This study investigated the role of nucleolar protein 2 (NOP2) during early mammalian embryo development. The researchers found that NOP2 is expressed throughout preimplantation development in mice, with highest levels at the 8-cell and morula stages. Knockdown of NOP2 using RNA interference resulted in embryos that arrested development at the morula stage, with reduced cell numbers, increased apoptosis, and impaired specification of the inner cell mass and trophectoderm lineages. NOP2 deficiency also led to a global reduction in all RNA species. Therefore, NOP2 is essential for blastocyst formation during preimplantation development in mice.
Molecular tools in reproductive research document discusses:
1. Molecular tools like genomics, proteomics, and RNA interference can provide insights into the underlying mechanisms of fertility and infertility.
2. These tools allow understanding of genetic variation and provide methods to enhance fertility and improve diagnosis of fertility disorders.
3. The document discusses applications of genetic markers, genomics, proteomics, and RNA interference in studying reproductive processes in male and female animals as well as embryonic development.
Klf2 is an essential factor that sustains ground state pluripotency cell st...Jia-Chi Yeo, PhD
This study investigates the molecular mechanisms underlying ground state pluripotency in mouse embryonic stem cells (mESCs) cultured under 2i conditions (dual inhibition of Mek and Gsk3 signaling pathways). The authors find that Klf2 protein levels are post-translationally regulated in mESCs - Mek/Erk signaling leads to phosphorylation and proteasomal degradation of Klf2, while inhibition of Mek with PD0325901 stabilizes Klf2 protein. Klf2-null mESCs can survive under normal culture conditions but not under 2i, demonstrating that Klf2 is essential for ground state pluripotency mediated by 2i. The study defines the Mek/
This document summarizes a study that identified and characterized Drosophila Snurportin (dSNUP), the fruit fly ortholog of human Snurportin1 (SPN1). The key findings are:
1) dSNUP lacks an importin-β binding (IBB) domain that is essential for SPN1's interaction with importin-β in vertebrates.
2) dSNUP does not physically interact with the Drosophila importin-β ortholog Ketel, and fruit fly snRNPs also fail to bind Ketel.
3) The importin-7 ortholog Moleskin (Msk) physically associates with both dS
Silencing of the lncRNA Zeb2-NAT facilitates reprogramming of aged fibroblast...XequeMateShannon
Aging imposes a barrier to somatic cell reprogramming through poorly understood mechanisms. Here, we report that fibroblasts from old mice express higher levels of Zeb2, a transcription factor that activates epithelial-to-mesenchymal transition. Synthesis of Zeb2 protein is controlled by a natural antisense transcript named Zeb2-NAT. We show that transfection of adult fibroblasts with specific LNA Gapmers induces a robust downregulation of Zeb2-NAT transcripts and Zeb2 protein and enhances the reprogramming of old fibroblasts into pluripotent cells. We further demonstrate that Zeb2-NAT expression is precociously activated by differentiation stimuli in embryonic stem (ES) cells. By knocking down Zeb2-NAT, we were able to maintain ES cells challenged with commitment signals in the ground state of pluripotency. In conclusion, our study identifies a long noncoding RNA that is overlapping and antisense to the Zeb2 locus as a target for rejuvenation strategies.
Viviparity is a unique characteristic of mammals. Gestational outcomes avoiding fetal defects or loss, maternal infection, or morbidity are contingent upon an intimate association between mother and developing fetus that nurtures the fetus without provoking maternal immune responses. Therefore the maintenance of optimal immunity is necessary for the successful gestation.
This document discusses the role of the guanine nucleotide exchange factor C3G in neuronal differentiation. It finds that C3G protein levels increase when human neuroblastoma cells are induced to differentiate through serum starvation or treatment with forskolin or nerve growth factor. Overexpression of C3G stimulates neurite growth and increases responsiveness to differentiation signals, in a process dependent on C3G's catalytic domain and the functions of Rap1 and Cdc42. Knockdown of C3G inhibits forskolin- and nerve growth factor-induced differentiation and enhances cell death from serum starvation. C3G phosphorylation and localization to the Golgi are increased by forskolin and nerve growth factor treatment, and C3G
This document presents a PowerPoint presentation on advanced biotechnology topics including recombinant DNA technology, in vitro fertilization (IVF), and molecular mapping. It was submitted by 5 students and contains sections on the concepts, tools, history, process, and applications of these technologies. Recombinant DNA involves joining DNA from different sources and inserting it into a host to produce products. IVF is the process of fertilizing an egg with sperm outside the body, then implanting the embryo. The first successful IVF birth was in 1978. Molecular mapping uses genetic markers to identify the location of genes and distances between genes on genomes.
This document describes a case study of 4 patients with chronically thin endometrium who underwent intrauterine perfusion of granulocyte colony stimulating factor (G-CSF). All 4 patients achieved embryo transfer and conception, an unexpected outcome given their history of poor endometrial thickness. G-CSF appeared to effectively increase endometrial thickness within 48 hours, even in patients resistant to other treatments. While randomized studies are still needed, this case series suggests G-CSF enhances endometrial thickness and may improve IVF outcomes for patients with thin endometrium.
Molecular tools in reproductive research document discusses:
1. Molecular tools like genomics, proteomics, and RNA interference can provide insights into the underlying mechanisms of fertility and infertility.
2. These tools allow understanding of genetic variation and provide methods to enhance fertility and improve diagnosis of fertility disorders.
3. The document discusses applications of genetic markers, genomics, proteomics, and RNA interference in studying reproductive processes in male and female animals as well as embryonic development.
Klf2 is an essential factor that sustains ground state pluripotency cell st...Jia-Chi Yeo, PhD
This study investigates the molecular mechanisms underlying ground state pluripotency in mouse embryonic stem cells (mESCs) cultured under 2i conditions (dual inhibition of Mek and Gsk3 signaling pathways). The authors find that Klf2 protein levels are post-translationally regulated in mESCs - Mek/Erk signaling leads to phosphorylation and proteasomal degradation of Klf2, while inhibition of Mek with PD0325901 stabilizes Klf2 protein. Klf2-null mESCs can survive under normal culture conditions but not under 2i, demonstrating that Klf2 is essential for ground state pluripotency mediated by 2i. The study defines the Mek/
This document summarizes a study that identified and characterized Drosophila Snurportin (dSNUP), the fruit fly ortholog of human Snurportin1 (SPN1). The key findings are:
1) dSNUP lacks an importin-β binding (IBB) domain that is essential for SPN1's interaction with importin-β in vertebrates.
2) dSNUP does not physically interact with the Drosophila importin-β ortholog Ketel, and fruit fly snRNPs also fail to bind Ketel.
3) The importin-7 ortholog Moleskin (Msk) physically associates with both dS
Silencing of the lncRNA Zeb2-NAT facilitates reprogramming of aged fibroblast...XequeMateShannon
Aging imposes a barrier to somatic cell reprogramming through poorly understood mechanisms. Here, we report that fibroblasts from old mice express higher levels of Zeb2, a transcription factor that activates epithelial-to-mesenchymal transition. Synthesis of Zeb2 protein is controlled by a natural antisense transcript named Zeb2-NAT. We show that transfection of adult fibroblasts with specific LNA Gapmers induces a robust downregulation of Zeb2-NAT transcripts and Zeb2 protein and enhances the reprogramming of old fibroblasts into pluripotent cells. We further demonstrate that Zeb2-NAT expression is precociously activated by differentiation stimuli in embryonic stem (ES) cells. By knocking down Zeb2-NAT, we were able to maintain ES cells challenged with commitment signals in the ground state of pluripotency. In conclusion, our study identifies a long noncoding RNA that is overlapping and antisense to the Zeb2 locus as a target for rejuvenation strategies.
Viviparity is a unique characteristic of mammals. Gestational outcomes avoiding fetal defects or loss, maternal infection, or morbidity are contingent upon an intimate association between mother and developing fetus that nurtures the fetus without provoking maternal immune responses. Therefore the maintenance of optimal immunity is necessary for the successful gestation.
This document discusses the role of the guanine nucleotide exchange factor C3G in neuronal differentiation. It finds that C3G protein levels increase when human neuroblastoma cells are induced to differentiate through serum starvation or treatment with forskolin or nerve growth factor. Overexpression of C3G stimulates neurite growth and increases responsiveness to differentiation signals, in a process dependent on C3G's catalytic domain and the functions of Rap1 and Cdc42. Knockdown of C3G inhibits forskolin- and nerve growth factor-induced differentiation and enhances cell death from serum starvation. C3G phosphorylation and localization to the Golgi are increased by forskolin and nerve growth factor treatment, and C3G
This document presents a PowerPoint presentation on advanced biotechnology topics including recombinant DNA technology, in vitro fertilization (IVF), and molecular mapping. It was submitted by 5 students and contains sections on the concepts, tools, history, process, and applications of these technologies. Recombinant DNA involves joining DNA from different sources and inserting it into a host to produce products. IVF is the process of fertilizing an egg with sperm outside the body, then implanting the embryo. The first successful IVF birth was in 1978. Molecular mapping uses genetic markers to identify the location of genes and distances between genes on genomes.
