We are developers of
tropical real estate.
Our clients:
Costa Rica
Pacific
Area de Conservación Guanacaste (ACG)
ACG: 15,000 SPECIES OF LEPIDOPTERA;
5,000 FOOD PLANTS; 4,000 PARASITOIDS
rain forest

cloud forest

dry forest

marine

Pa...
Adding DNA barcoding to
biodevelopment of a complex
tropical conserved wildland.
International Barcode of Life:
iBOL - create a searchable
directory for
life on earth.
And to build
it,
8 billion searcher...
We are talking about
GPS for biodiversity.
-------

Where is your specimen
in taxonomic space?
parataxonomists: 38 secure careers
in wildland biodiversity management
~ Area of Philadelphia and
suburbs
85 km (1,200 km2)
12 Life Zones
13 rearing barns
365 days/year

~ 3 parataxonomists do ...
building the caterpillar and barcode library
13
stack of
events

03-SRNP-8745

http://janzen.sas.upenn.edu

03-SRNP-8745
Codotractus imalena

http://janzen.sas.upenn.edu
...
Truck fulls

32 years of ACG Nymphalidae to
US National Museum of Natural History
130,000+ 5-legged vouchers.
Names are Us
History footnote: March 2003,
Professor Paul Hebert &
government Canada. Thank you.
The Mitochondrial Genome
D-Loop

Small ribosomal RNA
Large
ribosomal RNA

Cyt b

ND1

ND6
ND5

L-strand

COI
COI

ND2

H-s...
An actual fly
DNA barcode –

A 650-letter “word”
ACTTTATATTTTATTTTTGGAGCTTGATCTAGAATAATTGGAACTT
CTTTAAGAATATTAATTCGAATTGAA...
We are talking about
GPS for biodiversity.
-------

Where is your specimen
in taxonomic space?
Biodiversity Institute of Ontario

I, robot

$400,000
barcodes, export quality from Canada
How do I get them?
Bob Poole at Nearctica
http://www.nearctica.com/Argyrosticta/Argyrosticta.htm
Opsiphanes bogotanus
tamarindi
zelotes

cassini

quiteria
invirae
Opsiphanes bogotanus
tamarindi
zelotes

cassini

Janzen01
quiteria
invirae
Opsiphanes bogotanus
girls

tamarindi

cassini

zelotes
Janzen01

cassini
boys

cassini

Janzen01
quiteria
Janzen01

invir...
Opsiphanes fabricii

Opsiphanes jacobsorum
Opsiphanes fabricii

Opsiphanes jacobsorum
Opsiphanes quiteria

Opsiphanes jacobsorum
Licania arborea 27
Hirtella racemosa 63
Chrysobalanaceae

Inga spp. 85
Andira inermis 2
Zygia longifolia 36
Fabaceae

Prep...
Prepona
laertes &
demodice
Amphonyx
lucifer
Udranomia
kikkawai
Eacles
imperialis
Danaus gilippus 1863
Asturodes fimbriauralis eats Colubrina (Rhamnaceae)

8% different in
DNA barcodes

rain forest
sympatric
Asturodes new spe...
Anacrusis
males

Anacrusis
females
Urbanus segnestami

Urbanus bernikerni

Urbanus ehakerni

Once Urbanus belli, now three new species
U. belliDHJ01
U. belliDHJ02
U. belliDHJ03
Tropical submontane evergreen forest
Evergreen seasonal lowland forest
subtropic...
16,000+ records of parasitic
flies (Tachinidae), 5% of all.
420 morphospecies of flies.
96% very specialized, but
16 gener...
Tachinidae
Alex Smith
Univ. Guelph
Those

16 generalist
species

turned into
73 species.

Of these, nine
remain
generalists.
Canada to Argentina
Creagrura nigripes

Cubus validus

ICHNEUMONIDAE
Hyposoter INB-42

Mexico to Costa Rica
Hesperiidae: Nascus broteas
x Braconidae: Apanteles leucostigmus
Braconidae: Microgastrinae: Apanteles leucostigmus

becomes Braconidae: Microgastrinae: 37 species

3 32
32
2 rr
640 new species of Costa Rican campoplegine parasitic wasps, all INBio and donors

186 new species of ACG braconid microga...
ACG June 2013
What we thought we know, we don’t know. Use the new orca pictures. If time,
A second one of giraffes or elep...
From 30,000 feet, a trap sample:
27 Auto cari & 1 Auto minivani
Ian Gauld (1947-2009) = superb ichneumonid taxonomist
routine identification
Enicospilus (Ichneumonidae)
before barcoding, 1 day of work to identify,40spp
after barcoding, 11 undescribed species
What’s the hurry?
if you can’t read the forest,
it’s just firewood
if you can’t read the forest,
it’s just biofuel
Wright Brothers’ airplane
1978
2013
Canadian National Collection
accumulated voucher specimens
Atacta brasiliensis
sort by barcode, by host caterpillar
DHJ01

