A script executed by name is not run in current process (a child process is created to run the script), so this method is suitable to be used only if the environment variables and globally defined aliases (in $HOME/.cshrc) should be known to the script.
I am Bernard. I am a C Programming Assignment Help Expert at programminghomeworkhelp.com. I hold a Ph.D. in Computer Science from, University of Leeds, UK. I have been helping students with their homework for the past 12 years. I solve assignments related to C Programming.
Visit programminghomeworkhelp.com or email support@programminghomeworkhelp.com.You can also call on +1 678 648 4277 for any assistance with C Programming assignments.
Have you ever wondered how you would implement a parser for simple arithmetic expressions in C++? Faced with this problem, many C++ programmers would generate a parser using Flex and Bison, or perhaps Boost Spirit. In this talk, I introduced some alternative tools, Ragel and Lemon, showing how they can be used to build a calculator that handles simple arithmetic expressions.
Asynchronous operations are getting more and more popular. To the point that we are getting frameworks and environments revolving strictly around that concept. Boost.ASIO, Twisted and node.js are notable example. We will not explore that area. We will focus on techniques for making asynchronous more readable. We will present different currently used solutions. At the end we will introduce coroutines and explain the concept. We will show how these can be integrated with asynchronous code and what we benefit from using coroutines in asynchronous code.
I am Bernard. I am a C Programming Assignment Help Expert at programminghomeworkhelp.com. I hold a Ph.D. in Computer Science from, University of Leeds, UK. I have been helping students with their homework for the past 12 years. I solve assignments related to C Programming.
Visit programminghomeworkhelp.com or email support@programminghomeworkhelp.com.You can also call on +1 678 648 4277 for any assistance with C Programming assignments.
Have you ever wondered how you would implement a parser for simple arithmetic expressions in C++? Faced with this problem, many C++ programmers would generate a parser using Flex and Bison, or perhaps Boost Spirit. In this talk, I introduced some alternative tools, Ragel and Lemon, showing how they can be used to build a calculator that handles simple arithmetic expressions.
Asynchronous operations are getting more and more popular. To the point that we are getting frameworks and environments revolving strictly around that concept. Boost.ASIO, Twisted and node.js are notable example. We will not explore that area. We will focus on techniques for making asynchronous more readable. We will present different currently used solutions. At the end we will introduce coroutines and explain the concept. We will show how these can be integrated with asynchronous code and what we benefit from using coroutines in asynchronous code.
learn how to program with python
from scratch to be an expert
use the link in the first slide to get the full course
here is the link if you want : https://oke.io/JdxdUl
the link of the documentation : https://oke.io/J6DeY3
link to download python : https://oke.io/BENgRLR2
На протяжении всего существования C++ тема компайл-тайм рефлексии поднимается постоянно, но, к сожалению, до сих пор Стандарт языка не дает достаточных возможностей для извлечения и манипулирования компайл-тайм информацией. Большое количество библиотек и препроцессоров было придумано для того, чтобы решить эту проблему, начиная от простых макросов и заканчивая Qt-moc или ODB. В докладе Антон расскажет о том, как на эту проблему смотрит Комитет по Стандартизации: какие решения были предложены, и какое стало доминирующим.
Tiramisu : A Code Optimization Framework for High Performance Systems
https://www.csail.mit.edu/research/tiramisu-framework-code-optimization-and-code-generation
の概要です。
ドキュメントがほとんどないので、ソースコード解析をやって、サンプルプログラムの内容について、調べてみました。
Le slide deck de l'Université que nous avons donnée avec Rémi Forax à Devoxx France 2019.
Comme promis, Java sort sa version majeure tous les 6 mois. Le train passe et amène son lot de nouveautés. Parmi elles, certaines sont sorties : une nouvelle syntaxe pour les clauses switch et l'instruction de byte code CONSTANT_DYNAMIC. D'autres sont en chantier, plus ou moins avancé : une nouvelle façon d'écrire des méthodes de façon condensée, un instanceof 'intelligent', des constantes évaluées au moment où elles sont utilisées. Les projets progressent. Loom, et son nouveau modèle de programmation concurrente que l'ont peut tester avec Jetty. Amber, qui introduit les data types et des nouvelles syntaxes. Valhalla, dont les value types donnent leurs premiers résultats. S'il est difficile de prévoir une date de sortie pour ces nouveautés, on sait en revanche qu'une fois prêtes elles sortiront en moins de 6 mois. De tout ceci nous parlerons donc au futur et en public, avec des démonstrations de code, des slides, du code, de la joie et de la bonne humeur !
