1. Dr. Madhuri Hegde presented on detecting small intragenic deletions using targeted comparative genomic hybridization (aCGH).
2. She discussed several examples of deletions less than 2.5 kb detected by aCGH in disease genes including PAH, STK11, HPRT1, and EMD.
3. She concluded that aCGH is a valuable tool for detecting small intragenic deletions and providing insights into deletion mechanisms.
KDM5 epigenetic modifiers as a focus for drug discoveryChristopher Wynder
A summary presentation of my scientific work.
My laboratory focused on an enzyme KDM5b (aka PLU-1, JARID1b) that was widely expressed during development and played a key role in progression of breast cancer through HER-2.
My lab focused on understanding the key biochemical activity of the enzyme through dissecting the proteomic and genomic interactors.
Our results were confirmed through the use of ES cells, adult stem cells and mouse models.
Much of this work remains unpublished, please contact me for more information and/or access to any reagents that I still have as part of this work.
crwynder@gmail.com
Zinc finger nucleases (ZFNs) are engineered restriction enzymes
designed to target specific DNA sequences within the genome.
Assembly of zinc finger DNAbinding domain to a DNA-cleavage
domain.
Genome Sequencing in Finger Millet
Genome size estimation
SOLiD Sequencing Technology
Illumina Sequencing Technology
Gene prediction and functional annotation of genes
Mining of plant transcription factors and other genes
Regulation of KDM5 by multiple cofactors regulates cancer and stem cellsChristopher Wynder
Presentation of data regarding proteins that regulate the activity of KDM5b.
The studies use multiple disciplines including in vitro enzymology, ES cell studies of differentiation, Mass spectrometry to detect protein protein interactions.
These studies resulted in a comprehensive view of KDM5b function. It required development of at least three novel assays that are focused on moving epigenetic research from yeast and HeLa cell types to primary, clinically relevant cell types.
The techniques have been successfully used in Embryonic stem cells (human and mouse), Neural stem cells (mouse and patient derived as well as iPSCs.
KDM5 epigenetic modifiers as a focus for drug discoveryChristopher Wynder
A summary presentation of my scientific work.
My laboratory focused on an enzyme KDM5b (aka PLU-1, JARID1b) that was widely expressed during development and played a key role in progression of breast cancer through HER-2.
My lab focused on understanding the key biochemical activity of the enzyme through dissecting the proteomic and genomic interactors.
Our results were confirmed through the use of ES cells, adult stem cells and mouse models.
Much of this work remains unpublished, please contact me for more information and/or access to any reagents that I still have as part of this work.
crwynder@gmail.com
Zinc finger nucleases (ZFNs) are engineered restriction enzymes
designed to target specific DNA sequences within the genome.
Assembly of zinc finger DNAbinding domain to a DNA-cleavage
domain.
Genome Sequencing in Finger Millet
Genome size estimation
SOLiD Sequencing Technology
Illumina Sequencing Technology
Gene prediction and functional annotation of genes
Mining of plant transcription factors and other genes
Regulation of KDM5 by multiple cofactors regulates cancer and stem cellsChristopher Wynder
Presentation of data regarding proteins that regulate the activity of KDM5b.
The studies use multiple disciplines including in vitro enzymology, ES cell studies of differentiation, Mass spectrometry to detect protein protein interactions.
These studies resulted in a comprehensive view of KDM5b function. It required development of at least three novel assays that are focused on moving epigenetic research from yeast and HeLa cell types to primary, clinically relevant cell types.
The techniques have been successfully used in Embryonic stem cells (human and mouse), Neural stem cells (mouse and patient derived as well as iPSCs.
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assau...Thermo Fisher Scientific
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assault Investigations
Jack Ballantyne, Erin Hanson
National Center for Forensic Science, UCF
Sexual Assault by the numbers*:
60% of sexual assaults are not reported to the police.
97% of rapists never spend a day in jail.
There are an average of 237,868 victims of rape and sexual assault each year.
Every 2 minutes, another American is sexually assaulted.
1 out of every 5 American women have been the victim of an attempted or completed rape in her lifetime.
9 out of 10 rape victims are female.
*Source: Rape, Abuse & Incest National Network (RAINN)
In the US, an estimated 19.3% of women and 1.7% of men have been raped during their lifetimes**
**-CDC Sept 2014
NCFS Evaluation of Quantifiler® Trio / Yfiler® Plus:
Can we improve our analysis of extended interval post coital samples
using the integrated/modular Quantifiler® Trio/Yfiler® Plus system?
