SlideShare a Scribd company logo
1 of 35
PRODUCTION AND CHARACTERISATION
OF
BY LACTOBACILLUS PARACASEI FROM DAIRY
SAMPLES
• Dextran is group of high molecular mass polysaccharides.
• Composed of complex branched Glucan chains of different
lengths(3to2000kd).
• It is used to medicinally as an Antithrombotic (antiplatelet) to
reduce blood viscosity.
Introduction Of Dextran
• Dextran was first discovered by Louis Pasteur as a microbial
product in wine.
• Scheilberin (1874) confirmed that this microbial
polysaccharide with the empirical formula (C6H10O6) n and
therefore named as “dextran”.
• Dextran is produced by species of Leuconostoc, Lactobacillus
, Streptococcus and Acetobacter.
• It finds various other industrial applications .
Objectives
 Isolation of bacterial stain from dairy sources.
 Biochemical Characterization of the isolated bacterial stain and
identification.
 Confirmation of the identified bacterial stain using Sanger’s sequencing
method.
 Production of Dextran by the bacterial stain isolated from dairy and
vegetable sources.
 Characterization and confirmation of Dextran using FTIR analysis.
D
E
X
T
R
A
N
Isolation of colonies
Characterization of
Bacterial strain
DNA sequencing
c
c
v
Production of
DEXTRAN
Characterization of
DEXTRAN
Application Of
DEXTRAN
Experimental design
• The Lactobacillus sp. were isolated from available sources :
Fermented vegetables :
 cabbage
 cauliflower
 pumpkins
 carrot and tomato
Dairy products :
 Yoghurt
 Milk
Materials and Methods
 Sources
MSE agar was prepared
and then pour into the petridish
and allowed to solidify.
Sample (milk) was
collected and was
diluted
Transfer 0.1ml of
Serial diluted sample
onto agar plates
Spread the inoculum on the
surface of the agar by L rod
method
The plate was
Incubated at
25ºC at 24 hrs
Colourless, mucous
colonies
were developed

• Gram staining
• Indole test
• Oxidase test
• Catalase production test
The isolated bacterial strain was were confirmed the
Morphological and biochemical test.
Morphological and Biochemical characterization
of bacterial isolate:
 Conformation by sanger’s sequencing
 The sample was sent for analysis of 16s r RNA Analysis
in the laboratory of Yazzah genomics, Chennai. To analysis
 DNA isolation
 PCR
 Sequencing
NCBI – BLAST
 Phylogenetic tree construction
DEXTRAN PRODUCTION
Specific Dextran production Broth
A loopful of culture of colonies was inoculated in
10 ml of Dextran production broth
This Inoculum mainly used for Dextran production
Preparation of inoculum
Culture was incubated at 26˚.C
for 18 hrs.
40 ml of Sterile Dextran production
Medium was prepared and then added to
60 ml of inoculum medium
pH was adjusted at 5.5 to make
more it viscous
Production of Dextran
dextran
production
medium
After 18 hours of incubation, the culture medium was
precipitated by using chilled ethanol.
Precipitation of Dextran
Equal amount of
ethanol was added and
stirred well and
centrifuged at 4000
rpm at 30 minutes.
The supernatant was
discarded
Chilled ethanol
was added with constant
stirring and precipitates
of dextran was obtained
It was allowed to stand
for 5–10 minutes and
supernatant was again
decanted.
• precipitated Dextran was washed with distilled water
and centrifuged thrice to get purified Dextran .
• Sterile distilled water will be added step wise to make
a paste of dextran in water.
Purification Of Dextran
 RESULTS and DISCUSSIONS
Identification organism
The Bacterial strain were initially confirmed by growing it on
the selective MSE agar. Then they were confirmed by
phenotypic and biochemical characterization.
Figure 1: Isolation bacterial sp by spread plate method- The plate shows individual
colonies of bacterial isolate
Biochemical Test Results
Gram staining Positive
Motility Non-Motile
Oxidase Negative
Catalase Negative
Indole Negative
Morphological and biochemical characterization o f bacterial
strain
Gram staining - positive
Indole test - Negative
Oxidase - Negative
Conformation of bacterial strain by sanger’s sequencing
Figure 10: Sanger sequencing
sequence
>KIR_800R.ab1 821
CCGGTCTTTTCGAGCCTCAGCGTCAGTTACAGACCAGACAGCCG
CCTTCG
CCACTGGTGTTCTTCCATATATCTACGCATTTCACCGCTACACATG
GAGT
TCCACTGTCCTCTTCTGCACTCAAGTTTCCCAGTTTCCGATGCGC
TTCCT
CGGTTAAGCCGAGGGCTTTCACATCAGACTTAAAAAACCGCCTG
CGCTCG
CTTTACGCCCAATAAATCCGGATAACGCTTGCCACCTACGTATTAC
CGCG
GCTGCTGGCACGTAGTTAGCCGTGGCTTTCTGGTTGGATACCGT
CACGCC
GACAACAGTTACTCTGCCGACCATTCTTCTCCAACAACAGAGTTT
TACGA
CCCGAAAGCCTTCTTCACTCACGCGGCGTTGCTCCATCAGACTT
GCGTCC
ATTGTGGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTTTGGGC
CGTGTC
TCAGTCCCAATGTGGCCGATCAACCTCTCAGTTCGGCTACGTATC
 NCBI - BLAST
Figure 11: The figures shows that Nucleotide sequence analysis of BLAST
Figure 12: Description Query coverage analysis of BLAST
Figure 15: Multiple Sequence alignment and Similarity studies
 Phylogenetic tree construction
Figure 16: Phylogenetic tree construction – The figure shows the
relationship of the Lactobacillus paracasei sp with its related
bacteria
Dextran production
 Preparation of inoculum
Medium pH: ± 6. 9
Temperature: 25 °C
Incubation time: 24hrs
Figure17: Preparation of inoculum
 Dextran production
Figure18: Production of Dextran in MSE Dextran preparation media
Medium pH: ± 5.7
Temperature: 25 °C
Incubation time: 18hrs
 Precipitation and Purification of Dextran
Centrifuge speed: 4000 rpm
Minutes: 10mins
 conformation of Dextran by FTIR analysis
 Application of Dextran
 Protein stabilization
 Vaccines
 Antiplaetlet
 food
• Sarwat, F., Qader, S. A. U., Aman, A., & Ahmed, N. (2008).
Production & characterization of a unique dextran from an
indigenous Leuconostoc mesenteroides CMG713.Int. J. Biol. Sci,
4(6), 379-386.
• Üretimi, D. (2005). Production of dextran by newly isolated
strains of Leuconostoc mesenteroides PCSIR-4 and PCSIR-
9.TürkBiyokimyaDergisi [Turkish Journal of Biochemistry-Turk J
Biochem], 31(1), 21-26.
 References
production and characterisation dextran by lactobacillus paracasei