Python is an interpreted, high-level, and general-purpose programming language.
It is an easy to learn general-purpose programing language.
It is a platform-independent programing language, which means it can be used on any machine and in any operating system.
It has a simple syntax
Python is a case sensitive language.
It is an interrupted language.
It is free to use and even free for commercial products.
I am Gill K. I am an Operating System Assignment Expert at programminghomeworkhelp.com. I hold a PhD. in Programming at Manchester University, UK. I have been helping students with their homework for the past 6 years. I solve assignments related to Operating System Assignment.
Visit programminghomeworkhelp.com or email support@programminghomeworkhelp.com.
You can also call on +1 678 648 4277 for any assistance with Operating System Assignment.
C++20 comes with some big new language features: modules, coroutines, concepts, spaceship, and many new libraries. But apart from all those, C++20 also offers many small language improvements, making C++ more powerful and expressive, but also safer and more consistent. This talk is an overview over all those smaller additions to the core language that will make your life easier. We will discuss much-needed improvements to existing facilities such as lambdas, CTAD, structured bindings, and initialisation, as well as brand-new language utilities that you may not yet have heard about!
Slides from a brief presentation about the 'docase' notation that I did at Haskell Hackathon in Cambridge. The notation makes it easier to work with monads that have some additional operations (such as Par monad or Parsers).
learn how to program with python
from scratch to be an expert
use the link in the first slide to get the full course
here is the link if you want : https://oke.io/JdxdUl
the link of the documentation : https://oke.io/J6DeY3
link to download python : https://oke.io/BENgRLR2
На протяжении всего существования C++ тема компайл-тайм рефлексии поднимается постоянно, но, к сожалению, до сих пор Стандарт языка не дает достаточных возможностей для извлечения и манипулирования компайл-тайм информацией. Большое количество библиотек и препроцессоров было придумано для того, чтобы решить эту проблему, начиная от простых макросов и заканчивая Qt-moc или ODB. В докладе Антон расскажет о том, как на эту проблему смотрит Комитет по Стандартизации: какие решения были предложены, и какое стало доминирующим.
Tiramisu : A Code Optimization Framework for High Performance Systems
https://www.csail.mit.edu/research/tiramisu-framework-code-optimization-and-code-generation
の概要です。
ドキュメントがほとんどないので、ソースコード解析をやって、サンプルプログラムの内容について、調べてみました。
Le slide deck de l'Université que nous avons donnée avec Rémi Forax à Devoxx France 2019.
Comme promis, Java sort sa version majeure tous les 6 mois. Le train passe et amène son lot de nouveautés. Parmi elles, certaines sont sorties : une nouvelle syntaxe pour les clauses switch et l'instruction de byte code CONSTANT_DYNAMIC. D'autres sont en chantier, plus ou moins avancé : une nouvelle façon d'écrire des méthodes de façon condensée, un instanceof 'intelligent', des constantes évaluées au moment où elles sont utilisées. Les projets progressent. Loom, et son nouveau modèle de programmation concurrente que l'ont peut tester avec Jetty. Amber, qui introduit les data types et des nouvelles syntaxes. Valhalla, dont les value types donnent leurs premiers résultats. S'il est difficile de prévoir une date de sortie pour ces nouveautés, on sait en revanche qu'une fois prêtes elles sortiront en moins de 6 mois. De tout ceci nous parlerons donc au futur et en public, avec des démonstrations de code, des slides, du code, de la joie et de la bonne humeur !
Python is an interpreted, high-level, and general-purpose programming language.
It is an easy to learn general-purpose programing language.
It is a platform-independent programing language, which means it can be used on any machine and in any operating system.
It has a simple syntax
Python is a case sensitive language.
It is an interrupted language.
It is free to use and even free for commercial products.
I am Gill K. I am an Operating System Assignment Expert at programminghomeworkhelp.com. I hold a PhD. in Programming at Manchester University, UK. I have been helping students with their homework for the past 6 years. I solve assignments related to Operating System Assignment.
Visit programminghomeworkhelp.com or email support@programminghomeworkhelp.com.
You can also call on +1 678 648 4277 for any assistance with Operating System Assignment.
C++20 comes with some big new language features: modules, coroutines, concepts, spaceship, and many new libraries. But apart from all those, C++20 also offers many small language improvements, making C++ more powerful and expressive, but also safer and more consistent. This talk is an overview over all those smaller additions to the core language that will make your life easier. We will discuss much-needed improvements to existing facilities such as lambdas, CTAD, structured bindings, and initialisation, as well as brand-new language utilities that you may not yet have heard about!