Conclusions:
Quantitation System
• Excellent correlation between male quantitation and profile recovery
• Negative quant (threshold based) means negative/unusable Yfiler® Plus kit
• Observed autosomal/Y results consistent with expected based upon quant and F/M ratio
Yfiler® Plus kit
• Sensitive chemistry
• If >100 pg male, most full profiles
• Results obtained with high quantities of background female DNA (up to mg)
• Many ‘Usable profiles’ F/M ranging from 333:1-100,000:1
• Y-STR profiles using YFP can be obtained at least up to 9 days after intercourse
Whole Exome Sequencing at Stanford UniversityGolden Helix
Dr. Reza Sailani is a Research Fellow in the Genetics department at Stanford University. To provide an overview of his research, Sailani explains the following two recent studies he has conducted:
Association of AHSG with alopecia and mental retardation (APMR) syndrome: Alopecia with mental retardation syndrome (APMR) is a very rare autosomal recessive condition that is associated with total or partial absence of hair from the scalp and other parts of the body as well as variable intellectual disability. Here we present whole-exome sequencing results of a large consanguineous family segregating APMR syndrome with seven affected family members. Our study revealed a novel predicted pathogenic, homozygous missense mutation in the AHSG gene.
WISP3 mutation associated with Pseudorheumatoid Dysplasia: Progressive pseudorheumatoid dysplasia (PPD) is a skeletal dysplasia characterized by predominant involvement of articular cartilage with progressive joint stiffness. Here we report genetic characterization of a consanguineous family segregating an uncharacterized form of skeletal dysplasia. Whole exome sequencing in four affected siblings and parents resulted in identification of a loss of function homozygous mutation in the WISP3 gene leading to diagnosis of PPD in the affected individuals. The identified variant is rare and predicted to cause premature termination of the WISP3 protein.
Los días 11 y 12 de diciembre de 2014, la Fundación Ramón Areces celebró el Simposio Internacional 'Neuropatías periféricas hereditarias. Desde la biología a la terapéutica' en colaboración con CIBERER-ISCIII y el Centro de Investigación Príncipe Felipe. El tipo más común de estas patologías es la enfermedad de Charcot-Marie-Tooth, un trastorno neuromuscular hereditario con una prevalencia estimada de 17-40 afectados por 100.000 habitantes. Durante estos dos días, investigadores mostraron sus avances en la mejora del diagnóstico y el tratamiento y, por ende, de la aproximación clínica y la calidad de vida de las personas afectadas por estas patologías.
GENESIS™: Comprehensive genome editing - Translating genetic information into personalised medicines.
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined. Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
Gene editing application for cancer therapeuticsNur Farrah Dini
The application of TALENs as one of the gene editing tools in order to modify a specific targeted sites on a genome. This method shows a tremendous benefits especially in cancer research.
Alzheimer’s disease (AD) is a devastating neurodegenerative disease that is genetically complex. Although great progress has been made in identifying fully penetrant mutations in genes that cause early-onset AD, these still represent a very small percentage of AD cases. Large-scale, genome-wide association studies (GWAS) have identified at least 20 additional genetic risk loci for the more common form: late-onset AD. However, the identified SNPs are typically not the actual risk variants, but are in linkage disequilibrium with the presumed causative variants [1].
To help identify causative genetic variants, we have combined highly accurate, long-read sequencing with hybrid-capture technology. In this collaborative webinar*, we present this method and show how combining IDT xGen® Lockdown® Probes with PacBio SMRT® Sequencing allows targeting and sequencing of candidate genes from genomic DNA and corresponding transcripts from cDNA. Using a panel of target capture probes for 35 AD candidate genes, we demonstrate the power of this approach by looking at data for two individuals with AD. Some additional benefits of this method include the ability to leverage long reads, phase heterozygous variants, and link corresponding transcript isoforms to their respective alleles.
Reference: 1. Van Cauwenberghe C, Van Broeckhoven C, Sleegers K. (2016) The genetic landscape of Alzheimer disease: clinical implications and perspectives. Genet Med, 18(5):421–430.
