SlideShare a Scribd company logo

Bioinformetics - genetic variation between haemoglobin protein of humans and macaca primates

•Download as PPTX, PDF•
•
Aniket Bagul
Aniket Bagul

Bioinformetics...genetic variation between haemoglobin protein of humans and macaca primates

ScienceTechnology
1 of 29
             
   
 GTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTA CTGCCCTGTGGGGCAAGGTGAACGTGGATGAA GTTG GTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTC TACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG GGA TCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAA GGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGC C TTTAGTGATGGCCTGGCTCACCTGGACAACCTCAA GGGCACCTTTGCCACACTGAGTGAGCTGCACTGT G ACAAGCTGCACGTGGATCCTGAGAACTTCAGGCT CCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCAT CA CTTTGGCAAAGAATTCACCCCACCAGTGCAGGCT GCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATG CC CTGGCCCACAAGTATCAC  ACACTTGCTTCTGACACAACTGTGTTCACGAGCAAC CTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGAATGCCGTCACCACCCTGTGGGGCAA GGTGAACGTGGATGAAGTTGGTGGTGAGGCCCT GGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTT CTTTGAGTCCTTTGGGGATCTGTCCTCTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGC AAGAAAGTGCTTGGTGCCTTTAGTGATGGCCTGAA TCACCTGGACAACCTCAAGGGTACCTTTGCCCAGCT CAGTGAGCTGCACTGTGACAAGCTGCATGTGGAT CCTGAGAACTTCAAGCTCCTGGGCAACGTGCTGGT GTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCGCAAGTGCAGGCTGCCTATCAGAAAGTGGT GGCTGGTGTGGCTAATGCCCTGGCCCACAAGTAC CA CTAAGCTCACTTTCTTGCTGTCCAATTTCTACCAAAGG TTCCTTTGTTCCCAAAGTCCAACTACTGAACT GGGGGATATTATGAAGGGCCTTGAGGATCTGGAT TCTGCCTAAT
     
Bioinformetics - genetic variation between haemoglobin protein of humans and macaca primates
Bioinformetics - genetic variation between haemoglobin protein of humans and macaca primates

Recommended

Q no
Q noQ no
Q noVikas Sharma
 
Question 7
Question 7Question 7
Question 7kelseywatkinsx
 
Bug hunt 0.2
Bug hunt 0.2Bug hunt 0.2
Bug hunt 0.2BugNunt
 
Gene therapy
Gene therapyGene therapy
Gene therapyAniket Bagul
 
Distribution dani ardianto
Distribution dani ardiantoDistribution dani ardianto
Distribution dani ardiantoFebry Badulu
 
Brand identity -
Brand identity - Brand identity -
Brand identity - kelseywatkinsx
 
Distribution dani a
Distribution dani aDistribution dani a
Distribution dani aFebry Badulu
 
Powerpoin kristiadi
Powerpoin kristiadiPowerpoin kristiadi
Powerpoin kristiadiFebry Badulu
 

Recommended

Q no
Q noQ no
Q noVikas Sharma
 
Question 7
Question 7Question 7
Question 7kelseywatkinsx
 
Bug hunt 0.2
Bug hunt 0.2Bug hunt 0.2
Bug hunt 0.2BugNunt
 
Gene therapy
Gene therapyGene therapy
Gene therapyAniket Bagul
 
Distribution dani ardianto
Distribution dani ardiantoDistribution dani ardianto
Distribution dani ardiantoFebry Badulu
 
Brand identity -
Brand identity - Brand identity -
Brand identity - kelseywatkinsx
 
Distribution dani a
Distribution dani aDistribution dani a
Distribution dani aFebry Badulu
 
Powerpoin kristiadi
Powerpoin kristiadiPowerpoin kristiadi
Powerpoin kristiadiFebry Badulu
 
Distribution dani ardianto
Distribution dani ardiantoDistribution dani ardianto
Distribution dani ardiantoFebry Badulu
 
Textual analysis film covers
Textual analysis film coversTextual analysis film covers
Textual analysis film coverskelseywatkinsx
 
Besaran dan Ukuran
Besaran dan UkuranBesaran dan Ukuran
Besaran dan UkuranAflah Aufaa
 
Presenta si produksi by febri susanto
Presenta si produksi by febri susantoPresenta si produksi by febri susanto
Presenta si produksi by febri susantoFebry Badulu
 