Slides from a brief presentation about the 'docase' notation that I did at Haskell Hackathon in Cambridge. The notation makes it easier to work with monads that have some additional operations (such as Par monad or Parsers).
C Programming Language Tutorial for beginners - JavaTpointJavaTpoint.Com
JavaTpoint share a presentation of C Programming language for beginners and professionals. now in this slideshare you will be learned basics of c programming language, what is c programming language, history of c programming, installing turbo c, features of c programming language, datatypes of c language, operaters in c, control statement of c language, c language functions, c array, pointer in c programming, and structure and union.
CSCI 132 Practical Unix and Programming .docxmydrynan
CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
Tekclasses provides real-time in addition to positioning targeted unix learning bangalore. Our unix shell scripting course contains essential to superior levels in addition to the unix course is designed to have the positioning within beneficial MNC businesses within bangalore seeing that easily seeing that when you finally finish the actual Unix study course.
http://tekclasses.com/course/unix-shell-scripting-training/
BACKGROUND A shell provides a command-line interface for users. I.docxwilcockiris
BACKGROUND
: A shell provides a command-line interface for users. It interprets user commands and executes them. Some shells provide simple scripting terms, such as
if
or
while
, and allow users to make a program that facilitates their computing environment. Under the hood, a shell is just another user program as you know from Minor2 assignment. The file
/bin/bash
is an executable program file for the bash shell. The only thing special about your login shell is that it is listed in your login record so that /bin/login (i.e., the program that prompts you for your password) knows what program to start when you log in. If you run "cat /etc/passwd", you will see the login records of the machine.
PROGRAM DESCRIPTION
GROUP COLLABORATIVE PORTION
: In this assignment, you will implement the shell “engine” as the group component, where all members are responsible for the following functionality.
A Command-Line Interpreter, or Shell
Your shell should read the line from standard input (i.e., interactive mode) or a file (i.e., batch mode), parse the line with command and arguments, execute the command with arguments, and then prompt for more input (i.e., the shell prompt) when it has finished. This is what Minor 2 program should do with addition of batch processing which means just reading a batch line by line and calling the same interpretation logic.
Batch Mode
In batch mode, your shell is started by specifying a batch file on its command line. The batch file contains the list of commands that should be executed. In batch mode, you should not display a prompt, but you should echo each line you read from the batch file back to the user before executing it. After a batch is finished the shell will exit.
Interactive Mode
No parameters specified on command line when the shell is started. In this mode, you will display a prompt (any string of your choice) and the user of the shell will type in a command at the prompt.
You will need to use the fork() and exec() family of system calls. You may not use the system() system call as it simply invokes the system’s /bin/bash shell to do all of the work. You may assume that arguments are separated by whitespace. You do not have to deal with special characters such as ', ", \, etc. You may assume that the command-line a user types is no longer than 512 bytes (including the '\n'), but you should not assume that there is any restriction on the number of arguments to a given command.
INDIVIDUAL PORTIONS
Build-in Commands:
Every shell needs to support a number of built-in commands, which are functions in the shell itself, not external programs. Shells directly make system calls to execute built-in commands, instead of forking a child process to handle them.
In this assignment, each member of the group will implement one of the following section and commit in GitLab the code that supports those commands:
Add a new built-in
alias
command that allows you to define a shortcut for commands by essenti.
The Korn Shell is the UNIX shell (command execution program, often c.docxSUBHI7
The Korn Shell is the UNIX shell (command execution program, often called a command interpreter) that was developed by David Korn of Bell Labs as a comprehensive, combined version of other major UNIX shells. Incorporating all the features of the C shell (csh) and the Tab C-shell (tcsh) with the script language features similar to that of the Bourne Shell, the Korn Shell is considered the most efficient shell. Korn, Bourne, and C are the 3 most commonly used UNIX shells. You will be using the Korn Shell (ksh) for this project in which you will be writing shell script files.
1.
Begin by executing the following command from a terminal session in your Ubuntu system:
sudo apt-get install ksh
You will immediately be asked to enter your password (csci345). This will install the Korn shell into your Ubuntu system on your PC or Mac for use in this project. Simply type
ksh
and to go into the Korn Shell (your system prompt will change to $ only) and then enter CTRL-D to exit out of it (your default system prompt of
[email protected]
:~$ will re-appear).