* This presentation represents a collaboration between Pacific Biosciences and Integrated DNA Technologies. The individual opinions expressed may not reflect shared opinions of Pacific Biosciences and Integrated DNA Technologies.
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assau...Thermo Fisher Scientific
Why Y Chromosome Markers are an Ever Expanding Essential Tool in Sexual Assault Investigations
Jack Ballantyne, Erin Hanson
National Center for Forensic Science, UCF
Sexual Assault by the numbers*:
60% of sexual assaults are not reported to the police.
97% of rapists never spend a day in jail.
There are an average of 237,868 victims of rape and sexual assault each year.
Every 2 minutes, another American is sexually assaulted.
1 out of every 5 American women have been the victim of an attempted or completed rape in her lifetime.
9 out of 10 rape victims are female.
*Source: Rape, Abuse & Incest National Network (RAINN)
In the US, an estimated 19.3% of women and 1.7% of men have been raped during their lifetimes**
**-CDC Sept 2014
NCFS Evaluation of Quantifiler® Trio / Yfiler® Plus:
Can we improve our analysis of extended interval post coital samples
using the integrated/modular Quantifiler® Trio/Yfiler® Plus system?
Conclusions:
Quantitation System
• Excellent correlation between male quantitation and profile recovery
• Negative quant (threshold based) means negative/unusable Yfiler® Plus kit
• Observed autosomal/Y results consistent with expected based upon quant and F/M ratio
Yfiler® Plus kit
• Sensitive chemistry
• If >100 pg male, most full profiles
• Results obtained with high quantities of background female DNA (up to mg)
• Many ‘Usable profiles’ F/M ranging from 333:1-100,000:1
• Y-STR profiles using YFP can be obtained at least up to 9 days after intercourse
Whole Exome Sequencing at Stanford UniversityGolden Helix
Dr. Reza Sailani is a Research Fellow in the Genetics department at Stanford University. To provide an overview of his research, Sailani explains the following two recent studies he has conducted:
Association of AHSG with alopecia and mental retardation (APMR) syndrome: Alopecia with mental retardation syndrome (APMR) is a very rare autosomal recessive condition that is associated with total or partial absence of hair from the scalp and other parts of the body as well as variable intellectual disability. Here we present whole-exome sequencing results of a large consanguineous family segregating APMR syndrome with seven affected family members. Our study revealed a novel predicted pathogenic, homozygous missense mutation in the AHSG gene.
WISP3 mutation associated with Pseudorheumatoid Dysplasia: Progressive pseudorheumatoid dysplasia (PPD) is a skeletal dysplasia characterized by predominant involvement of articular cartilage with progressive joint stiffness. Here we report genetic characterization of a consanguineous family segregating an uncharacterized form of skeletal dysplasia. Whole exome sequencing in four affected siblings and parents resulted in identification of a loss of function homozygous mutation in the WISP3 gene leading to diagnosis of PPD in the affected individuals. The identified variant is rare and predicted to cause premature termination of the WISP3 protein.
Los días 11 y 12 de diciembre de 2014, la Fundación Ramón Areces celebró el Simposio Internacional 'Neuropatías periféricas hereditarias. Desde la biología a la terapéutica' en colaboración con CIBERER-ISCIII y el Centro de Investigación Príncipe Felipe. El tipo más común de estas patologías es la enfermedad de Charcot-Marie-Tooth, un trastorno neuromuscular hereditario con una prevalencia estimada de 17-40 afectados por 100.000 habitantes. Durante estos dos días, investigadores mostraron sus avances en la mejora del diagnóstico y el tratamiento y, por ende, de la aproximación clínica y la calidad de vida de las personas afectadas por estas patologías.
GENESIS™: Comprehensive genome editing - Translating genetic information into personalised medicines.
Horizon is the only source of rAAV expertise and is uniquely capable of exploiting multiple platforms: CRISPR, ZFNs and rAAV singularly or combined. Horizon’s scientists are experts at all forms of gene editing and so have the experience to help guide customers towards the approach that best suits their project
Gene editing application for cancer therapeuticsNur Farrah Dini
The application of TALENs as one of the gene editing tools in order to modify a specific targeted sites on a genome. This method shows a tremendous benefits especially in cancer research.