More Related Content

What's hot

Streptomycin production
Streptomycin productionStreptomycin production
Streptomycin productionShipra Sood
 
Physical and Chemical Control of Microbes
Physical and Chemical Control of MicrobesPhysical and Chemical Control of Microbes
Physical and Chemical Control of MicrobesRajesh Sagalgile
 
Bacteriocins
BacteriocinsBacteriocins
BacteriocinsKumuda J
 
Strain development techniques of industrially important microorganisms
Strain development techniques of industrially important microorganismsStrain development techniques of industrially important microorganisms
Strain development techniques of industrially important microorganismsMicrobiology
 
Tower Fermernter
Tower FermernterTower Fermernter
Tower FermernterDinesh S
 
Contamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and VegetablesContamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and VegetablesSuganthiA4
 
Biotransformation of Steroids and Sterols
Biotransformation of Steroids and SterolsBiotransformation of Steroids and Sterols
Biotransformation of Steroids and SterolsKARTHIK REDDY C A
 
Microflora of raw milk, sources of milk contamination and their control.
Microflora of raw milk, sources of milk contamination and their control.Microflora of raw milk, sources of milk contamination and their control.
Microflora of raw milk, sources of milk contamination and their control.ShaistaKhan60
 
Preservation of microbes
Preservation of microbesPreservation of microbes
Preservation of microbesNithyaNandapal
 
Soy sauce Microbiological aspects
Soy sauce Microbiological aspectsSoy sauce Microbiological aspects
Soy sauce Microbiological aspectsMoksha Chib
 
Beer types, production &spoilage
Beer  types, production &spoilageBeer  types, production &spoilage
Beer types, production &spoilagePallavi Dhotra
 
Indicator organisms and water quality
Indicator organisms and water qualityIndicator organisms and water quality
Indicator organisms and water qualityDr. Samira Fattah
 
Spoilage of canned foods (MICROBIAL SPOILAGE)
Spoilage of canned foods (MICROBIAL SPOILAGE) Spoilage of canned foods (MICROBIAL SPOILAGE)
Spoilage of canned foods (MICROBIAL SPOILAGE) RaihanathusSahdhiyya
 