As you go through this exercise and start writing shell scripts, you will learn some additional troubleshooting tips to help you navigate through the Korn Shell (ksh).
Keep track of some of these tips (5 of them) and put them into a Word document in a list format with explanations (at least 150 words in current APA format). Make sure that these are different from those mentioned in the textbook.
2.
Do some research on what the Korn Shell is about and what it has to offer. Provide some basic information (3–5 key points) in a short report (at least 150 words in current APA format) and compile it into the same Word document as above and submit it with this project. Also, provide 5–7 positive features of the Korn Shell (ksh) in the same report (at least 150 words in current APA format) in a list. Below are 3 websites that can assist you in this effort. You will need at least 2 external references for this short report (in addition to your textbook):
-
http://kornshell.com/
-
http://www.dartmouth.edu/~rc/classes/ksh/print_pages.shtml
-
http://www.bolthole.com/solaris/ksh.html
There are many other websites out there that will give you additional help, if needed. Take a look at the ksh shell script below. There are 3 versions of essentially the same program, which is a wrapper to edit a file under SCCS version control. The basic task is to use the sccs command to “check out” a file under version control and then automatically edit the file. The script will then be used by users who may not be particularly advanced UNIX users. Hence, the need for a wrapper script. While the basic functionality is the same across all versions, the differences in safety and usability between the first version and the last (4th) version are worth noting. The first one is extremely bad: it would be written by someone who has just picked up a book on shell scripting and has decided, “I’m a programmer.
Say whether each of the following statements is true (“T”) or false .pdfRBMADU
Say whether each of the following statements is true (“T”) or false (“F”).
__ When modifying existing software, changes should follow the style of the original code.
__ In software testing, “path coverage” is another name for “statement coverage”.
__ The file command can be used to assess the type of a file.
__ The “o” in a pattern o+rx that can be given as as argument to chmod(1) stands for “owner”.
__ A downside to operating systems like LINUX and UNIX is that they still use the concept of
processes.
Other operating systems, such as Microsoft Windows, have done away with processes.
__ To send a signal to a process we use the >>> construct in the shell. For example, to send a
SIGKILL to a process with PID 7476, we would give the command
__ A characteristic of TDD (test-driven development) is the extensive use of prototypes.
__ Most UNIX/LINUX (shell) commands are actually the names of programs.
__ A characteristic of iterative software development is that one breaks a problem into a small
problem plus
a series of increments.
__ In a C/C++ program that includes the file , a data type of uint32_t is always 4 bytes in size.
B. (1 mark each, 6 marks total)
In each of the statements below, fill in the blank with the word or phrase which best fits the
overall state- ment.
In the context of output from ps(1), the acronym PPID stands for
_______________________________ .
The name of the environment variable which defines the list of paths searched by bash for
commands is
_________________________ .
Every complete C/C++ program has a function called __________________ . It is the standard
entry point
to the program.
UNIX/LINUX tools (commands) typically follow the convention of writing their output to
____________________________ and reading their input from __________________________
.
In UNIX/LINUX, a(n) _______________ is a named sequence of nonvolatile bytes.
A(n) _______________ is a a pair of streams, one for writing and one for reading, such that
everything written on the output stream can be read from the input stream in order and with full
fidelity.
C. (26 marks)
For each of the following multiple-choice1 questions, indicate the answer that is the best
response to the question. Circle the label (e.g. “(a)”) of your intended response in each case.
1. Which of the following sentences describing “testing” and “debugging” is true?
(a) Testing finds bugs, debugging locates error messages.
(b) Testing finds coding faults, debugging locates execution failures.
(c) Testing finds execution failures, debugging locates coding faults.
(d) Testing generates error messages, debugging locates bugs.
(e) None of the above.
1. or, as Peppermint Patty from the Peanuts comic strip would say, “mystical guess”
page 2
Cmpt 214 Midterm Examination
October 21, 2014
Which of the following statements regarding good programming style is true?
(a) A user should preferentially use the layout
rather than
(b) A user should preferentially use the layout if (condition)
{ }
r.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Normal Labour/ Stages of Labour/ Mechanism of LabourWasim Ak
Normal labor is also termed spontaneous labor, defined as the natural physiological process through which the fetus, placenta, and membranes are expelled from the uterus through the birth canal at term (37 to 42 weeks
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
The French Revolution Class 9 Study Material pdf free download
The best unix shell scripting interview questions 2018 learn now!
1. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 1/17
The Best Unix Shell Scripting Interview
Questions 2018 - Learn Now!
mindmajix.com (https://mindmajix.com/unix-shell-scripting-interview-questions)
Unix Shell Scripting Interview Questions
(4.0)
Email This Post
If you're looking for Unix Shell Scripting Interview Questions for Experienced or
Freshers, you are at right place. There are lot of opportunities from many
reputed companies in the world. According to research Unix Shell Scripting has a
market share of about 17%. So, You still have opportunity to move ahead in your
career in Unix Shell Scripting. Mindmajix offers Advanced Unix Shell Scripting
Interview Questions 2018 that helps you in cracking your interview & acquire
dream career as Unix Shell Scripting Developer.
Are you interested in taking up for Unix Shell Scripting Certification Training?
Enroll Now Unix Shell Scripting Training! (https://mindmajix.com/unix-
shell-scripting-training)
2. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 2/17
C Shell – Beginner
Q. What must you do before you are able to run your new script for the
first time by its name or with an alias?
You must make it executable, that is to execute the command:
chmod +x scriptname
Q. The following command is included in the .login script of a user:
alias whois ´grep !ˆ /etc/passwd´
What will be the output, when the user issues the following?
who is guru
If there is a defined user account named “guru”, or the string guru is contained
elsewhere in /etc/passwd file, then the output will be the entry which contains
the string “guru”, otherwise, it will be an empty line.
Q. If the condition If ( -r filename ) fails (returns false), what are the
possible reasons?
The possible reasons are:
a) filename is not readable by the owner of the process
b) filename does not exist
Q. Which is the difference between the next two statements?
set var = 99
@ var = 99
Using the typical assignment form (set …), the value assigned in var is the string
99. Using the @, the value is the integer 99.
Q. Given the code snippet:
@ n = 5
while ($n)
# actions
…
end
3. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 3/17
What actions should be performed inside the loop, in order to get out of
this loop?
Any command that changes the value of variable n, for it to become 0 sometime.
E.g., @ n—
Q. What will the output of the following commands be? Explain.
set names = (Kathrin Chris Jacob)
shift names
echo $#names
The output will be 2.
shift command gets rid of the first element of the array names. So, the echo
command will display 2 as the number of elements of the array.
Q. What does the command rehash do?
rehash recomputes the internal hash table for the PATH variable. If the new
command resides in a directory not listed in PATH, add this directory to PATH,
and then use rehash.
Q. How could you ensure that a script will be run in csh?
The first line of the script could be used to define the shell you want to use, as
follows:
#!/bin/csh
This is sufficient to run the script in csh.
Q. Given that script1 is an executable C shell script situated in directory
/home/myhomedir/project1/data/dir1, use three ways to run it, explaining the
pros and cons.
a) cd/home/myhomedir/project1/data/dir1/script1 (You should first cd to the
directory path)
b) /home/myhomedir/project1/data/dir1/script1 (You should include the
absolute directory path)
c) script1 (shortest form, but it works only if the directory path is added to the
PATH environment variable of the user)
4. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 4/17
Q. What will be the value of the sixrem variable, after executing this
command?
@ sixrem = $data[2] % 6
The expression divides the value of second element of the data array by 6 and
assigns the remainder of the division to the sixrem variable.
Q. Name two ways to obtain the length of a string, giving a simple
example for each one.
The two ways to obtain the length of a string are:
a) Using the wc command:
set string = “any string”
@ ln = `echo $string | wc -c` -1
b) Using the awk function length:
set string = “any string”
set ln = `echo $string | awk ‘{print length($0)}’`
Q. Create a script that displays a list of regular files from the current
directory.
#!/bin/csh -f
foreach i (*)
if ( -f $i ) then
print $i
endif
end
Q. Describe in short the word completion feature of the tcsh shell.
Completion works anywhere in the command line, not at just the end, for both
commands and filenames. Type part of a word and hit the Tab key, and the shell
replaces the incomplete word with the complete one in the input buffer. The
completion also adds a “/” to the end of completed directories and a space to the
end of other words. The shell parses the buffer to determine whether the word
you try to complete should be completed as a command, filename or variable.
5. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 5/17
The first word in the buffer and the first word following ‘;’, ‘|’, ‘|&’, ‘&&’ or ‘||’ is
considered to be a command. A word beginning with ‘$’ is considered to be a
variable. Anything else is a filename. An empty line is ‘completed’ as a filename.