Alzheimer’s disease (AD) is a devastating neurodegenerative disease that is genetically complex. Although great progress has been made in identifying fully penetrant mutations in genes that cause early-onset AD, these still represent a very small percentage of AD cases. Large-scale, genome-wide association studies (GWAS) have identified at least 20 additional genetic risk loci for the more common form: late-onset AD. However, the identified SNPs are typically not the actual risk variants, but are in linkage disequilibrium with the presumed causative variants [1].
To help identify causative genetic variants, we have combined highly accurate, long-read sequencing with hybrid-capture technology. In this collaborative webinar*, we present this method and show how combining IDT xGen® Lockdown® Probes with PacBio SMRT® Sequencing allows targeting and sequencing of candidate genes from genomic DNA and corresponding transcripts from cDNA. Using a panel of target capture probes for 35 AD candidate genes, we demonstrate the power of this approach by looking at data for two individuals with AD. Some additional benefits of this method include the ability to leverage long reads, phase heterozygous variants, and link corresponding transcript isoforms to their respective alleles.
Reference: 1. Van Cauwenberghe C, Van Broeckhoven C, Sleegers K. (2016) The genetic landscape of Alzheimer disease: clinical implications and perspectives. Genet Med, 18(5):421–430.
* This presentation represents a collaboration between Pacific Biosciences and Integrated DNA Technologies. The individual opinions expressed may not reflect shared opinions of Pacific Biosciences and Integrated DNA Technologies.
Lessons learned from high throughput CRISPR targeting in human cell linesChris Thorne
In just a short period of time CRISPR-Cas9 technology has revolutionized the field of genome editing, and taken the scientific community by storm. Already our understanding of how best to apply this technology has advanced significantly and almost every week new publications appear showcasing its application in basic and translational research.
While CRISPR-Cas9 is applicable across many different cell types, we have found it particularly suited for genome editing in near-haploid human cell lines. This has allowed us to establish a robust pipeline for the inactivation of non-essential genes at unprecedented scale and efficiency.
We have now knocked out over 1500 human genes and have generated a resource that is, to the best of our knowledge, the largest collection of human knockout cell lines available, covering comprehensive subsets of genes clustered by biological pathway (e.g. the autophagy pathway, the JAK/STAT pathway) or by phylogenetic relationship (e.g. kinases, bromodomain-containing proteins).
In this talk we will discuss how, through more than 1500 genome editing experiments, we have started to unravel some of the general principles governing the use of CRISPR-Cas9 in mammalian cells. For example, we have analyzed the impact of variation in the guide RNA sequence on Cas9 cleavage efficiency and characterized the mutational signature arising from CRISPR-Cas9 cleavage.
We will also highlight (with examples) how these learnings are now being applied to introduce other genomic modifications in a high throughput manner, including chromosomal deletions, translocations, point mutations and endogenous gene tags.
Clinical molecular diagnostics for drug guidanceNikesh Shah
1. Be familiar with next generation molecular diagnostic techniques that can provide guidance in clinical decision making
2. Identify the utility of these diagnostic approaches with some examples
3. Be aware of the challenges that exist in implementing these tools as part of the routine clinical decision making process, especially in resource limited settings
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...QIAGEN
Meningioma’s display a broad spectrum of clinical, histological and cytogenetic features even within the same WHO grade often posing a challenge for classification and prognostic stratification. In this webinar, we will describe our experience of using targeted amplicon sequencing to develop rapid clinical sequencing system to identify and confirm the meningioma genotype in just two weeks. In addition the details of the three meningioma categories and the genes involved will be discussed.
Making genome edits in mammalian cellsChris Thorne
Looking at the kind of modifications that can be made in mammalian cells, and how at Horizon moving to a haploid model system has significantly improved efficiency of both editing and validation
Avacta Life Sciences Affimers Presentation Global Protein Engineering Summit ...AvactaLifeSciences
Avacta Life Sciences Exhibits Affimers at Global Protein Engineering Summit
Avacta Life Sciences exhibited recently at the Global Protein Engineering Summit ("PEGS") where it presented its Affimer technology.
