uses the newly
made primer to prime synthesis of DNA to fill in the
remaining gap on the C-rich telomere strand and DNA
ligase seals the nick. (f) The primer is removed,
leaving a 12–16-nt overhang on the G-rich strand.

18. Telomerase Activity
In humans, telomerase is active in
germ cells, in vitro immortalized cells,
the vast majority of cancer cells,
epidermal skin cells, follicular hair cells
and, possibly, in some stem cells.
Inactive in most cells: Somatic cells,
differentiated cells, post-mitotic cells.

19. Cellular senescence
Once the telomere shrinks to a certain
extent, the cell stops dividing.
~4kb in human cells triggers end to cell
division.
This leads to other changes called
cellular senescence:
Cell morphology changes.
Gene expression changes.

20. Exponential Senescent
Senescing
Senescence of keratinocytes
Progressive changes in the cellular morphology during serial
subculture. First panel, the cells in the exponential phase showed a typical
keratinocyte cell morphology with polygonal shape, and as the cells were
entering the senescent phase, they became flat, enlarged, and contained the
clear empty spaces around the nuclei. In the senescent phase, the cells became
even larger.
• Keratin: A fibrous protein forming the main structural constituent of hair, feathers
etc.
• Keratinocyte: An epidermal cell which produces keratin