This document describes a case study of 4 patients with chronically thin endometrium who underwent intrauterine perfusion of granulocyte colony stimulating factor (G-CSF). All 4 patients achieved embryo transfer and conception, an unexpected outcome given their history of poor endometrial thickness. G-CSF appeared to effectively increase endometrial thickness within 48 hours, even in patients resistant to other treatments. While randomized studies are still needed, this case series suggests G-CSF enhances endometrial thickness and may improve IVF outcomes for patients with thin endometrium.
Effect of Follicle Size on Oocyte Recovery and Maturation In Vitro in Iraqi S...Mohammed Muayad TA
1) The study examined the effects of follicular size on the percentage of oocyte recovery and maturation in Iraqi sheep.
2) A significant difference was found between large follicles (<2.5mm) and small follicles (>2mm) in terms of percentage of oocyte recovery (67.02±2.2 vs 64.18±7.5) and percentage of oocyte maturation (44.5±2.07 vs 39.3±8.5).
3) The results indicate that follicular size can affect the percentage of oocyte recovery and maturation in vitro in Iraqi sheep.
Nutrition Research - Decreased ZnT-2 transporter expression in offspring prod...Aroldo Trejo
Rats born to mothers fed a zinc-deficient diet during pregnancy and lactation displayed stunted growth and decreased expression of the ZnT-2 zinc transporter in the small intestine compared to rats born to mothers fed an adequate zinc diet. Offspring of severely zinc-deficient mothers died or had spinal defects. The downregulation of the ZnT-2 transporter, which exports zinc out of cells, helps maintain zinc homeostasis in conditions of deficiency by reducing zinc efflux. The results emphasize the importance of adequate maternal zinc intake to prevent adverse outcomes in offspring such as stunted growth and mortality.
This document summarizes a study examining the role of the Brg1 gene during early embryonic development in mice. The researchers conditionally deleted the Brg1 gene beginning at gastrulation using a tamoxifen-inducible Cre system. They found that Brg1 deficiency resulted in increased apoptosis, growth retardation, and embryonic death. Gene expression analysis revealed upregulation of genes that negatively regulate cell growth and cell cycle progression. Additionally, the p53 protein accumulated in Brg1-deficient embryos and activated p53-dependent pathways. The researchers provide evidence that Brg1 functions in part via regulating the p53 program to constrain gene expression and facilitate rapid embryonic growth.
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...Simon Gemble
Cellular inhibitor of apoptosis protein-1 (cIAP1) can directly interact with the transcription factor E2F1 and increase its transcriptional activity. cIAP1 is recruited to E2F1 binding sites on cyclin E and cyclin A promoters in a cell cycle-dependent manner. Silencing cIAP1 inhibits E2F1 DNA binding and transcriptional activation of cyclin E, reducing cell proliferation. Thus, one function of nuclear cIAP1 is to regulate E2F1 transcriptional activity and control cell cycle progression.
The study examined gene expression levels of TGF-β1, IGF-1, and IL-1β in bladder tissue samples from wildtype and cystinuria knockout mice of different ages. RNA was extracted from the samples and converted to cDNA, which was then used to perform qPCR to analyze gene expression levels. The results found no statistically significant differences in TGF-β1 or IGF-1 expression levels between genotypes or age groups. However, one 5-month old knockout mouse sample showed unusually high IGF-1 expression levels in multiple tests, suggesting another gene may be affecting its expression. Further research is needed to verify this possibility and test IL-1β expression levels.
Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats
Mariana Ríos1, Alexis Parada-Bustamante1, Luis A Velásquez2,3, Horacio B Croxatto2,3,4 and Pedro A Orihuela2,3*
By Luis Alberto Velasquez Cumplido
This document summarizes a study examining the expression and localization of matrix metalloproteinases (MMP-2, -7, -9) and their tissue inhibitors (TIMP-2, -3) in the chicken oviduct during maturation. The study found that these MMPs and TIMPs were differentially expressed in the infundibulum, magnum, isthmus and shell gland sections of the oviduct on the mRNA and protein levels. Expression levels generally decreased with maturation in most sections. Protein levels of MMP-9 decreased while MMP-7 and TIMP-3 increased in the maturing oviduct. MMP-2 and TIMP-2 protein levels remained constant with a slight MMP
TIF1-gamma Controls Erythroid Cell Fate by Regulating Transcription ElongationJoe Lee
1) A genetic suppressor screen in zebrafish identified a mutation in the cdc73 gene that rescued the erythroid defect in tif1g (moonshine) mutants.
2) cdc73 encodes a subunit of the PAF elongation complex. Knockdown of other PAF subunits also rescued tif1g mutants, indicating TIF1g antagonizes the PAF complex.
3) Biochemical studies showed TIF1g interacts with erythroid transcription factors and elongation factors, coupling them to promote transcription elongation of erythroid genes by counteracting polymerase II pausing.
Integrin V can form heterodimers with several subunits to mediate cell-cell and cell-extracellular matrix interactions. During zebrafish gastrulation, V is expressed maternally and zygotically. Here, we used a morpholino-mediated V knockdown strategy to study V function. Although V morphants displayed vascular defects, they also exhibited left-right body asymmetry defects affecting multiple visceral organs. This was preceded by mislocalization of dorsal forerunner cells (DFCs) and malformation of the Kupffer’s vesicle (KV) laterality organ
The researchers engineered a genetic toolset called pB-Tet-GOI for flexible control of transgene expression in stem and progenitor-derived cell lineages. The system incorporates the latest tetracycline transactivator and reverse transactivator variants to provide regulated transgene expression upon addition or removal of doxycycline. It allows for doxycycline-induced, doxycycline-suppressed, doxycycline-resistant (constitutive), and doxycycline-induced/constitutive regulation of transgenes. Initial tests showed the system provides inducible transgene expression with minimal leakiness and can be used to bidirectionally express reporters and genes of interest to direct cell differentiation.
This document summarizes research on the DNA translocase SpoIIIE in Bacillus subtilis. The key findings are:
1) SpoIIIE transports DNA directionally from the mother cell to the forespore during sporulation.
2) The g-domain of SpoIIIE is necessary for establishing directionality of DNA transport in vivo, but not for mechanical translocation in vitro.
3) SpoIIIE recognizes specific DNA sequences called SRS that are highly skewed on the B. subtilis chromosome, similar to how the related protein FtsK recognizes KOPS sequences. Interaction with SRS sequences regulates the direction of SpoIIIE-mediated DNA transport.
This document summarizes Richard Rodriguez's final lab report on analyzing the L34P mutation in the gap junction protein Cx31 using site-directed mutagenesis. Key findings include:
1) The L34P mutation is associated with Erythrokeratoderma vairabilis (EKV) skin disorder and causes the disease through a recessive inheritance pattern by preventing formation of normal gap junctions between keratinocytes.
2) Site-directed mutagenesis was used to introduce the L34P mutation into a Cx31 plasmid, which was then transformed into E. coli cells. Over 200 colonies grew on each transformation plate.
3) The mutated Cx31 plasmid will be used
Polyamine-Related Genes in Mouse Implantation_2008_EndocrinologyYuechao Zhao
Polyamines are essential for embryo implantation. This study investigated the expression and regulation of polyamine-related genes in the mouse uterus during embryo implantation. The study found:
1) Ornithine decarboxylase (Odc), a key regulator of polyamine synthesis, was strongly expressed at implantation sites and stimulated by estrogen treatment.
2) The expression of other polyamine-related genes like Odc antizyme 1 and spermidine/spermine N1-acetyltransferase was also high at implantation sites and regulated by Odc levels.
3) Inhibiting Odc using an inhibitor significantly reduced embryo implantation rates, indicating polyamines are important for successful
This study investigated the expression of connexin 43 (Cx43), a gap junction protein, in normal rat ovaries and ovaries with polycystic ovary syndrome (PCOS) induced by androstenedione. Granulosa cells were isolated from rat ovaries and cultured with or without androstenedione. The following key findings were reported:
1) Cx43 was expressed in the granulosa cell layer of normal and PCOS ovaries, and its protein levels were upregulated in PCOS ovaries.
2) In cultured granulosa cells, Cx43 had a punctate membranous distribution. Androstenedione increased both gap junctional intercellular communication and Cx43 protein
This document summarizes a study investigating the roles of the genes gldN and gldO in gliding motility in the bacterium Flavobacterium johnsoniae. The study found that:
1) A mutant lacking both gldN and gldO was completely nonmotile, indicating that at least one of the proteins is required for gliding.
2) The gldN mutant had some residual motility, suggesting gldO may partially compensate for the lack of gldN.