You can read more about Affimer technology here http://www.avactalifesciences.com
PEGS is considered to be the essential protein engineering meeting where commercial and academic progress in protein engineering is showcased and this year it attracted over 1800 delegates from across the globe to Boston. Avacta Life Sciences presented its Affimer technology for the first time at a PEGS meeting with technical exhibits and a presentation by the CSO, Paul Ko Ferrigno, entitled "Biological Recognition: Beyond the Antibody."*
The exhibition booth was busy with over 80 delegates talking to the Avacta Life Science management team over the four days of the summit. The feedback on the Affimer technology was very positive, in particular, the short development times and excellent stability were highlighted by delegates as key advantages of Affimers over antibodies. There was also a strong interest in Affimers from the management of companies developing biological therapeutics who were keen to learn more about the potential of Affimers as novel therapeutics.
In addition, several companies were interested in the use of Affimers as an alternative to antibodies in diagnostic devices, mainly because they could generate binders against new biomarkers much more quickly and evaluate them in higher numbers.
The benefits of Affimer microarrays for biomarker discovery also resonated with diagnostic developers who appreciated the advantage of being able to evaluate significantly larger numbers of potential biomarkers more cost and time effectively than by mass spectrometry. The potential of the arrays for multiplexed solutions for clinical diagnosis and monitoring during drug trials was also something that generated interest amongst those delegates.
Matt Johnson, Chief Technical Officer of Avacta Life Sciences commented: "It was great to experience face to face the level of interest in Affimers. The majority of people I spoke to were either having problems raising antibodies to their target of interest or just couldn't use antibodies because of the type of assays they wanted to perform. Many of the presentations focused around the use of antibody fragments for intra-cellular studies which is a rapidly growing area that holds great interest for drug and diagnostics developers. It is an area where there are clear advantages for Affimers over antibody fragments which don't behave well in the cytoplasm.
"The general enthusiasm around Affimers was very encouraging and the amount of interest generated by the potential of Affimers as therapeutics and by the Affimer arrays for biomarker discovery only reinforces my excitement around this new technology."
2007. stephen chanock. technologic issues in gwas and follow up studies
ACMG Workshop 2011
1. Detection of small intragenic deletions using targeted comparative genomic hybridization
2.
3.
4.
5. The OGT aCGH design process aCGH arrays All possible human genome probes Oligome TM database Further selection based on OGT probe rating and desired coverage and content Selection based on specificity, T m , GC, etc. Design & hyb two different aCGH arrays Optimised aCGH design = PRODUCT Selection of best performing probes based on experimental results
6.
7. Detection of Small intragenic Deletions Using Targeted Comparative Genomic Hybridization MadhuriHegde, Ph.D., FACMG Associate Professor Scientific Director, Emory Genetics Laboratory Department of Human Genetics Emory University Atlanta, GA
8. Scherer et al. (2007) Nat Genet 39:s7-s15 Genomic Variation G-banded karyotype FISH Microarray (~5 Mb)
9. aCGH FISH MLPA Real-Time PCR Deletion/Duplication Detection Methodology in clinical diagnostics
10. Purpose With the help of few examples of small deletions mapped in our laboratory, -illustrate the success of this technology -demonstrate the detection limits, and -discuss the lessons learnt thus far Scope Small intragenic deletions (~2.5 kb and shorter)
13. Probe density Keeping a balance: decrease redundancy while not compromising of sensitivity Duplication of Ex44
14. Exon-centric multi-gene high density array Designed to detect CNVs encompassing single and multiple exon Increase the cost-effectiveness without compromising on sensitivity
17. Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC) Autosomal dominant inheritance 37 year old male personal and a family history of multiple cutaneousleiomyomatosis
19. 2 year old East Indian male with a biochemical diagnosis of MSUD. Maple Syrup Urine Disease Autosomal Recessive inheritance c.871C>T (p.R291X) nonsense mutation in exon 7 of DBT gene identified
22. PAH Phenylketonuria (PKU) Autosomal recessive inheritance - two mutations in trans Metabolic disorder - biochemical profile adds to clinical suspicion
23.
24. exons PAH gene (~79 kb) 13 9 6 3 1 PKU case 1 PKU case 2
25. 868 bp 1,286 bp Exon 6 Exon 7 Two unrelated individuals with the same deletion PKU case 1 PKU case 2 PAH gene
26. Allele 1 1134 bp Allele 2 ~350 bp 100 200 300 case 1 case 2 Allele specific PCR
27. Green: Repeat masker Red: polymorphisms (SNP) CAPITAL: exon Underlined: primers Breakpoint within a SINE: MIRb family Breakpoint within a exon 6 Red box: “CT” is the microhomology at breakpoints.