Quantifying Fan Engagement using Social Media
Quantifying Fan Engagement using Social MediaQuantifying Fan Engagement using Social Media
Quantifying Fan Engagement using Social MediaEdward Kwartler
 
Presentase produksi
Presentase produksiPresentase produksi
Presentase produksiFebry Badulu
 
Frofil doni ok
Frofil doni okFrofil doni ok
Frofil doni okFebry Badulu
 
Tugas mata kuliah = supply chain management
Tugas mata kuliah = supply chain managementTugas mata kuliah = supply chain management
Tugas mata kuliah = supply chain managementFebry Badulu
 
Drama
DramaDrama
DramaAlvina Yousaf
 
Interesting Tuur
Interesting TuurInteresting Tuur
Interesting Tuurmeneertuur
 
Wessex Genomic Medicine Centre: Predict, Prevent, Adapt
Wessex Genomic Medicine Centre: Predict, Prevent, AdaptWessex Genomic Medicine Centre: Predict, Prevent, Adapt
Wessex Genomic Medicine Centre: Predict, Prevent, AdaptHealth Innovation Wessex
 
Biotech Era Ahead: Transcriptomics
Biotech Era Ahead: TranscriptomicsBiotech Era Ahead: Transcriptomics
Biotech Era Ahead: TranscriptomicsTaha A. Taha
 
Bio animation
Bio animationBio animation
Bio animationpunxsyscience
 
Anatomy of an Entrepreneur - Rice Alliance July 2010
Anatomy of an Entrepreneur - Rice Alliance July 2010Anatomy of an Entrepreneur - Rice Alliance July 2010
Anatomy of an Entrepreneur - Rice Alliance July 2010Marc Nathan
 
Jordt_Transcription_flipbook
Jordt_Transcription_flipbookJordt_Transcription_flipbook
Jordt_Transcription_flipbookpunxsyscience
 
primer analysis.pdf
primer analysis.pdfprimer analysis.pdf
primer analysis.pdfAaimaAfzaal
 
Buenas practicas
Buenas practicasBuenas practicas
Buenas practicasadjfklas dfjsld fsdl
 
Gerencia de informatic apdf
Gerencia de informatic apdfGerencia de informatic apdf
Gerencia de informatic apdfGiomar Serna
 
Allegato 2
Allegato 2Allegato 2
Allegato 2Luca De Cristofaro
 
Es dynamik dentin broschüre web
Es dynamik dentin broschüre webEs dynamik dentin broschüre web
Es dynamik dentin broschüre webNoe Soria
 
Molecular genetics i
Molecular genetics iMolecular genetics i
Molecular genetics iNathaniel Pearson
 
Get the Most from a Single Cell Infographic
Get the Most from a Single Cell InfographicGet the Most from a Single Cell Infographic
Get the Most from a Single Cell InfographicQIAGEN
 

More Related Content

Viewers also liked

Distribution dani ardianto
Distribution dani ardiantoDistribution dani ardianto
Distribution dani ardiantoFebry Badulu
 
Textual analysis film covers
Textual analysis film coversTextual analysis film covers
Textual analysis film coverskelseywatkinsx
 
Besaran dan Ukuran
Besaran dan UkuranBesaran dan Ukuran
Besaran dan UkuranAflah Aufaa
 
Presenta si produksi by febri susanto
Presenta si produksi by febri susantoPresenta si produksi by febri susanto
Presenta si produksi by febri susantoFebry Badulu
 
Quantifying Fan Engagement using Social Media
Quantifying Fan Engagement using Social MediaQuantifying Fan Engagement using Social Media
Quantifying Fan Engagement using Social MediaEdward Kwartler
 
Presentase produksi
Presentase produksiPresentase produksi
Presentase produksiFebry Badulu
 
Tugas mata kuliah = supply chain management
Tugas mata kuliah = supply chain managementTugas mata kuliah = supply chain management
Tugas mata kuliah = supply chain managementFebry Badulu
 

Viewers also liked (9)

Distribution dani ardianto
Distribution dani ardiantoDistribution dani ardianto
Distribution dani ardianto
 
Textual analysis film covers
Textual analysis film coversTextual analysis film covers
Textual analysis film covers
 
Besaran dan Ukuran
Besaran dan UkuranBesaran dan Ukuran
Besaran dan Ukuran
 
Presenta si produksi by febri susanto
Presenta si produksi by febri susantoPresenta si produksi by febri susanto
Presenta si produksi by febri susanto
 