Q. In tcsh, how are the remaining choices (if any) listed whenever the
word completion fails?
The remaining choices (if any), are listed only if the shell variable autolist is set.
Q. In tcsh, how do you disable filename substitution?
noglob shell variable can be set to disable the filename substitution feature.
Q. Compare the sched tcsh built-in command with the UNIX/Linux at
command.
These commands are similar but not the same. sched command runs directly
from the shell, so it has access to shell variables and settings at command can
run a scheduled command at exactly the specified time.
Q. Schedule a prompt change at 10:55 as a reminder for an oncoming
event.
sched 10:55 set prompt = ‘It’s time for the important meeting: >’
Q. What is the impact of -f option in the first line of a csh script?
(#!/bin/csh
versus
#!/bin/csh -f)
Using option -f, the shell does not load any resource or startup files (.cshrc for a
script), or perform any command hashing, and thus starts faster.
Q. How can you start a job in the background, and then terminate your
login session, without terminating the background job?
We can start a job in the background and then terminate our login session,
without terminating the background job using “no hangup” command, nohup:
nohup command > output_file &
6. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 6/17
Q. Which is the difference between
echo c{1,4,2,5,1}
and
echo [c]{1,4,2,5,1}?
The first echo will display c1 c4 c2 c5 c1, while the second displays only c1.
Q. Display the first and last arguments of a script, regardless of the
number of arguments, and without a loop.
my_var3 = $#argv
echomy_var1: $argv[$1]
echomy_last_var: $argv[$my_var3]
Q. How will you set the ‘search path’ in csv?
Search path in csv can be set as follows:
a) setenv PATH “/myfolder1 /bin: /myfolder2 /myfile3”
b) using list
set path = ( /myfolder1 /bin /myfolder2 /myfile3 )
Q. Create a tar archive into /home/user1/myarch.tar, including all files
ending in .c, .h, .l, .y,.o and .cc and also the Makefile from two
directories, ~/dir1 and ~/dir2.
tar cvf /home/user1/myarch.tar ~/{dir1,dir2}/{Makefile,*.{c,h,l,o,y,cc}}
or
tar cvf /home/user1/myarch.tar ~/dir1/Makefile ~/dir1/*.[chloy] ~/dir1/*.cc
~/dir2/Makefile ~/dir2/*.[chloy] ~/dir2/*.cc
Q. Your script must be executed with exactly two arguments, otherwise
would be terminated. Write a code to implement these checks.
if ($#argv <> 2) then
echo “Usage: $0 arg1 arg2”
echo “You must give exactly two parameters”
exit 20
endif
7. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 7/17
Q. Write a pipeline that reads from the j-th line up to the k-th line of a text
file, without using awk.
set total = `cat textfile | wc -l`
set j = 10
set k = 18
@ count = $k – $j
head -$k textfile | tail -$count
C Shell – Intermediate
Q. Explain the following commands:
set names = (John Kathrin Chris Jacob)
set names = ($names[1-2] Angela $names[3-])
First command creates an array named names with the four names as its
elements.
Second command adds name Angela between Kathrin and Chris.
Q. How could you move cursor to specified coordinates on screen? (tcsh)
We can move the cursor to specified coordinates on the screen using echotc cm
column row
Q. What is the result of this loop?
foreach i ([A-Z]*) ? mv $i $i.csh ? end
The loop renames all files that begin with a capital letter, adding the “extension”
.csh.
Q. Assuming there is a label cleanup somewhere in a script, explain the
command onintr cleanup
The script will branch to label cleanup if it catches an interrupt signal.
Q. Is there a way to repeat a command for a predefined number of times,
without using a counter-controlled loop?
We can repeat a command for a predefined number of times, without using a
8. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 8/17
counter-controlled loop using the repeat command, e.g.,
repeat 5 ls >> listings
Q. csh and tcsh both support the filename & command completion
feature. But the feature works differently in csh than in tcsh. Name the
differences.
tcsh automatically completes filenames and commands when the Tab key is hit.
csh does so only when the filec variable is set, after the Esc key is hit.
Q. Name the special login files for csh&tcsh in the order used by each
shell.