3) The gldN/gldO mutant was defective in localization of the motility protein SprB to the cell surface, suggesting GldN is involved in secretion of motility
This study characterizes a novel microtubule-associated protein in Toxoplasma gondii called TgTLAP3. The researchers generated a transgenic parasite line expressing fluorescently tagged TgTLAP3 and found that it localized to the apical region near the organizing center of cortical microtubules. Knockout parasites were also generated using Cre-LoxP recombination and appeared normal with no obvious phenotype. Preliminary experiments showed TgTLAP3 does not directly bind microtubules in host cells. Future work will further characterize the TgTLAP3 knockout parasites through time-lapse imaging of daughter cell development to understand its role in cytoskeletal organization.
Modulation of pluripotency in the porcine embryo and i ps cells (Dec.27,2012) Ahmad Usama
1) The study investigated signaling pathways involved in formation of the porcine inner cell mass (ICM) and methods to increase pluripotency in porcine embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).
2) They found that inhibiting MEK and GSK3β signaling pathways in porcine embryos and iPSCs, combined with LIF treatment, promoted a naive pluripotent state similar to mouse ESCs.
3) Naive piPSCs expressed genes associated with naive pluripotency and showed higher germline differentiation potential than non-naive piPSCs. The study provides insights into regulating pluripotency in
This study investigated the translation of alternatively spliced calpastatin cDNAs in vitro. Three mRNA types (I-III) are produced from a single gene through alternative promoter usage and splicing. Types I and II each contain two potential start sites, while Type III contains one. In vitro transcription/translation showed that Types I and II generate a range of proteins from 145-120 kDa, indicating both start sites are used. Type III generates a single 128 kDa protein. Deleting exons or start sites helped determine utilization of start sites and potential tissue-specific control mechanisms.
El documento describe la transgénesis, el proceso de transferir genes entre organismos. Explica que el primer animal transgénico fue un ratón creado en 1974 mediante la inyección de ADN en un cigoto. También menciona algunas especies que han sido modificadas genéticamente, como ratones, ratas, pollos y peces. Además, resume las principales técnicas utilizadas para crear organismos transgénicos e identifica algunos problemas potenciales asociados con la transgénesis. Por último, discute el caso de una cone
El documento describe el desarrollo de las plantas transgénicas, incluyendo los primeros experimentos de transferencia de genes foráneos a células vegetales hace 20 años y cómo se han convertido en una herramienta esencial para estudiar la fisiología vegetal y desarrollar nuevas variedades. También explica cómo las plantas transgénicas se producen incorporando genes de otras especies para conferir nuevas características como resistencia a plagas, enfermedades, herbicidas y condiciones ambientales adversas.
Effect of Follicle Size on Oocyte Recovery and Maturation In Vitro in Iraqi S...Mohammed Muayad TA
1) The study examined the effects of follicular size on the percentage of oocyte recovery and maturation in Iraqi sheep.
2) A significant difference was found between large follicles (<2.5mm) and small follicles (>2mm) in terms of percentage of oocyte recovery (67.02±2.2 vs 64.18±7.5) and percentage of oocyte maturation (44.5±2.07 vs 39.3±8.5).
3) The results indicate that follicular size can affect the percentage of oocyte recovery and maturation in vitro in Iraqi sheep.
Nutrition Research - Decreased ZnT-2 transporter expression in offspring prod...Aroldo Trejo
Rats born to mothers fed a zinc-deficient diet during pregnancy and lactation displayed stunted growth and decreased expression of the ZnT-2 zinc transporter in the small intestine compared to rats born to mothers fed an adequate zinc diet. Offspring of severely zinc-deficient mothers died or had spinal defects. The downregulation of the ZnT-2 transporter, which exports zinc out of cells, helps maintain zinc homeostasis in conditions of deficiency by reducing zinc efflux. The results emphasize the importance of adequate maternal zinc intake to prevent adverse outcomes in offspring such as stunted growth and mortality.
This document summarizes a study examining the role of the Brg1 gene during early embryonic development in mice. The researchers conditionally deleted the Brg1 gene beginning at gastrulation using a tamoxifen-inducible Cre system. They found that Brg1 deficiency resulted in increased apoptosis, growth retardation, and embryonic death. Gene expression analysis revealed upregulation of genes that negatively regulate cell growth and cell cycle progression. Additionally, the p53 protein accumulated in Brg1-deficient embryos and activated p53-dependent pathways. The researchers provide evidence that Brg1 functions in part via regulating the p53 program to constrain gene expression and facilitate rapid embryonic growth.
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...Simon Gemble
Cellular inhibitor of apoptosis protein-1 (cIAP1) can directly interact with the transcription factor E2F1 and increase its transcriptional activity. cIAP1 is recruited to E2F1 binding sites on cyclin E and cyclin A promoters in a cell cycle-dependent manner. Silencing cIAP1 inhibits E2F1 DNA binding and transcriptional activation of cyclin E, reducing cell proliferation. Thus, one function of nuclear cIAP1 is to regulate E2F1 transcriptional activity and control cell cycle progression.
The study examined gene expression levels of TGF-β1, IGF-1, and IL-1β in bladder tissue samples from wildtype and cystinuria knockout mice of different ages. RNA was extracted from the samples and converted to cDNA, which was then used to perform qPCR to analyze gene expression levels. The results found no statistically significant differences in TGF-β1 or IGF-1 expression levels between genotypes or age groups. However, one 5-month old knockout mouse sample showed unusually high IGF-1 expression levels in multiple tests, suggesting another gene may be affecting its expression. Further research is needed to verify this possibility and test IL-1β expression levels.
Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats
Mariana Ríos1, Alexis Parada-Bustamante1, Luis A Velásquez2,3, Horacio B Croxatto2,3,4 and Pedro A Orihuela2,3*
By Luis Alberto Velasquez Cumplido
This document summarizes a study examining the expression and localization of matrix metalloproteinases (MMP-2, -7, -9) and their tissue inhibitors (TIMP-2, -3) in the chicken oviduct during maturation. The study found that these MMPs and TIMPs were differentially expressed in the infundibulum, magnum, isthmus and shell gland sections of the oviduct on the mRNA and protein levels. Expression levels generally decreased with maturation in most sections. Protein levels of MMP-9 decreased while MMP-7 and TIMP-3 increased in the maturing oviduct. MMP-2 and TIMP-2 protein levels remained constant with a slight MMP
TIF1-gamma Controls Erythroid Cell Fate by Regulating Transcription ElongationJoe Lee
1) A genetic suppressor screen in zebrafish identified a mutation in the cdc73 gene that rescued the erythroid defect in tif1g (moonshine) mutants.
2) cdc73 encodes a subunit of the PAF elongation complex. Knockdown of other PAF subunits also rescued tif1g mutants, indicating TIF1g antagonizes the PAF complex.
3) Biochemical studies showed TIF1g interacts with erythroid transcription factors and elongation factors, coupling them to promote transcription elongation of erythroid genes by counteracting polymerase II pausing.
Integrin V can form heterodimers with several subunits to mediate cell-cell and cell-extracellular matrix interactions. During zebrafish gastrulation, V is expressed maternally and zygotically. Here, we used a morpholino-mediated V knockdown strategy to study V function. Although V morphants displayed vascular defects, they also exhibited left-right body asymmetry defects affecting multiple visceral organs. This was preceded by mislocalization of dorsal forerunner cells (DFCs) and malformation of the Kupffer’s vesicle (KV) laterality organ
The researchers engineered a genetic toolset called pB-Tet-GOI for flexible control of transgene expression in stem and progenitor-derived cell lineages. The system incorporates the latest tetracycline transactivator and reverse transactivator variants to provide regulated transgene expression upon addition or removal of doxycycline. It allows for doxycycline-induced, doxycycline-suppressed, doxycycline-resistant (constitutive), and doxycycline-induced/constitutive regulation of transgenes. Initial tests showed the system provides inducible transgene expression with minimal leakiness and can be used to bidirectionally express reporters and genes of interest to direct cell differentiation.
This document summarizes research on the DNA translocase SpoIIIE in Bacillus subtilis. The key findings are:
1) SpoIIIE transports DNA directionally from the mother cell to the forespore during sporulation.
2) The g-domain of SpoIIIE is necessary for establishing directionality of DNA transport in vivo, but not for mechanical translocation in vitro.
3) SpoIIIE recognizes specific DNA sequences called SRS that are highly skewed on the B. subtilis chromosome, similar to how the related protein FtsK recognizes KOPS sequences. Interaction with SRS sequences regulates the direction of SpoIIIE-mediated DNA transport.
This document summarizes Richard Rodriguez's final lab report on analyzing the L34P mutation in the gap junction protein Cx31 using site-directed mutagenesis. Key findings include:
1) The L34P mutation is associated with Erythrokeratoderma vairabilis (EKV) skin disorder and causes the disease through a recessive inheritance pattern by preventing formation of normal gap junctions between keratinocytes.