Quantifying Fan Engagement using Social Media
Quantifying Fan Engagement using Social MediaQuantifying Fan Engagement using Social Media
Quantifying Fan Engagement using Social Media
 
Presentase produksi
Presentase produksiPresentase produksi
Presentase produksi
 
Frofil doni ok
Frofil doni okFrofil doni ok
Frofil doni ok
 
Tugas mata kuliah = supply chain management
Tugas mata kuliah = supply chain managementTugas mata kuliah = supply chain management
Tugas mata kuliah = supply chain management
 
Drama
DramaDrama
Drama
 

Similar to Bioinformetics - genetic variation between haemoglobin protein of humans and macaca primates

Interesting Tuur
Interesting TuurInteresting Tuur
Interesting Tuurmeneertuur
 
Wessex Genomic Medicine Centre: Predict, Prevent, Adapt
Wessex Genomic Medicine Centre: Predict, Prevent, AdaptWessex Genomic Medicine Centre: Predict, Prevent, Adapt
Wessex Genomic Medicine Centre: Predict, Prevent, AdaptHealth Innovation Wessex
 
Biotech Era Ahead: Transcriptomics
Biotech Era Ahead: TranscriptomicsBiotech Era Ahead: Transcriptomics
Biotech Era Ahead: TranscriptomicsTaha A. Taha
 
Anatomy of an Entrepreneur - Rice Alliance July 2010
Anatomy of an Entrepreneur - Rice Alliance July 2010Anatomy of an Entrepreneur - Rice Alliance July 2010
Anatomy of an Entrepreneur - Rice Alliance July 2010Marc Nathan
 
Jordt_Transcription_flipbook
Jordt_Transcription_flipbookJordt_Transcription_flipbook
Jordt_Transcription_flipbookpunxsyscience
 
primer analysis.pdf
primer analysis.pdfprimer analysis.pdf
primer analysis.pdfAaimaAfzaal
 
Gerencia de informatic apdf
Gerencia de informatic apdfGerencia de informatic apdf
Gerencia de informatic apdfGiomar Serna
 
Es dynamik dentin broschüre web
Es dynamik dentin broschüre webEs dynamik dentin broschüre web
Es dynamik dentin broschüre webNoe Soria
 
Get the Most from a Single Cell Infographic
Get the Most from a Single Cell InfographicGet the Most from a Single Cell Infographic
Get the Most from a Single Cell InfographicQIAGEN
 
Sequence Analysis - 2-16-16 (1)
Sequence Analysis - 2-16-16 (1)Sequence Analysis - 2-16-16 (1)
Sequence Analysis - 2-16-16 (1)Alexander Ward
 
Mesa "Les Dades Curen" Jornades Big Data Institucions - David Torrents
Mesa "Les Dades Curen" Jornades Big Data Institucions - David TorrentsMesa "Les Dades Curen" Jornades Big Data Institucions - David Torrents
Mesa "Les Dades Curen" Jornades Big Data Institucions - David TorrentsIniciativa Barcelona Open Data
 
Gene mutations
Gene mutationsGene mutations
Gene mutationspawl9
 
Transcription and Translation Flip book Joseph Whitman
Transcription and Translation Flip book Joseph WhitmanTranscription and Translation Flip book Joseph Whitman
Transcription and Translation Flip book Joseph Whitmanpunxsyscience
 
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationSite directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationTyler Liang
 

Similar to Bioinformetics - genetic variation between haemoglobin protein of humans and macaca primates (20)

Interesting Tuur
Interesting TuurInteresting Tuur
Interesting Tuur
 
Wessex Genomic Medicine Centre: Predict, Prevent, Adapt
Wessex Genomic Medicine Centre: Predict, Prevent, AdaptWessex Genomic Medicine Centre: Predict, Prevent, Adapt
Wessex Genomic Medicine Centre: Predict, Prevent, Adapt
 
Biotech Era Ahead: Transcriptomics
Biotech Era Ahead: TranscriptomicsBiotech Era Ahead: Transcriptomics
Biotech Era Ahead: Transcriptomics
 
Bio animation
Bio animationBio animation
Bio animation
 
Anatomy of an Entrepreneur - Rice Alliance July 2010
Anatomy of an Entrepreneur - Rice Alliance July 2010Anatomy of an Entrepreneur - Rice Alliance July 2010
Anatomy of an Entrepreneur - Rice Alliance July 2010
 