What's hot (20)

Streptomycin production
Streptomycin productionStreptomycin production
Streptomycin production
 
Lactic acid production
Lactic acid productionLactic acid production
Lactic acid production
 
Physical and Chemical Control of Microbes
Physical and Chemical Control of MicrobesPhysical and Chemical Control of Microbes
Physical and Chemical Control of Microbes
 
Bacteriocins
BacteriocinsBacteriocins
Bacteriocins
 
Strain development techniques of industrially important microorganisms
Strain development techniques of industrially important microorganismsStrain development techniques of industrially important microorganisms
Strain development techniques of industrially important microorganisms
 
Oriental foods
Oriental foodsOriental foods
Oriental foods
 
Tower Fermernter
Tower FermernterTower Fermernter
Tower Fermernter
 
soy sauce.pptx
soy sauce.pptxsoy sauce.pptx
soy sauce.pptx
 
Contamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and VegetablesContamination, Spoilage and preservation of Fruits and Vegetables
Contamination, Spoilage and preservation of Fruits and Vegetables
 
Biotransformation of Steroids and Sterols
Biotransformation of Steroids and SterolsBiotransformation of Steroids and Sterols
Biotransformation of Steroids and Sterols
 
Microflora of raw milk, sources of milk contamination and their control.
Microflora of raw milk, sources of milk contamination and their control.Microflora of raw milk, sources of milk contamination and their control.
Microflora of raw milk, sources of milk contamination and their control.
 
Strain Improvement
Strain ImprovementStrain Improvement
Strain Improvement
 
Organic acids production copy
Organic acids production   copyOrganic acids production   copy
Organic acids production copy
 
Preservation of microbes
Preservation of microbesPreservation of microbes
Preservation of microbes
 
Soy sauce Microbiological aspects
Soy sauce Microbiological aspectsSoy sauce Microbiological aspects
Soy sauce Microbiological aspects
 
Beer types, production &spoilage
Beer  types, production &spoilageBeer  types, production &spoilage
Beer types, production &spoilage
 
Bacteria in food science
Bacteria in food scienceBacteria in food science
Bacteria in food science
 
Indicator organisms and water quality
Indicator organisms and water qualityIndicator organisms and water quality
Indicator organisms and water quality
 
Bacterial Virulence
Bacterial VirulenceBacterial Virulence
Bacterial Virulence
 
Spoilage of canned foods (MICROBIAL SPOILAGE)
Spoilage of canned foods (MICROBIAL SPOILAGE) Spoilage of canned foods (MICROBIAL SPOILAGE)
Spoilage of canned foods (MICROBIAL SPOILAGE)
 

Similar to production and characterisation dextran by lactobacillus paracasei

ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture MediaANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture Mediacdhfinechemical
 
Feather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOTFeather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOTResmi Raj L
 
Pathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic BacteriaPathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic BacteriaAyushiSharma843565
 
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )Reshma Balakrishnan
 
Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.NEHA MISHRA
 
Practical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdfPractical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdfssuser668f10
 
Microbiologica Samples processing
Microbiologica Samples processing Microbiologica Samples processing
Microbiologica Samples processing tabeenaali
 
Work report_15_08_2016
Work report_15_08_2016Work report_15_08_2016
Work report_15_08_2016Sonali Uttam
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticAlexander Decker
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticAlexander Decker
 
Seminario biologia molecular
Seminario biologia molecularSeminario biologia molecular
Seminario biologia molecularisabelpalaciom
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...inventionjournals
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...inventionjournals
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...inventionjournals
 
Reduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINSReduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINSnisaiims
 
33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.Annadurai B
 

Similar to production and characterisation dextran by lactobacillus paracasei (20)

ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture MediaANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
ANAEROBIC CNA AGAR BASE - Dehydrated Culture Media
 
Rapid MIcrobiological Methods
Rapid MIcrobiological MethodsRapid MIcrobiological Methods
Rapid MIcrobiological Methods
 
Feather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOTFeather degrading Bacillis thuringiensis S3KUBOT
Feather degrading Bacillis thuringiensis S3KUBOT
 
Pathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic BacteriaPathogenic /Nonpathogenic Bacteria
Pathogenic /Nonpathogenic Bacteria
 
gene cloning
gene cloninggene cloning
gene cloning
 
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
MICROBIOLOGICAL TESTS (CONVENTIONAL METHODS )
 
Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.Carbohydrate, isolation and purification techniques. A complete view.
Carbohydrate, isolation and purification techniques. A complete view.
 