2) Site-directed mutagenesis was used to introduce the L34P mutation into a Cx31 plasmid, which was then transformed into E. coli cells. Over 200 colonies grew on each transformation plate.
3) The mutated Cx31 plasmid will be used
Polyamine-Related Genes in Mouse Implantation_2008_EndocrinologyYuechao Zhao
Polyamines are essential for embryo implantation. This study investigated the expression and regulation of polyamine-related genes in the mouse uterus during embryo implantation. The study found:
1) Ornithine decarboxylase (Odc), a key regulator of polyamine synthesis, was strongly expressed at implantation sites and stimulated by estrogen treatment.
2) The expression of other polyamine-related genes like Odc antizyme 1 and spermidine/spermine N1-acetyltransferase was also high at implantation sites and regulated by Odc levels.
3) Inhibiting Odc using an inhibitor significantly reduced embryo implantation rates, indicating polyamines are important for successful
This study investigated the expression of connexin 43 (Cx43), a gap junction protein, in normal rat ovaries and ovaries with polycystic ovary syndrome (PCOS) induced by androstenedione. Granulosa cells were isolated from rat ovaries and cultured with or without androstenedione. The following key findings were reported:
1) Cx43 was expressed in the granulosa cell layer of normal and PCOS ovaries, and its protein levels were upregulated in PCOS ovaries.
2) In cultured granulosa cells, Cx43 had a punctate membranous distribution. Androstenedione increased both gap junctional intercellular communication and Cx43 protein
This document summarizes a study investigating the roles of the genes gldN and gldO in gliding motility in the bacterium Flavobacterium johnsoniae. The study found that:
1) A mutant lacking both gldN and gldO was completely nonmotile, indicating that at least one of the proteins is required for gliding.
2) The gldN mutant had some residual motility, suggesting gldO may partially compensate for the lack of gldN.
3) The gldN/gldO mutant was defective in localization of the motility protein SprB to the cell surface, suggesting GldN is involved in secretion of motility
This study characterizes a novel microtubule-associated protein in Toxoplasma gondii called TgTLAP3. The researchers generated a transgenic parasite line expressing fluorescently tagged TgTLAP3 and found that it localized to the apical region near the organizing center of cortical microtubules. Knockout parasites were also generated using Cre-LoxP recombination and appeared normal with no obvious phenotype. Preliminary experiments showed TgTLAP3 does not directly bind microtubules in host cells. Future work will further characterize the TgTLAP3 knockout parasites through time-lapse imaging of daughter cell development to understand its role in cytoskeletal organization.
Modulation of pluripotency in the porcine embryo and i ps cells (Dec.27,2012) Ahmad Usama
1) The study investigated signaling pathways involved in formation of the porcine inner cell mass (ICM) and methods to increase pluripotency in porcine embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).
2) They found that inhibiting MEK and GSK3β signaling pathways in porcine embryos and iPSCs, combined with LIF treatment, promoted a naive pluripotent state similar to mouse ESCs.
3) Naive piPSCs expressed genes associated with naive pluripotency and showed higher germline differentiation potential than non-naive piPSCs. The study provides insights into regulating pluripotency in
This study investigated the translation of alternatively spliced calpastatin cDNAs in vitro. Three mRNA types (I-III) are produced from a single gene through alternative promoter usage and splicing. Types I and II each contain two potential start sites, while Type III contains one. In vitro transcription/translation showed that Types I and II generate a range of proteins from 145-120 kDa, indicating both start sites are used. Type III generates a single 128 kDa protein. Deleting exons or start sites helped determine utilization of start sites and potential tissue-specific control mechanisms.
El documento describe la transgénesis, el proceso de transferir genes entre organismos. Explica que el primer animal transgénico fue un ratón creado en 1974 mediante la inyección de ADN en un cigoto. También menciona algunas especies que han sido modificadas genéticamente, como ratones, ratas, pollos y peces. Además, resume las principales técnicas utilizadas para crear organismos transgénicos e identifica algunos problemas potenciales asociados con la transgénesis. Por último, discute el caso de una cone
El documento describe el desarrollo de las plantas transgénicas, incluyendo los primeros experimentos de transferencia de genes foráneos a células vegetales hace 20 años y cómo se han convertido en una herramienta esencial para estudiar la fisiología vegetal y desarrollar nuevas variedades. También explica cómo las plantas transgénicas se producen incorporando genes de otras especies para conferir nuevas características como resistencia a plagas, enfermedades, herbicidas y condiciones ambientales adversas.
Este documento define los organismos transgénicos como aquellos cuyo material genético ha sido alterado artificialmente mediante la introducción de un gen exógeno. Explica que se obtienen modificando el ADN y que esto puede ser útil para la producción de alimentos y materias primas, aunque también conlleva riesgos como la aparición de alergias o la creación de "súper malas hierbas". Finalmente, concluye que los organismos transgénicos requieren un estricto control debido a las posibles consecuencias para la sal
El documento describe la historia de la manipulación genética de organismos vivos por parte de los humanos y explica qué son los organismos transgénicos. Señala que las plantas transgénicas se usan para mejorar la resistencia a enfermedades, insectos y sequía, así como para mejorar la calidad y rendimiento de los cultivos. Aunque existen riesgos potenciales, no se han reportado daños a la salud humana o animal debido al consumo de alimentos transgénicos en los últimos 10 años.
Este documento trata sobre la ingeniería genética y los animales y plantas transgénicos. Explica los métodos para crear animales y plantas transgénicos como la microinyección, el uso de retrovirus, la transformación de células madre embrionarias, y la utilización de Agrobacterium. También describe los beneficios potenciales de los animales y plantas transgénicos como la producción de órganos para trasplantes, medicinas, resistencia a plagas y sequía, y un mayor rendimiento. Sin embargo, también
Transgenesis is the process of introducing an exogenous gene into an organism to produce a new trait. It allows for more specific, faster, and flexible introduction of traits compared to selective breeding. Golden rice was developed using transgenesis to introduce beta-carotene genes into rice, providing vitamin A. While this could help address vitamin A deficiency, there are also risks like gene transfer and unintended effects that require careful evaluation.
Cold Spring Harb Symp Quant Biol-2015-Leseva-sqb.2015.80.027441Milena Leseva
This document summarizes research on the natural reprogramming of the mammalian epigenome that occurs during reproduction and development. It discusses how fertilization triggers extensive demethylation and reprogramming of the parental genomes. It also describes how primordial germ cells undergo erasure and re-establishment of epigenetic marks during their development. A key factor in guiding this intricate epigenomic reprogramming is TRIM28, a multifunctional protein that interacts with various chromatin modifiers and transcription factors. TRIM28 is able to target these complexes to specific genomic regions like imprinted genes and retrotransposons to protect certain loci from demethylation during reprogramming events.
Mouse zar1 like (xm 359149) colocalizes with m-rna processing components and ...wujunbo1015
1. The study identified a mouse gene, Zar1l, that encodes a ZAR1-like protein called ZAR1L. 2. ZAR1L is predominantly expressed in oocytes and zygotes. When ectopically expressed, ZAR1L localizes to cytoplasmic foci in late two-cell stage embryos. 3. Expression of a dominant-negative ZAR1L C-terminal mutant induced two-cell stage embryonic arrest, accompanied by abnormal epigenetic modifications and downregulation of chromatin factors.
1) The study investigates the role of b-catenin in myogenesis using P19 cells with reduced b-catenin activity (P19[shb-cat] cells) compared to control cells.
2) The loss of b-catenin resulted in reduced expression of genes involved in premyogenic mesoderm formation and skeletal myogenesis.
3) While retinoic acid could partially compensate by upregulating some precursor genes in P19[shb-cat] cells, it could not compensate for the expression of genes required for terminal myogenesis or overall skeletal muscle formation.
A RESEARCH ON GENOMIC IMPRINTINGGenomic imprinting is the epig.docxransayo
A RESEARCH ON GENOMIC IMPRINTING
Genomic imprinting is the epigenetic phenomenon mostly occurring in gametogenesis. It has independently evolved in flowering plants and mammals. In both organisms, imprinting occurs in the embryo-nourishing tissues; the endosperm and the placenta respectively. Imprinting genes regulate the transfer of nutrients to developing progeny (Beery & Workman, 2011).The genomic imprinting usually occurs when both the maternal and the paternal alleles are present but one allele expresses itself while the other remains inactive ( Engel, N. 2015). Gene imprinting is believed to be important in regulation of growth in embryo and neonate
Experiments on androgenotes and gynogenotes , which are produced by nuclear transplantation, are used to create basis of genomic imprinting. The zygotes from androgenotes and gynogenotes were formed but neither type could undergo more development. From this situation, it is possible to suggest that the maternal and paternal effects are complimentary(Morgan, Li, & O’Neill, 2009). Each genome contains different viable and necessary properties. Another evidence that genomic imprinting has a major role in growth and development comes from a research by Li et al(1993).