Jordt_Transcription_flipbook
Jordt_Transcription_flipbookJordt_Transcription_flipbook
Jordt_Transcription_flipbook
 
primer analysis.pdf
primer analysis.pdfprimer analysis.pdf
primer analysis.pdf
 
Buenas practicas
Buenas practicasBuenas practicas
Buenas practicas
 
Gerencia de informatic apdf
Gerencia de informatic apdfGerencia de informatic apdf
Gerencia de informatic apdf
 
Allegato 2
Allegato 2Allegato 2
Allegato 2
 
Es dynamik dentin broschüre web
Es dynamik dentin broschüre webEs dynamik dentin broschüre web
Es dynamik dentin broschüre web
 
Molecular genetics i
Molecular genetics iMolecular genetics i
Molecular genetics i
 
Get the Most from a Single Cell Infographic
Get the Most from a Single Cell InfographicGet the Most from a Single Cell Infographic
Get the Most from a Single Cell Infographic
 
Circle
CircleCircle
Circle
 
Sequence Analysis - 2-16-16 (1)
Sequence Analysis - 2-16-16 (1)Sequence Analysis - 2-16-16 (1)
Sequence Analysis - 2-16-16 (1)
 
Mesa "Les Dades Curen" Jornades Big Data Institucions - David Torrents
Mesa "Les Dades Curen" Jornades Big Data Institucions - David TorrentsMesa "Les Dades Curen" Jornades Big Data Institucions - David Torrents
Mesa "Les Dades Curen" Jornades Big Data Institucions - David Torrents
 
Gene mutations
Gene mutationsGene mutations
Gene mutations
 
Transcription and Translation Flip book Joseph Whitman
Transcription and Translation Flip book Joseph WhitmanTranscription and Translation Flip book Joseph Whitman
Transcription and Translation Flip book Joseph Whitman
 
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationSite directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
 
Clustering Genes: W-curve + TSP
Clustering Genes: W-curve + TSPClustering Genes: W-curve + TSP
Clustering Genes: W-curve + TSP
 

Recently uploaded

Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRDelhi Call girls
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxgindu3009
 
Cultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxCultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxpradhanghanshyam7136
 
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCESTERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCEPRINCE C P
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Lokesh Kothari
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfmuntazimhurra
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...jana861314
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksSérgio Sacani
 
Types of different blotting techniques.pptx
Types of different blotting techniques.pptxTypes of different blotting techniques.pptx
Types of different blotting techniques.pptxkhadijarafiq2012
 
GFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptxGFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptxAleenaTreesaSaji
 
G9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptG9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptMAESTRELLAMesa2
 
Work, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE PhysicsWork, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE Physicsvishikhakeshava1
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhousejana861314
 
Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.aasikanpl
 
A relative description on Sonoporation.pdf
A relative description on Sonoporation.pdfA relative description on Sonoporation.pdf
A relative description on Sonoporation.pdfnehabiju2046
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Sérgio Sacani
 
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡anilsa9823
 
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfAnalytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfSwapnil Therkar
 

Recently uploaded (20)

Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
 
The Philosophy of Science
The Philosophy of ScienceThe Philosophy of Science
The Philosophy of Science
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
Cultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxCultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptx
 
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCESTERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 
Biological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdfBiological Classification BioHack (3).pdf
Biological Classification BioHack (3).pdf
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disks
 
Types of different blotting techniques.pptx
Types of different blotting techniques.pptxTypes of different blotting techniques.pptx
Types of different blotting techniques.pptx
 
GFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptxGFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptx
 
G9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.pptG9 Science Q4- Week 1-2 Projectile Motion.ppt
G9 Science Q4- Week 1-2 Projectile Motion.ppt
 
Work, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE PhysicsWork, Energy and Power for class 10 ICSE Physics
Work, Energy and Power for class 10 ICSE Physics
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhouse
 
Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
Call Girls in Munirka Delhi 💯Call Us 🔝9953322196🔝 💯Escort.
 
A relative description on Sonoporation.pdf
A relative description on Sonoporation.pdfA relative description on Sonoporation.pdf
A relative description on Sonoporation.pdf
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
 
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
CALL ON ➥8923113531 🔝Call Girls Kesar Bagh Lucknow best Night Fun service 🪡
 
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdfAnalytical Profile of Coleus Forskohlii | Forskolin .pdf
Analytical Profile of Coleus Forskohlii | Forskolin .pdf
 

Bioinformetics - genetic variation between haemoglobin protein of humans and macaca primates