DHJ02
Noctuidae hosts of Atacta brasiliensis

Coenipeta bibitrix

Mocis latipes
Ethmia stephenrumseyi

Tithraustes lambertae

Erbessa stroudi

Phareas burnsi

Porphyrogenes peterwegei

Anacrusis terrimc...
150 staff
$6.5 m/year

2% of
Costa Rica

165,000 ha
2%

Of 9,000+ species
3 cases with nearly
identical barcodes

Adelpha

melanthe

Adelpha

phylaca
What we lack is

a program called “Know thy park”
conducted by the conserved wildland
itself
in collaboration with the nat...
We have extraordinarily poor knowledge
and understanding of
what it is we are conserving,
what it does,
where it lives, an...
Phareas burnsi 2013
Phareas coeleste 1852
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Janzen ecn2013
Upcoming SlideShare
Loading in …5
×

Janzen ecn2013

492 views

Published on

Published in: Business, Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
492
On SlideShare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
34
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide
  • C:\Documents and Settings\Owner\Desktop\19122008 - am\01122008\Jose planning - churchill microgastrinae\PatelloaxanthuraDHJ01-DHJPAR000352911112008.FAS
  • Janzen ecn2013

    1. 1. We are developers of tropical real estate.
    2. 2. Our clients:
    3. 3. Costa Rica Pacific Area de Conservación Guanacaste (ACG)
    4. 4. ACG: 15,000 SPECIES OF LEPIDOPTERA; 5,000 FOOD PLANTS; 4,000 PARASITOIDS rain forest cloud forest dry forest marine Pacific Ocean 1,200 KM2 LAND: PHILADELPHIA AND SUBURBS
    5. 5. Adding DNA barcoding to biodevelopment of a complex tropical conserved wildland.
    6. 6. International Barcode of Life: iBOL - create a searchable directory for life on earth. And to build it, 8 billion searchers.
    7. 7. We are talking about GPS for biodiversity. ------- Where is your specimen in taxonomic space?
    8. 8. parataxonomists: 38 secure careers in wildland biodiversity management
    9. 9. ~ Area of Philadelphia and suburbs 85 km (1,200 km2) 12 Life Zones 13 rearing barns 365 days/year ~ 3 parataxonomists do ~ 40,000 rearings/yr
    10. 10. building the caterpillar and barcode library
    11. 11. 13
    12. 12. stack of events 03-SRNP-8745 http://janzen.sas.upenn.edu 03-SRNP-8745 Codotractus imalena http://janzen.sas.upenn.edu Hesperiidae 03-SRNP-8745 Codotractus imalena http://janzen.sas.upenn.edu Estacion Cacao 03-SRNP-8745 Codotractus imalena http://janzen.sas.upenn.edu Sector Hesperiidae Cacao 03-SRNP-8745 Estacion Cacao Hesperiidae Codotractus Area de Conservacion imalena http://janzen.sas.upenn.edu 03-SRNP-8745 Sector Codotractus imalena Estacion Cacao Hesperiidae Guanacaste Cacao http://janzen.sas.upenn.edu 03-SRNP-8745 Area de Hesperiidae Conservacion Sector Cacao Costa Rica Estacion Cacao imalena Codotractus 03-SRNP-8745 Guanacastehttp://janzen.sas.upenn.edu Area de Hesperiidae Conservacion Sector Codotractus imalena N323150 E375650 Cacao Estacion Cacao CostaArea de Conservacion Rica 03-SRNP-8745 Guanacastehttp://janzen.sas.upenn.edu 03/21/2003 Sector Cacao Estacion Cacao Hesperiidae N323150Ricade Codotractus imalena E375650http://janzen.sas.upenn.edu CostaArea LonchocarpusGuanacaste 03-SRNP-8745 Conservacion Sector Cacao Estacion Cacao Hesperiidae 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus imalena CostaArea oliganthus (Fabaceae)Estacion Cacao Guanacaste 03-SRNP-8745 Conservacion Sector Cacao Codotractus imalena Lonchocarpus Rica Hesperiidae 03/21/2003E375650http://janzen.sas.upenn.edu N323150 Harry Ramirez CostaArea de Conservacion Guanacaste 03-SRNP-8745 Sector Codotractus imalena Estacion Cacao oliganthus (Fabaceae)Cacao Lonchocarpus Rica Hesperiidae 03/21/2003E375650http://janzen.sas.upenn.edu +70 more fields CostaArea de Conservacion N323150 Guanacaste 03-SRNP-8745 Sector HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus (Fabaceae)Cacao 