Practical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdfPractical 40 biochemical test microbiology.pdf
Practical 40 biochemical test microbiology.pdf
 
DNA & RNA Extraction Kit
DNA & RNA  Extraction KitDNA & RNA  Extraction Kit
DNA & RNA Extraction Kit
 
Microbiologica Samples processing
Microbiologica Samples processing Microbiologica Samples processing
Microbiologica Samples processing
 
Work report_15_08_2016
Work report_15_08_2016Work report_15_08_2016
Work report_15_08_2016
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probiotic
 
Isolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probioticIsolation and identification by pcr and analysis for probiotic
Isolation and identification by pcr and analysis for probiotic
 
Seminario biologia molecular
Seminario biologia molecularSeminario biologia molecular
Seminario biologia molecular
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
 
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
Isolation and Characterization of Bacteriocin Producing Lactic Acid Bacteria ...
 
Reduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINSReduction of cost of Genetics diagnosis test through FISH & PRINS
Reduction of cost of Genetics diagnosis test through FISH & PRINS
 
33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.33.Expression, Production and Purification of Proteinases from Aspergillus spp.
33.Expression, Production and Purification of Proteinases from Aspergillus spp.
 
WMB3
WMB3WMB3
WMB3
 

Recently uploaded

Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...
Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...
Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...shyamraj55
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Enterprise Knowledge
 
Artificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning eraArtificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning eraDeakin University
 
Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxOnBoard
 
Unlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power SystemsUnlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power SystemsPrecisely
 
My Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 PresentationMy Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 PresentationRidwan Fadjar
 
Key Features Of Token Development (1).pptx
Key  Features Of Token  Development (1).pptxKey  Features Of Token  Development (1).pptx
Key Features Of Token Development (1).pptxLBM Solutions
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupFlorian Wilhelm
 
Benefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other FrameworksBenefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other FrameworksSoftradix Technologies
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubKalema Edgar
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):comworks
 
Understanding the Laravel MVC Architecture
Understanding the Laravel MVC ArchitectureUnderstanding the Laravel MVC Architecture
Understanding the Laravel MVC ArchitecturePixlogix Infotech
 
Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsMark Billinghurst
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticscarlostorres15106
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
Build your next Gen AI Breakthrough - April 2024
Build your next Gen AI Breakthrough - April 2024Build your next Gen AI Breakthrough - April 2024
Build your next Gen AI Breakthrough - April 2024Neo4j
 
Install Stable Diffusion in windows machine
Install Stable Diffusion in windows machineInstall Stable Diffusion in windows machine
Install Stable Diffusion in windows machinePadma Pradeep
 

Recently uploaded (20)

Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...
Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...
Automating Business Process via MuleSoft Composer | Bangalore MuleSoft Meetup...
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024
 
Artificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning eraArtificial intelligence in the post-deep learning era
Artificial intelligence in the post-deep learning era
 
Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptx
 
DMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special EditionDMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special Edition
 
Unlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power SystemsUnlocking the Potential of the Cloud for IBM Power Systems
Unlocking the Potential of the Cloud for IBM Power Systems
 
My Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 PresentationMy Hashitalk Indonesia April 2024 Presentation
My Hashitalk Indonesia April 2024 Presentation
 
Key Features Of Token Development (1).pptx
Key  Features Of Token  Development (1).pptxKey  Features Of Token  Development (1).pptx
Key Features Of Token Development (1).pptx
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project Setup
 
Benefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other FrameworksBenefits Of Flutter Compared To Other Frameworks
Benefits Of Flutter Compared To Other Frameworks
 
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptxE-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding Club
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):
 
Understanding the Laravel MVC Architecture
Understanding the Laravel MVC ArchitectureUnderstanding the Laravel MVC Architecture
Understanding the Laravel MVC Architecture
 
Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR Systems
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
 
Vulnerability_Management_GRC_by Sohang Sengupta.pptx
Vulnerability_Management_GRC_by Sohang Sengupta.pptxVulnerability_Management_GRC_by Sohang Sengupta.pptx
Vulnerability_Management_GRC_by Sohang Sengupta.pptx
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
Build your next Gen AI Breakthrough - April 2024
Build your next Gen AI Breakthrough - April 2024Build your next Gen AI Breakthrough - April 2024
Build your next Gen AI Breakthrough - April 2024
 
Install Stable Diffusion in windows machine
Install Stable Diffusion in windows machineInstall Stable Diffusion in windows machine
Install Stable Diffusion in windows machine
 

production and characterisation dextran by lactobacillus paracasei