If the command is executed from the (“/etc/csh.cshrc& /etc/csh.login”) system
files, the login shell will be started.
a) It will run the commands given in the files present in the home directory of the
user.~/.cshrc or ~/.tcshrc:During shell startup, it gets executed for each instance
of the shell. If ~/.cshrcs present, ‘tcsh’ uses this file else executes ‘~/.tcshrc’
b) ~/.login: at login it is executed after .cshrcby login shell
c) ~/.cshdirs: After .login (tcsh), it is executed by login shell
Q. What do the following lines do? Explain the differences.
ls > filename
ls >! Filename
In both forms, the output of ls command is redirected to filename. If filename
does not exist, it will be created, otherwise it will be truncated. When the first
form is used, if shell parameter noclobber is set and filename is an existing file,
an error results. The ‘!’ in the second form is used to suppress that check.
Q. You can run a script by its name, using an alias or using source.
Explain the differences in using each of the three methods. When is it
suitable to use each method?
A script executed by name is not run in current process (a child process is created
to run the script), so this method is suitable to be used only if the environment
variables and globally defined aliases (in $HOME/.cshrc) should be known to
9. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 9/17
the script.
The method that executes a script using an alias is a variant of executing the
script by name. In addition, if the alias is defined from shell prompt, it applies
only to the current process. To make the alias global, you must define it in
$HOME/.cshrc, but be careful to keep the number of aliases included there to a
relatively small number.
With the third method, the script runs in the current process, thus, any aliases
defined in the current process will be known to your script.
Q. How could you override a defined alias? Give a simple example.
To override an alias, precede the alias with backslash. Fox example, if you have
an alias named rm which runs a custom script, if you want to run the command
rm instead of the rm alias, you can do it as shown below:
rm filename
Q. You plan to write a script that will process the file passed to it as the
only argument on the command line. So, your script must accept at least
one argument and this single or first argument must be an existing file.
Write the necessary checks, displaying the appropriate messages.
#!/bin/csh
if ( $#argv == 0 ) then
echo Error: A file name must be supplied as argument
exit 10
else if ( ! -e $1 ) then
echo Error: $1 is not an existing file
exit 11
endif
commands to process the file
Q. Write a code excerpt that processes (here, just displays) the elements
of an array, from the first one to the last one.
set myarray = (value1, value2, value3, value4, value5)
10. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 10/17
set i = 1
while ( $#myarray > 0 )
echo “$i array’s element is: $myarray[1]”
shift myarray
@ i++
end
or,
set myarray = (value1, value2, value3, value4, value5)
set i = 1
foreach val ( $myarray[*] )
echo “$i array’s element is: $val”
@ i++
End
Q. Complete the last echo command with a descriptive message in the
following script. In other words, explain the value of pct variable.
#!/bin/csh
set duout = (`du -sk ~`)
@ dir_size = $duout[1]
set dfout = (`df -k | grep /home`)
@ home_size = $dfout[2]
@ pct = $dir_size * 100 / $home_size
echo “… $pct …”
echo “Your home directory takes $pct % of /home filesystem”
Q. Extract just the mode of a given file, using two different ways.
The mode of a given file can be extracted in the following ways:
a) set file_mode = `ls -l filename | tail -1 | cut -f1 -d” ” | cut -c2-`
b) set file_mode = `ls -l filename | awk ‘ /^-/ {print substr($1,2)}’`
11. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 11/17
Q. Which is the output of the following excerpt?
netstat -an | awk ‘/SHED/ {split($4,c,”.”); print “Connection to ” c[4] ”
from ” $5}’ | sort -nt” ” -k 3
Lines in the format “Connection to port_number from IP_Address”, for each
established connection, sorted by port_number.
Q. Find the position of a substring in a given string. Display a message if
the string does not contain this substring.
set string = “any string”
set sub = “str”
set pos = ` echo $string | awk -v s=$sub ‘{print index($0,s)}’`
if ( $pos == 0 ) then
echo “$string does not contain the substring $sub”
else
echo “$sub first occurrence in $string starts in position $pos”
endif
Q. Change the case of a string.
set string = “C Shell Programming”
set ustring = `echo $string | awk ‘{print toupper($0)}’` # = “C SHELL
PROGRAMMING”
set lstring = `echo $string | awk ‘{print tolower($0)}’` # = “c shell programming”
Q. Assume that in a script the value of a variable limt becomes equal to
92.1. Display the message:
Upper limit 92.10% in your_system
set system = `hostname`
printf “Upper limit %f.2%% in the %s” $limt $system
Q. Suppose a script contains the following snippet:
set fl = /home/dbuser5/reports/fs_report1.txt
echo $fl:e
echo $fl:r
12. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 12/17
echo $fl:t
echo $fl:h
What do you expect to be displayed?
txt
fs_report1
fs_report1.txt
/home/dbuser5/reports
Q. Create a script that converts the filenames from current directory to
lower case letters.