Optimal method for gene imprinting is DNA methylation, which is carried out with enzyme DNA methyltransferase in mammals. DNA MTase acts on the DNA sequence 5’-6pG-3’. Primarily higher eukaryotes have CpG islands in their genomes. The islands are hardly methylated in the animal cells, this could be due to the bound transcription factors that block DNA MTase. Those sequences which are methylated are normally not active. Some research also show that methylated sequences can be active (Madek, 1974).
The importance of DNA methylation was demonstrated in the study of mammalian development(Li et al, 1993). They postulated that if mutation was introduced to the DNA MTase gene in embryonic stem cell of a mice, methylation of CpG would be abnormal and the gene expression would be affected (“DNA methylation and demethylation dynamics,” 2015). Gene mutation of DNA MTase was caused by homologous recombination and Southern blot analysis affirmed this (Wilkins, 2010). The genes used were insulin-like growth factors; H19, lgf2 and lgf2 receptor; lgf2r.
Normally H19 gene, whih is a maternal allele, is expressed while the paternal allele is inactive. Inactive paternal allele is methylated but the maternal allele is not; this should be noted carefully. RNase and Northern blot analysis essays procedures demonstrated the effects of decreased levels of DNA methylation on mutant mice. It was brought to light that typical DNA methylation is a requirement to keep for the paternal allele inactive for the H19 gene (Mightiness of science, 2016)
The lgf2 is opposite of the H19 gene in that it is expressed only in a methylated paternal allele. As a result, it is expressed in mice having deficient MTase activity. It is expected that the lgf2 gene wil.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
LncRNA WARS2-IT1 Functions as an Oncogene and is Associated with Poor Outcome...semualkaira
Glioblastoma multiforme (GBM) is one of the most common malignant brain tumors in adults and has high mortality and relapse rates. Over the past few years, great advances have been made in the diagnosis and treatment of GBM, but unfortunately, the five-year overall survival rate of GBM patients is approximately 5.1%. Our study aimed to investigate the new mechanism of Long noncoding RNAs (lncRNAs) WARS2-IT1 regulate the malignant progression of Glioblastoma.
Caspase activation contributes to astrogliosis without inducing apoptosis in astrocytes. The study found that treating cultured neonatal rat astrocytes with dibutryl cAMP or beta-amyloid peptide, stimuli known to induce astrogliosis, led to increased caspase activity and expression of active caspase-3 without cell death. Inhibition of caspases attenuated the increased expression of glutamine synthetase and fibroblast growth factor-2, markers of astrogliosis. The results suggest caspases play a non-apoptotic role in regulating astrogliosis in astrocytes following brain injury.
UTF-8''Final Assessing post-synaptic partners of Dentate Granule Cells in a M...Grant Pizzo
1) The document describes an experiment assessing how dentate granule cell (DGC) axon terminals and their post-synaptic partners change in a rat model of temporal lobe epilepsy (TLE).
2) The researcher induced seizures in rats using pilocarpine and later injected retroviruses to label dividing DGCs. Tissue was then analyzed to identify post-synaptic partners of DGCs using antibodies targeting interneurons and mossy cells.
3) Preliminary results showed that antibodies for GAD67 and GluR2 successfully labeled the correct cell types, but need further refinement, while an mGluR1/5 antibody did not label interneurons in the dentate gyrus
- Epigenetic modifications like DNA methylation and histone modifications play an important role in regulating gene expression and cell differentiation.
- Certain transcription factors are asymmetrically distributed during early cell divisions, leading to new patterns of gene expression over generations in response to cellular signaling.
- While epigenetic changes are not always heritable, some studies have found evidence that epigenetic switches can be transmitted from parents to offspring, though these effects may be reversible. This has implications for the inheritance of acquired traits.
FUBP1 is a tumor suppressor gene that encodes a protein which regulates the expression of the c-MYC gene by binding to its promoter region. As a transcriptional regulator, FUBP1 plays an important role in controlling cell proliferation. Mutations or deletions of the FUBP1 gene have been associated with several types of brain tumors, including oligodendrogliomas and astrocytomas.
This document summarizes a study that found the transcription factors eyes absent (eya) and sine oculis (so), which are involved in eye development, are also required in the somatic cyst cells of the Drosophila testis for proper spermatocyte development. The study found that eya mutant testes exhibit degenerating young spermatocytes, and mosaic analysis revealed a somatic requirement for both eya and so in the cyst cells, not in the germline. Immunolocalization showed eya and so proteins are expressed in cyst cell nuclei as spermatocytes differentiate. The study suggests eya and so may form a transcription complex in the cyst cells to activate genes involved in cyst cell differentiation and s
1) The study examines how the telomere-associated protein TIN2 is reorganized in the nuclei of human mammary epithelial cells undergoing growth arrest and differentiation.
2) The researchers find that TIN2 forms one to three large nuclear subdomains that do not contain telomeres and occur simultaneously with TIN2 remaining at telomeres.
3) Expression of truncated forms of TIN2 prevents formation of the large TIN2 domains and relaxation of growth arrest in the cells, suggesting TIN2 organization regulates proliferation and differentiation.
Loss of photoreceptor potential from retinal progenitor cell cultures, despit...Dr Reaz Vawda, MSc PhD
1) Researchers improved survival and growth rates of retinal progenitor cells (RPCs) derived from mouse retinal cells by modifying dissociation and culture methods, but photoreceptor potential was still lost.
2) Freshly dissociated retinal cells from postnatal mice that expressed rhodopsin integrated at higher rates after transplantation and formed photoreceptors, indicating these were post-mitotic photoreceptor precursors.
3) Cultured RPCs, even after attempted differentiation, did not generate photoreceptors or express rhodopsin after transplantation. Identifying cues to promote survival of specified photoreceptor precursors in vitro is needed for therapeutic use of RPCs.
This study examined the effects of inhibiting the Hippo signaling pathway during sea urchin embryogenesis. Researchers treated sea urchin embryos with verteporfin, an inhibitor of YAP which is a key component of the Hippo pathway. They found that inhibiting the Hippo pathway delayed cell cleavage and gastrulation. While marker genes for specific cell types were still expressed, the patterns of expression were altered. Inhibition of the Hippo pathway resulted in epithelial cells that were larger in size and fewer in number, suggesting YAP is involved in epithelial organization and proliferation during sea urchin development.
This doctoral research used single-molecule imaging techniques to study DNA replication in live E. coli cells. Endogenous replication proteins like β2-clamps were labeled with fluorescent proteins using genome engineering. Observations found β2-clamps accumulate on DNA after initiation and remain bound for minutes. Experiments also examined how replisomes encounter natural Tus-Ter roadblocks and determined replication speed decreases but is not stalled. Further work aimed to study primase dynamics and localization of Tus proteins during the cell cycle but faced challenges in strain engineering. The research demonstrated applications of in vivo single-molecule imaging while also highlighting ongoing difficulties in the field.
The document discusses how the SUMO E3-ligase PIAS1 couples reactive oxygen species (ROS)-dependent JNK activation to oxidative cell death in human endometrial stromal cells (HESCs). It finds that ROS-dependent JNK activation converges on the SUMO pathway via PIAS1. Knockdown of PIAS1 prevents ROS-dependent hypersumoylation but enhances JNK signaling in HESCs. PIAS1 determines the level of JNK activity, couples ROS signaling to the SUMO pathway, and promotes oxidative cell death. PIAS1 knockdown attenuates ROS-dependent caspase activation and apoptosis.
This study investigated the role of the cellular protein annexin 2 (Anx2) in human immunodeficiency virus type 1 (HIV-1) particle production and infectivity. The researchers knocked down Anx2 expression by 98% in various cell types using lentiviruses encoding short hairpin RNAs against Anx2. They found that knocking down Anx2 did not reduce HIV-1 virus-like particle production in COS-1, 293T, Jurkat T cells, or primary human macrophages. Similarly, murine cells lacking Anx2 produced normal levels of particles. However, supernatants from Anx2-depleted primary human macrophages exhibited decreased infectivity, indicating Anx2 plays a
How does the Drosophila embryo get its pair-rule stripes How is the .pdfdeepakarora871
How does the Drosophila embryo get its pair-rule stripes? How is the evenskipped enhancer
build to ensure transcription of even-skipped in stripes? Use the even-skipped stripe 2 enhancer
as an example. Describe in general terms the inputs of transcription factors, and how the
embryonic expression domains of these factors are generated in the Drosophila embryo.
Solution
Initially,12 nuclear divisions take place which result in a multinucleate syncitium which is an
early drosophilla embryo; formation of pole cells take place followed by cellularization and
gastrulation. During gastrulation, extension of germ band takes place driving the posterior trunk
regions around the posterior end and the dorsal side, here the first signs of segmentation are seen.
At the syncitial blastoderm stage anterior-posterior and dorso-ventral axes get fully established.
Maternal factors in the form of mRNAs and proteins specify the anterior-posterior axis of the
embryo and the dorso-ventral aspect is governed by the localization of maternal proteins within
the envelope of egg vitelline and the positional information.