28. 868 bp 1,286 bp 800 bp 800 bp Partial exon 6 deletion Exon 6 Exon 7 Intron 6 PKU case 1 PKU case 2 Note: breakpoint within an element
29. STK11 Peutz-Jeghers syndrome (PJS) Autosomal dominant inheritance - one mutation Clinical Presentation & Family History
32. +1 -1 0 Possible deletion encompassing exon 3 Designing allele specific PCR 1076 bp exons 2 3 4 AluY Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT1_1F ex2_1F INT2_1F INT2_2F INT2_3F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R
33. Exon3 Intron2 Intron3 Exon2 Exon 4 Intron1 INT2_2F INT3_1R INT3_2R INT3_3R INT3_4R and INT3_5R Data indicates a possible deletion of ~1kb. Expected band size in bp Possible exon 3 deletion 678 1130 1324 1580 1595
34. Proximal breakpoint 1170072 in intron 2 Distal breakpoint 1171039 in intron 3 Reference Reference Patient Patient
35. +1 -1 0 Note: breakpoints outside of element A few probes that did not perform ideally were unique exons 2 3 4 1076 bp 967 bp AluY
40. Exon 5 Max (2757bp) Min (381bp) Int4_1 Int4_2 Int4_3 Int4_4 Intron 4 Intron 5 Int5_4 HPRT_Int5_5R Int5_6 Int5_2 Int5_1 Int5_3 Int5_5 HPRT_Int4_1F HPRT_Int4_2F HPRT_Int5_5R 2745 bp fragment expected in wild type 2657 bp fragment expected in wild type 88bp size difference 500- 400- 300- 500- 400- 300-
41. Mapped a total of 380 bp in the amplicon 157 bp of intron 4 69 bp insertion 154 bp of intron 5 157 bp of intron 4 69 bp insertion
42. The Inserted 69 bpsequence match best on a gene desert on Chromsome 5. ATTCTAGTGATGTTTTCAGGCCTCAGGGGGCGGGTTGGGGGTGGTGGAGGTGGTGTGTATAATATCACT
43.
44. Wt Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Ex1 Ex2 Ex3 Pt. water Exon 1 and 2 did not amplify for the patient
47. Wt expected band with 1F/2R Would be 480 bp For Wt expected band with 1F/3R Would be 677 bp Band ~370 bp Suggesting ~300 bp deletion Band ~170 bp Suggesting ~300 bp deletion Forward Primer 1F 1F Reverse Primer 2R 3R Wt Pt. H2O Wt Pt. H2O 1kb+ -100 -200 -300 -400 -500 -650 -850 -------1000
48. exon1 exon2 Red nucleotides are deleted. Exons are capitalized Microhomology is limited to two nucleotides, “GC”
Madhuri Hegde, PhD, FACMG Associate Professor – Scientific Director Emory Genetics Lab Emory University School of Medicine
Madhuri Hegde, PhD, FACMG Associate Professor – Scientific Director Emory Genetics Lab Emory University School of Medicine
Extract from paper: Figure 1 - Lexicon of genomic variation. Descriptors of variation began in the realm of cytogenetics, followed by those from the field of molecular genetics and, most recently, by technologies such as those described in this perspective, which bridge the gap for detection of genomic variants (sometimes called cytogenomics 55 ). The designation of the category '1 kb to submicroscopic' is somewhat arbitrary at both ends, but is used for operational definition. In a broad sense, structural variation has been used to refer to genomic segments both smaller and larger than the narrower operational definition, as illustrated by the large bracket. The focus of recent discoveries has been the subgroup in the midrange (indicated with strong highlighting), but the gradation of shading illustrates that the biological boundaries may really encompass some forms of variation previously recognized from either cytogenetic or molecular genetic approaches. At the molecular level, SNPs can be identified that are representative of the underlying haplotype structure (tagSNPs). As structural variation becomes better integrated with the existing SNP-based linkage disequilibrium maps, it is likely that presence or absence of many structural variants will simply be inferred by typing selected SNPs
The modified Emory designs consist of panels of disease specific groups. For example, genes associated with neuromuscular dystrophy, x-linked intellectual disability and Duchene muscular dystrophy. There are also other panels of genes, for example, associated with cancer, diabetes and hearing loss. Contact us directly for more information on the disorders and genes included.
Contact us directly for more information on the disorders and genes included.