#!/bin/csh -f
foreachmy_old_file1 (`ls`)
setmy_new_ file1 = `echo $my_old_file1 | tr ´[A-Z]´ ´[a-z]´`
if (“$my_new_ file1” == “$my_old_file1”) then
continue
endif
mv $ my_old_file1 $my_new_ file1
end
Q. Name some basic differences between csh and tcsh.
tcsh includes a command-line editor, file name and command completion
features, and enhanced job control, in comparison with the Berkeley csh.
Q. Compare the tcsh shell variables correct and autocorrect.
autocorrect can be set to correct the word to be completed before any
completion attempt. correct can be set to ‘cmd’ to correct command names or to
‘all’ to correct the entire line, each time return is hit.
Q. What is the purpose of the special alias shell?
The shell special alias can be set to specify an interpreter other than the shell
itself.
13. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 13/17
Q. Which is the method to bind the keys to the standard vi or emacs
bindings?
Shell’s built-in command is bindkey. Its -e option binds all keys to standard
emacs bindings, while -v option binds to standard vi bindings.
Q. Which is the purpose of shell’s variable color?
Shell’s variable color, if set, enables color display for the built in ls-F and it passes
–color=auto to ls.
Q. Set your prompt to display username@hostname: pwd>
It can be done as follows:
set prompt = “%n@%m: %/ >”
Q. How can you start (from shell prompt) 2 commands “in the
background”, ensuring that the second command will start after the
completion of the first one?
It can be done as follows:
(command 1 ; command 2) &
Check Out Unix Shell Scripting Tutorials (https://mindmajix.com/unix-shell)
Explore Unix Shell Scripting Sample Resumes! Download & Edit, Get Noticed by
Top Employers!Download Now! (https://mindmajix.com/unix-shell-
scripting-sample-resumes)
Social Share
Previous (https://mindmajix.com/ui-developer-interview-questions)
Next (https://mindmajix.com/vb-net-interview-questions)
Popular Courses in 2018
Salesforce Training (https://mindmajix.com/salesforce-
training)
(5.0)
14. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 14/17
2245 Enrolled
Selenium Training (https://mindmajix.com/selenium-
training)
(5.0)
3370 Enrolled
Splunk Training (https://mindmajix.com/splunk-training)
(5.0)
1256 Enrolled
Python Training (https://mindmajix.com/python-training)
(5.0)
1351 Enrolled
DevOps Training (https://mindmajix.com/devops-training)
(5.0)
2895 Enrolled
RPA Training (https://mindmajix.com/rpa-training)
(5.0)
4025 Enrolled
OpenStack Training (https://mindmajix.com/openstack-
training)
(5.0)
15. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 15/17
945 Enrolled
Data Science Training (https://mindmajix.com/data-
science-training)
(5.0)
1578 Enrolled
Microsoft Azure Training
(https://mindmajix.com/microsoft-azure-training)
(5.0)
1956 Enrolled
MongoDB Training (https://mindmajix.com/mongodb-
training)
(5.0)
1220 Enrolled
Hadoop Training (https://mindmajix.com/hadoop-
training)
(5.0)
1090 Enrolled
Cognos Training (https://mindmajix.com/cognos-training)
(5.0)
3012 Enrolled
JENKINS Training (https://mindmajix.com/jenkins-
training)
16. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 16/17
(4.0)
880 Enrolled
SAS Training (https://mindmajix.com/sas-training)
(5.0)
1890 Enrolled
VMware Training (https://mindmajix.com/vmware-
training)
(5.0)
3250 Enrolled
AngularJS Training (https://mindmajix.com/angularjs-
training)
(5.0)
3756 Enrolled
Salesforce Lightning Training
(https://mindmajix.com/salesforce-lightning-training)
(5.0)
1458 Enrolled
Automation Anywhere Training
(https://mindmajix.com/automation-anywhere-training)
(5.0)
3780 Enrolled
17. 4/3/2018 The Best Unix Shell Scripting Interview Questions 2018 - Learn Now!
https://www.instapaper.com/read/1037948618 17/17
Machine Learning Training
(https://mindmajix.com/machine-learning-training)
(5.0)
985 Enrolled
Artificial Intelligence (AI) Training
(https://mindmajix.com/artificial-intelligence-training)
(5.0)
75 Enrolled
mindmajix.com (https://mindmajix.com/unix-shell-scripting-interview-questions)