Even skipped acts as a transcriptional repressor of numerous genes.There is a combination of
maternal factors, transcription activators, and repressors, which defines each stripe of eve already
patterned in the egg either prior to fertilization or prior to cellularization.There are regional
specific enhancers which governs the stripe pattern of eve transcription.A stripe-specific
enhancer regulate each stripe. As seen in the case of eve stripe 2,in the range of -1.5 and -1.0 kb
upstream from the eve start site a minimal stripe 2 enhancer has been identified which assures
eve transcription in the second pair rule stripe.
Reference
1. Wolpert,L., Tickle, C., & Arias, A,M. (2015).Principles of development. Oxford: Oxford
university press.
2. Jiang, P., Ludwig, M. Z., Kreitman, M. and Reinitz, J. (2015). Natural variation of the
expression pattern of the segmentation gene even-skipped in melanogaster. Dev Biol [Epub
ahead of print]. PubMed ID: 26129990.
Similar to Nop2 is required for mammalian preimplantation development (20)
How does the Drosophila embryo get its pair-rule stripes How is the .pdf
Nop2 is required for mammalian preimplantation development
1. RESEARCH ARTICLE
Molecular Reproduction & Development 83:124–131 (2016)
Nop2 Is Required for Mammalian Preimplantation
Development
WEI CUI,1
JASON PIZZOLLO,1
ZHENGBIN HAN,1,2
CHELSEA MARCHO,1
KUN ZHANG3
, AND JESSE MAGER1
*
1
Department of Veterinary and Animal Sciences, University of Massachusetts, Amherst, Massachusetts
2
Harbin Institute of Technology, School of Life Science and Technology, Harbin, China
3
Laboratory of Mammalian Molecular Embryology, Institute of Animal Genetics, Breeding and Reproduction,
College of Animal Sciences, Zhejiang University, Hangzhou, China
SUMMARY
Nucleolar protein 2 (NOP2) is evolutionarily conserved from yeast to human, and has
been found to play an important role in accelerating cell proliferation, cell-cycle
progression, and tumor aggressiveness. The expression pattern and function of
Nop2 during early mammalian embryo development, however, has not been investi-
gated.WeidentifiedNop2asanessentialgenefordevelopmenttotheblastocyststage
while performing an RNA interference (RNAi)-based screen in mouse preimplantation
embryos. Nop2 is expressed throughout preimplantation development, with highest
mRNA and protein accumulation at the 8-cell and morula stages, respectively. RNAi-
mediatedknockdownofNop2resultsinembryosthatarrestasmorula.NOP2-deficient
embryos exhibit reduced blastomere numbers, greatly increased apoptosis, and
impaired cell-lineage specification. Furthermore, knockdown of Nop2 results in global
reductionofallRNAspecies,includingrRNA,smallnuclearRNA,smallnucleolarRNA,
and mRNA. Taken together, our results demonstrate that Nop2 is an essential gene
for blastocyst formation, and is required for RNA processing and/or stability in vivo
during preimplantation embryo development in the mouse.
Mol. Reprod. Dev. 83: 124À131, 2016. ß 2015 Wiley Periodicals, Inc.
Received 29 September 2015; Accepted 1 December 2015
Ã
Corresponding author:
University of Massachusetts, Amherst
661 North Pleasant Street
Amherst, MA 01003.
E-mail: jmager@vasci.umass.edu
Grant sponsor: March of Dimes Research
Grant; Grant number: #6-FY11-367;
Grant sponsor: NIH; Grant number:
1R21HD078942-01
Published online 15 December 2015 in Wiley Online Library
(wileyonlinelibrary.com).
DOI 10.1002/mrd.22600
INTRODUCTION
The fertilized egg progresses through three major tran-
scriptional and morphogenetic events during preimplanta-
tion embryo development, resulting in the first cell-lineage
decision and formation of a blastocyst-stage embryo capa-
ble of implantation. The first event is the maternal-to-
zygotic transition, which includes the degradation of ma-
ternal transcripts in favor of zygotic transcripts; this process
initiates the dramatic reprogramming required for success-
ful embryo development (Latham et al., 1991). In mice,
zygotic genome activation begins in 1-cell stage embryos,
but becomes obvious at the 2-cell stage (Schultz, 2002).
The second major event is embryo compaction, which
involves the flattening of blastomeres against each other
starting at the 8-cell stage in the mouse. Compaction is
accompanied by biochemical changes involving cellular
metabolism and ion transport, and results in early
Abbreviations: dsRNA, double-stranded RNA; Nop2, nucleolar protein 2;
RNAi, RNA interference
ß 2015 WILEY PERIODICALS, INC.
2. embryonic cells first resembling somatic cells (Fleming
et al., 2001; Zeng et al., 2004). The third major event is
blastomere allocation and the first cell-fate determination,
where blastomeres of the morula give rise to the inner cell
mass, from which the embryo proper is derived, versus
the trophectoderm, from which extra-embryonic tissues are
derived (Yamanaka et al., 2006). Overt, detectable gene
expression patterns occur within these two distinct lineages
in the compacted morula. For example, the transcription
factor POU5F1 (OCT4) is enriched in the inner cell mass,
where it promotes pluripotency and inhibits differentiation,
although the transcription factor CDX2 becomes highly
upregulated in the trophectoderm, where it influences epi-
thelial differentiation. Appropriate regulation of POU5F1
and CDX2 are necessary for successful blastocyst forma-
tion (Cockburn and Rossant, 2010; Marcho et al., 2015).
We are currently performing an RNA interference
(RNAi)-based screen, using the mouse preimplantation
embryo, to understand which genes are functionally re-
quired for early embryo development (Maserati et al., 2011;
Zhang et al., 2013a,b). Microinjection of long, double-
stranded RNA (dsRNA) against specific transcripts into
fertilized 1-cell zygotes is a robust approach to achieve
gene-specific silencing (Svoboda et al., 2000; Wianny and
Zernicka-Goetz, 2000) without an interferon response or
significant off-target effects (Stein et al., 2005). One goal of
our screen was to identify genes with previously unknown
functions during preimplantation development. One of
these genes encodes nucleolar protein 2 (NOP2).
Murine NOP2 is homologous to yeast protein NOP2p
and human NOP2 (also named NSUN1 or P120) (de Beus
et al., 1994; Mitrecic et al., 2008). NOP2 belongs to the
NOP2/SUN (NSUN) RNA-methyltransferase family, which
includes six other members: NSUN2 through NSUN7
(Blanco and Frye, 2014). NOP2 promotes mouse fibroblast
growth and tumor formation (Perlaky et al., 1992), and is
highly expressed in diverse tumor types but not in normal
cells. Therefore, NOP2 is being pursued as a prognostic
marker for cancer aggressiveness (Saijo et al., 2001;
Bantis et al., 2004). Limited studies in mammals have
demonstrated expression of Nop2 in brain tissue and fetal
liver (Wang et al., 2014; Kosi et al., 2015), but the expres-
sion pattern and function of Nop2 during preimplantation
development have not yet been investigated.
Here we show that Nop2 is expressed throughout pre-
implantation development, with highest transcription and
protein accumulation at the 8-cell and morula stages,
respectively. We further demonstrate that NOP2 is neces-
sary for successful preimplantation embryo development,
as NOP2-deficient embryos cannot form blastocysts, ar-
resting at the morula stage with severe cell death, impaired
lineage specification, and a global reduction in RNA.
RESULTS
Expression of Nop2 During Preimplantation
Immunofluorescence analysis during all stages of pre-
implantation development revealed that NOP2 protein
abundance was low during the oocyte-to-2-cell embryo
development period, with no obvious difference between
the cytoplasm and nucleus (Fig. 1A). NOP2 abundance
increased significantly from the 4- to 8-cell stage, mostly
concentrated in the nucleus, specifically around the nucle-
olus. NOP2 protein accumulation peaked at the morula
stage, with a slight qualitative decrease in nuclear intensity
in blastocyst embryos.
Quantitative and reverse-transcription PCR revealed
that Nop2 mRNA is expressed at relatively low levels
in oocytes and zygotes, increased through subsequent
cleavage stage divisions, peaked at the 8-cell stage,
and dramatically declined in morula and blastocysts
(Fig. 1B and C). This mRNA expression profile is consistent
with the dynamic protein levels that we detected, although
there was a slight delay between peak mRNA and protein
levels, which may reflect timing of translation within each
cell.
Efficient Knockdown of NOP2 by dsNop2 RNA
Microinjection
dsNop2 RNA was injected into the cytoplasm of zygotes
to deplete NOP2 activity. In all experiments presented,
control embryos were injected with dsGFP to stimulate
the RNAi machinery. Injection of specific dsNop2 RNA
resulted in a drastic degradation of Nop2 mRNA in all
stages examined (Fig. 1D). Similarly, immunofluorescence
analysis revealed obvious protein reduction in NOP2-
knockdown embryos (hereafter referred to as dsNop2
embryos) at the morula stage (Fig. 1E), indicating success-
ful functional loss of NOP2.