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus CostaArea Guanacaste 03-SRNP-8745 Conservacion Sector Codotractus +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Conservacion CostaArea Guanacaste 03-SRNP-8745 Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Rica Codotractus Costa Sector Guanacaste 03-SRNP-8745 Conservacion +70 more fields (Fabaceae)Cacao HarryLonchocarpus de Hesperiidae Ramirez Area Estacion Cacao imalena oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus CostaArea Guanacaste 03-SRNP-8762 Conservacion Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650http://janzen.sas.upenn.edu N323150Ricade Codotractus CostaArea Guanacaste Conservacion Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao imalena Ramirez Hesperiidae oliganthus 03/21/2003E375650 N323150Ricade Codotractus CostaArea Guanacaste Conservacion Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao Ramirez Hesperiidae oliganthus 03/21/2003E375650 N323150Ricade Conservacion CostaArea Guanacaste Sector +70 more fields (Fabaceae)Cacao HarryLonchocarpus Estacion Cacao Ramirez oliganthus 03/21/2003E375650 N323150Rica Costa Sector Guanacaste +70 more fields (Fabaceae)Cacao HarryLonchocarpus de Conservacion Ramirez Area oliganthus 03/21/2003E375650 N323150Rica Costa Guanacaste +70 more fields (Fabaceae) HarryLonchocarpus de Conservacion Ramirez Area oliganthus 03/21/2003E375650 N323150Rica Costa Guanacaste +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus 03/21/2003E375650 N323150Rica Costa +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus 03/21/2003E375650 N323150 +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus 03/21/2003 +70 more fields (Fabaceae) HarryLonchocarpus Ramirez oliganthus +70 more fields (Fabaceae) Harry Ramirez oliganthus +70 more fields Harry Ramirez +70 more fields COI: atcgcctaatgctgga…. …millions
    13. 13. Truck fulls 32 years of ACG Nymphalidae to US National Museum of Natural History
    14. 14. 130,000+ 5-legged vouchers.
    15. 15. Names are Us
    16. 16. History footnote: March 2003, Professor Paul Hebert & government Canada. Thank you.
    17. 17. The Mitochondrial Genome D-Loop Small ribosomal RNA Large ribosomal RNA Cyt b ND1 ND6 ND5 L-strand COI COI ND2 H-strand ND4 COI ND4L ND3 COIII COII ATPase subunit 8 ATPase subunit 6
    18. 18. An actual fly DNA barcode – A 650-letter “word” ACTTTATATTTTATTTTTGGAGCTTGATCTAGAATAATTGGAACTT CTTTAAGAATATTAATTCGAATTGAATTAGGTCATCCAGGTTCCTT AATTGGAAATGACCAAATTTATAATGTAATTGTAACAGCTCATGC ATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGA TTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAG CTTTTCCTCGAATGAATAATATAAGTTTTTGACTTCTTCCTCCTGCT TTAATACTTTTATTAACAAGTAGAATAGTAGAAAGTGGAGCTGGA ACAGGATGAACAGTTTATCCTCCTTTATCATCTATTATTGCTCATG GAGGAGCATCTGTTGACTTAGCTATTTTTTCTCTTCATTTAGCAGG AATTTCTTCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATT AATATACGATCTATTGGTATTACCTTTGATCGAATACCTTTATTTG TTTGATCAGTTGCTATTACAGCCTTATTACTTTTATTATCTTTACCA GTTTTAGCTGGAGCAATTACAATATTATTAACNGATCGAAATTTA AATACATCATTTTTTG
    19. 19. We are talking about GPS for biodiversity. ------- Where is your specimen in taxonomic space?
    20. 20. Biodiversity Institute of Ontario I, robot $400,000
    21. 21. barcodes, export quality from Canada
    22. 22. How do I get them?
    23. 23. Bob Poole at Nearctica http://www.nearctica.com/Argyrosticta/Argyrosticta.htm
    24. 24. Opsiphanes bogotanus tamarindi zelotes cassini quiteria invirae
    25. 25. Opsiphanes bogotanus tamarindi zelotes cassini Janzen01 quiteria invirae
    26. 26. Opsiphanes bogotanus girls tamarindi cassini zelotes Janzen01 cassini boys cassini Janzen01 quiteria Janzen01 invirae
    27. 27. Opsiphanes fabricii Opsiphanes jacobsorum
    28. 28. Opsiphanes fabricii Opsiphanes jacobsorum
    29. 29. Opsiphanes quiteria Opsiphanes jacobsorum