NOP2 is Required for Blastocyst Formation
We next evaluated the impact of dsNop2 microinjection
on developmental progression at 24 hr (2-cell stage), 48 hr
(4/8-cell stage), 72 hr (morula stage), and 96 hr (blastocyst
stage) post-fertilization. In these time-course experiments,
dsNop2 embryos develop to the morula stage and compact
without obvious differences in morphology or rate of devel-
opment compared to control dsGFP embryos (Fig. 2A).
At 96 hr, 95% (103/108) of control embryos reach the
blastocyst stage whereas nearly all dsNOP2 embryosÀÀ
1.5% (2/105)ÀÀfailed to reach the blastocyst stage
(Fig. 2A and B). Some dsNop2 embryos also exhibited
visible signs of degeneration at 96 hr, specifically display-
ing morphological irregularities (Fig. 2A, arrows).
As dsNop2 embryos cannot develop into blastocysts, we
performed more-detailed analyses at the morula stage,
when they still appear morphologically normal. dsNop2
embryo blastomeres appeared to compact, although we
observed a reduction in the blastomere number per
embryo compared to that of control embryos at 72 hr
(28.2 Æ 0.7 cells per dsGFP embryo; 14.9 Æ 0.2 cells per
dsNop2 embryo) (Fig. 2C).
We also injected a control and six distinct commercial
siRNAs designed against NOP2 (Fig. 2G) in order to
confirm that the observed phenotype is specifically due
Nop2 IS REQUIRED FOR PREIMPLANTATION
Mol. Reprod. Dev. 83:124–131 (2016) 125
3. to the loss of NOP2 function. siRNA controls elicited no
phenotypeÀÀ92% (11/12) of injected zygotes form blasto-
cysts (left most image) (Fig. 2H)ÀÀwhereas none (0/69) of
the Nop2 siRNA-injected embryos formed blastocysts,
regardless of which siRNA was used. Thus, the arrested-
development phenotype can be attributed specifically to the
loss of NOP2 function.
NOP2 Deficiency Results in Apoptosis and
Impaired Lineage Specification
Markers of apoptosis (active tumor protein p53 (TP53))
and lineage specification (POU5F1, for the inner cell mass,
and CDX2, for the trophectoderm) were examined by
immunofluorescence to understand how NOP2 knockdown
related to blastocyst failure. Compared with dsGFP morula
at 72 hr, POU5F1 and CDX2 were greatly decreased
whereas active TP53 was present in many blastomeres
of dsNop2 morula (Fig. 2D). dsGFP embryos formed blas-
tocysts with clear lineage-specific POU5F1/CDX2 localiza-
tion and no detectable active TP53 after 96 hr in culture
(Fig. 2E). dsNop2 embryos, on the other hand, remained
arrested at the morula stage, with no lineage-specific
segregation of POU5F1 or CDX2: POU5F1 was present
at low levels in most blastomeres, and few blastomeres had
detectable CDX2. Apoptotic cells were also more abundant
and many more cells contained apoptotic bodies (Fig. 2E,
arrow). An extra 12 hr of culture (108 hr total) resulted
in even lower POU5F1 and CDX2 protein as well as
severe aggregation of apoptotic bodies in dsNop2 embryos
(Fig. 2F, arrows), indicating the death of blastomere.
NOP2 Deficiency Results in Global Reduction of
RNA
NOP2 plays a role in RNA stability (Hong et al., 1997;
Gustafson et al., 1998; Castello et al., 2012; Blanco and
Frye, 2014), so we assessed global levels of different types
of RNA in control and dsNOP2 embryos. Total RNA was
isolated from identical numbers of dsGFP and dsNop2
morulae (10 each), and then assessed by bioanalyzer.
Electropherograms showed that normal representative
peaks of tRNA/5S/5.8S, 18S, and 28S are clearly visible
in dsGFP control embryos, but were drastically decreased
or entirely absent in dsNop2 embryos (Fig. 3A), suggesting
a global RNA reduction following NOP2 knockdown.
Figure 1. Expression profile of Nop2 during preimplantation development, and efficient knockdown of Nop2 by dsNop2 RNA microinjection.
A: Immunofluorescence analysis of NOP2 protein from the metaphase II (MII) oocyte to the blastocyst stage. Peak accumulation occurs at morula
stage. B and C: Quantitative (B) and reverse-transcription (C) PCR for Nop2 mRNA abundance in wild-type embryos during preimplantation
development. D: Quantitative analysis of Nop2 mRNA degradation following dsNop2 microinjection at the developmental stages examined.
Ã
, P < 0.05. Mean Æ standard error is shown. E: Depletionof NOP2 protein in dsNop2 morula. Oo, MII oocyte; Zy, zygote; Mo, morula; Bl, blastocyst.
Scale bar, 50 mm.
Molecular Reproduction & Development CUI ET AL.
126 Mol. Reprod. Dev. 83:124–131 (2016)
4. Figure 2. Characterization of NOP2-deficient embryos. A: Developmental progression of dsNop2 embryos. Arrows indicate morphological
abnormalities suggestive of degeneration. B and C: Blastocyst formation rate (B) and blastomere cell number (C) in the absence of NOP2.
Ã
, P < 0.05. Mean Æ standard error is shown; ‘‘n’’ indicates the number of embryos examined. DÀF: Immunofluorescence analysis of morula (D)
and blastocysts (E) for the lineage-specific markers POU5F1 and CDX2 and the apoptotic marker activated TP53 in treated embryos at the
expected times (D and E) or after extended culture (F). Cells with apoptotic bodies (arrows) can be found in dsNop2 embryos. G: Schematic of
Nop2 mRNA (orange UTRs and grey CDs), with the target locations for the dsRNA (dark blue) and six distinct commercial siRNAs (red, Ambion;
light blue, Qiagen) used to knockdown NOP2. H: Phenotype of siRNA-injected embryos. Most embryos injected with scrambled siRNA
developed into blastocysts (11/12), whereas none of the embryos injected with one of the Nop2 siRNAs developed into blastocysts (0/69)
(between 11 and 13 embryos were injected with each siRNA). Scale bar, 50 mm.
Nop2 IS REQUIRED FOR PREIMPLANTATION
Mol. Reprod. Dev. 83:124–131 (2016) 127
5. Pyronin Y, a fluorescent RNA dye that binds to both RNA
and DNA, was also used to evaluate global RNA levels in
morula. Consistent with the bioanlyzer data, an obvious
decrease in Pyronin Y signal was observed in dsNop2
embryos compared with dsGFP controls (Fig. 3B).
We also performed quantitative PCR to assess the
changes to several different classes of RNAs, and con-
firmed that rRNA (18S), small nuclear RNA (Rnu6), small
nucleolar RNA (Snord65), and mRNAs (Actb, Gapdh,
Pou5f1, Cdx2, and Bax) were all significantly reduced after
NOP2 knockdown. Conversely, Tp53 abundance was
much higher, which is consistent with the active apoptosis
resulting from the depletion of NOP2.
DISCUSSION
In the present study, we tracked the expression of the
mammalianNop2geneduringpreimplantationdevelopment,
and demonstrated its indispensible role in early embryos.
Nop2 mRNA abundance increases at the 2-cell stage and
peaks at the 8-cell stage (Fig. 1B and C), indicating that
the embryonic source is the zygotic genome rather than
maternal stores from the oocyte. The dynamic decline of
Nop2 mRNA after the 8-cell stage (Fig. 1B and C) suggests
there is a tightly regulated mechanism that restricts its
accumulation at later stages.
NOP2 promotes cell proliferation and ribosome assem-
bly, and high NOP2 expression leads to tumor aggres-
siveness (Perlaky et al., 1992; Saijo et al., 2001; Bantis
et al., 2004). We therefore speculate that the preimplanta-
tion expression pattern of Nop2 is orchestrated with the
dynamics of preimplantation development: For example, its
levels are highest when cleavage is required, but the gene
is silenced when lineage differentiation occurs. Although,
we detected the majority of NOP2 protein around the
nucleolus, a cytoplasmic form was also detectable. Careful
observation of dsNop2 embryos (Fig. 1E) indicates that this
Figure 3. Global RNA reduction in dsNop2 embryos. A and B: Bioanalyzer electropherograms (A) and Pyronin Y staining (B) of RNA after Nop2
knockdown. Scale bar, 50 mm. C: Relative levels of different classes of RNA in injected embryos, representing rRNA (18S), small nuclear RNA
(Rnu6), small nucleolar RNA (Snord65), and mRNAs (Actb, Gapdh, Oct4, Cdx2, Bax). Ã
, P < 0.05. Mean Æ standard error is shown.
Molecular Reproduction & Development CUI ET AL.