    30. 30. Licania arborea 27 Hirtella racemosa 63 Chrysobalanaceae Inga spp. 85 Andira inermis 2 Zygia longifolia 36 Fabaceae Prepona laertes
    31. 31. Prepona laertes & demodice Amphonyx lucifer Udranomia kikkawai Eacles imperialis
    32. 32. Danaus gilippus 1863
    33. 33. Asturodes fimbriauralis eats Colubrina (Rhamnaceae) 8% different in DNA barcodes rain forest sympatric Asturodes new species eats Gouania (Rhamnaceae)
    34. 34. Anacrusis males Anacrusis females
    35. 35. Urbanus segnestami Urbanus bernikerni Urbanus ehakerni Once Urbanus belli, now three new species
    36. 36. U. belliDHJ01 U. belliDHJ02 U. belliDHJ03 Tropical submontane evergreen forest Evergreen seasonal lowland forest subtropical Rain – Cloud forest Coastal rainforest Lowland deciduous forest Semi deciduous –deciduous forest Lowland semi deciduous forest Mangrove forest Herbaceous marshes Marshes and reed beds of typha Open savanna grasses Wooded savannah Shrub vegetation with isolated clumps Alluvial tropical rainforest vegetation
    37. 37. 16,000+ records of parasitic flies (Tachinidae), 5% of all. 420 morphospecies of flies. 96% very specialized, but 16 generalists with names. Monty Wood, taxonomist. But, are they generalists? Barcode 16 species.
    38. 38. Tachinidae Alex Smith Univ. Guelph
    39. 39. Those 16 generalist species turned into 73 species. Of these, nine remain generalists.
    40. 40. Canada to Argentina Creagrura nigripes Cubus validus ICHNEUMONIDAE Hyposoter INB-42 Mexico to Costa Rica
    41. 41. Hesperiidae: Nascus broteas x Braconidae: Apanteles leucostigmus
    42. 42. Braconidae: Microgastrinae: Apanteles leucostigmus becomes Braconidae: Microgastrinae: 37 species 3 32 32 2 rr
    43. 43. 640 new species of Costa Rican campoplegine parasitic wasps, all INBio and donors 186 new species of ACG braconid microgastrine parasitic wasps, all current ACG staff 800 new species of ACG tachinid parasitic flies, all current and past ACG staff & donors
    44. 44. ACG June 2013 What we thought we know, we don’t know. Use the new orca pictures. If time, A second one of giraffes or elephants. Everyone of us thinks we know the name; none of 7 billion people do.
    45. 45. From 30,000 feet, a trap sample: 27 Auto cari & 1 Auto minivani
    46. 46. Ian Gauld (1947-2009) = superb ichneumonid taxonomist
    47. 47. routine identification
    48. 48. Enicospilus (Ichneumonidae)
    49. 49. before barcoding, 1 day of work to identify,40spp
    50. 50. after barcoding, 11 undescribed species
    51. 51. What’s the hurry?
    52. 52. if you can’t read the forest, it’s just firewood
    53. 53. if you can’t read the forest, it’s just biofuel
    54. 54. Wright Brothers’ airplane
    55. 55. 1978
    56. 56. 2013
    57. 57. Canadian National Collection
    58. 58. accumulated voucher specimens
    59. 59. Atacta brasiliensis
    60. 60. sort by barcode, by host caterpillar
    61. 61. DHJ01 DHJ02
    62. 62. Noctuidae hosts of Atacta brasiliensis Coenipeta bibitrix Mocis latipes
    63. 63. Ethmia stephenrumseyi Tithraustes lambertae Erbessa stroudi Phareas burnsi Porphyrogenes peterwegei Anacrusis terrimccarthyae Urbanus bernikerni Euglyphis jessiehillae Dunama jessiebarronae
    64. 64. 150 staff $6.5 m/year 2% of Costa Rica 165,000 ha
    65. 65. 2% Of 9,000+ species 3 cases with nearly identical barcodes Adelpha melanthe Adelpha phylaca
    66. 66. What we lack is a program called “Know thy park” conducted by the conserved wildland itself in collaboration with the national and international community.
    67. 67. We have extraordinarily poor knowledge and understanding of what it is we are conserving, what it does, where it lives, and how to find it when we want it -in the big disorderly green garden. And we ask starving and stressed society to pay the bill to conserve the garden?
    68. 68. Phareas burnsi 2013 Phareas coeleste 1852

    ×