128 Mol. Reprod. Dev. 83:124–131 (2016)
6. cytoplasmic signal is not due to non-specific background;
indeed, similar cytoplasmic localization has been reported
in yeast (de Beus et al., 1994), suggesting that NOP2
participates in cytoplasmic events in addition to its reported
role in rRNA synthesis and methylation.
dsRNA-mediated knockdown of NOP2 was used to
define its function during early embryo development
(Fig. 1D and E). dsNop2 embryos do not develop past
the morula stage (Fig. 2A and B), indicating an indispens-
able role for NOP2 during blastocyst development. Blasto-
mere number was significantly reduced in dsNop2 embryos
that reach the morula stage, extending the role for NOP2 in
cell proliferation and cell-cycle progression that has been
reported in yeast (Hong et al., 1997) and human cancer cells
(Saijo et al., 2001; Bantis et al., 2004; Wang et al., 2014) to
mammalian preimplantation embryos. Blastomere number
can limit blastocyst formation (Yamanaka et al., 2006;
Marikawa and Alarcon, 2009), so the fewer blastomeres
surviving in morulae may be one source of the lower blasto-
cyst rates. But dsNOP2 embryos also fail to activate and
properly partition the transcription factors required for inner
cell mass (POU5F1) and trophectoderm (CDX2) differentia-
tion(Figs.2and3).SinceCdx2isessentialfortrophectoderm
formation (Biggers et al., 1988; Watson et al., 1990), we
speculate that failure to specify this lineage is another major
contributor to the dsNop2 failed-blastocyst phenotype.
NOP2 in HeLa cells has also been identified as a RNA-
binding protein that regulates both rRNA (Gustafson et al.,
1998) and mRNA (Castello et al., 2012). We therefore
analyzed global RNA levels, and found a significant reduc-
tion in all RNA types in embryos lacking NOP2 using global
and gene-specific assessments (Fig. 3). The direct con-
sequences of NOP2 loss on global levels of cellular RNAs
are difficult to identify since dsNOP2 embryos are stalled or
dying. Even though dsNOP2 morula appear morphologi-
cally normal, it is possible that its blastomeres are already
severely compromised and thus the global RNA reduction
is not specific to the loss of NOP2. On the other hand, our
results are consistent with a recent study demonstrating
that NOP2 interacts with and stabilizes lncRNA-hPVT1 in
human liver cancers (Wang et al., 2014).
In sum, Nop2 is expressed during mouse preimplanta-
tion, with highest mRNA and protein accumulation at 8-cell
and morula stages, respectively; is essential for blastocyst
formation, as NOP2-deficient embryos arrest at the morula
stage with severe apoptosis and impaired cell-lineage
specification; and plays an important role in RNA process-
ing and/or stability during early embryogenesis, as Nop2
knockdown leads to a global reduction of diverse RNA
species. Thus, NOP2 production in early cleavage stages
is required for blastocyst formation.
MATERIALS AND METHODS
Embryo Recovery and Culture
Use of vertebrate animals for embryo production was
approved by the Institutional Animal Care and Use Com-
mittee of the University of Massachusetts, Amherst.
B6D2F1 female mice 8À10 weeks old were induced to
superovulate with 5 IU pregnant mare serum gonadotropin
(Sigma-Aldrich, St. Louis, MO), followed 48 hr later by 5 IU
human chorionic gonadotropin (hCG) (Sigma-Aldrich, St.
Louis, MO). Superovulated females were mated with
B6D2F1 males, and euthanized at 20 hr post-hCG injection
for zygote collection from the oviducts. Oviductal ampullae
were dissected to release zygotes, and cumulus cells were
removed by pipetting in M2 medium containing hyaluroni-
dase (EMD Millipore, Billerica, MA). Zygotes were then
washed in M2 medium (EMD Millipore, Billerica, MA) and
cultured in KSOM medium (EMD Millipore, Billerica, MA)
at 378C in a humidified atmosphere of 5% CO2/5% O2
balanced with N2.
Preparation of dsRNA
DNA templates for T7 RNA polymerase-mediated
dsRNA production were amplified from genomic DNA or
preimplantation embryo cDNA using primers containing T7
binding sequences followed by gene-specific sequences for
dsGFP (50
-TAATACGACTCACTATAGGGCACATGAAG-
CAGCACGACTT and 50
-TAATACGACTCACTATAGGG-
TGCTCAGGTAGTGGTTGTCG) or dsNop2 (50
-TAATAC-
GACTCACTATAGGGGGAGCATGAGCGGATCTTAG and
50
-TAATACGACTCACTATAGGGTCCACCGTAATGGA-
ACAGGT).
PCR products were purified using a QIAquick PCR
Purification Kit (Qiagen, Hilden, Germany). In vitro tran-
scription was performed using a MEGAscript T7 Kit (Am-
bion, Waltham, MA), followed by the addition of TURBO
RNase-free DNase to degrade the DNA template. dsRNA
was then passed through NucAway Spin Columns (Am-
bion, Waltham, MA) to remove salt and unincorporated
nucleotides. dsRNA was extracted with phenol/chloroform
(Sigma-Aldrich, St. Louis, MO), precipitated with 70% eth-
anol, and resuspended in RNase-free water (Integrated
DNA Technologies, Coralville, IA). The quality of dsRNA
was confirmed by electrophoresis both after in vitro tran-
scription and after final precipitation. The dsRNA concen-
tration was measured using a NanoDrop (Thermo
Scientific, Waltham, MA). Each dsRNA was diluted to
2 mg/ml, and stored at À808C until use.
siRNA Production and Sequences
The sources and sequences of all siRNAs are listed in
Table 1. Five to ten picoliters of 100 mM control or Nop2
siRNA were microinjected into the cytoplasm of zygotes.
Microinjection
Microinjection was performed in M2 medium using a
Nikon inverted microscope equipped with a piezo-driven
(Sutter Instrument, Novato, CA) micromanipulator (Trans-
ferMan NK2, Eppendorf, Hamburg, Germany). A volume of
5À10 pl of dsNop2 (2 mg/ml) or Nop2 siRNA (100 mM)
was microinjected into the cytoplasm of zygotes using a
blunt-ended pipette of 6À7 mm in diameter. The same
Nop2 IS REQUIRED FOR PREIMPLANTATION
Mol. Reprod. Dev. 83:124–131 (2016) 129
7. concentration and volume of dsGFP or scrambled siRNA
was injected as a control in all experiments. After microin-
jection, zygotes were washed with M2 and cultured in
KSOM medium at 378C in a humidified atmosphere of
5% CO2/5% O2 balanced with N2.
RNA Extraction, Reverse Transcription PCR, and
Quantitative PCR
TotalRNAextractionwasperformedwithaHighPureRNA
Isolation Kit (# 11828665001, Roche, Basel, Switzerland).
cDNA was synthesized using an iScript cDNA synthesis kit
(Bio-Rad Laboratories, Hercules, CA, 170-8891). Specific
reverse-transcription primers for Rnu6 and Snord65, accom-
panied with TaqMan probes (Life Technologies, Carlsbad,
CA), were used during cDNA synthesis.
Intron-spanning primers were used for standard
reverse-transcription PCR (Actb: 50
-GGCCCAGAGCAA-
GAGAGGTATCCand50
-ACGCACGATTTCCCTCTCAGC;
Nop2: same as for the preparation of dsNop2 T7 template,
listed above). Quantitative PCR was performed on a
Stratagene MX3005p using TaqMan Gene Expression
Assays (Life Technologies, Carlsbad, CA) and PerfeCTa
qPCR Mix with low ROX (Quanta Biosciences, Gaithers-
burg, MD)-based reactions. Nop2 expression in different
embryo stages was normalized to Gapdh. Quantification
of gene expression differences between control and
NOP2-knockdown groups was achieve using one-
embryo-equivalent of cDNA per reaction since the knock-
down of NOP2 can induce global RNA, including those
encoding housekeeping genes.
All PCR reactions were run with a minimum of three
replicates under the following conditions: 1 cycle of 508C
for 30 sec; 1 cycle of 958C for 2 min; then 40 cycles of 15sec
at 958C and 30sec at 608C. The TaqMan probes used
included: Nop2, Mm00663137_g1; Gapdh, 4352339E;
Actb, 4352341E; Pou5f1, Mm00658129_gH; Cdx2,
Mm01212280_m1; 18S, Hs99999901_s1; Rnu6 (U6 small
nuclear RNA, also named U6 snRNA), TM1973; Snord65
(smallnucleolarRNA65,alsonamedsnoRNA135),TM1230,
Trp53 Mm01731287_m1; and Bax, Mm00432050_m1.
Pyronin Y RNA Staining
Embryos were fixed in 4% paraformaldehyde in phos-
phate-buffered saline (PBS) for 20 min at 258C, washed
three times in PBS containing 0.3% polyvinylpyrrolidone
(PBS/PVP), and stained with 40
,6-diamidino-2-phenylindole
(DAPI). Embryos were then transferred to PBS/PVP con-
taining 5 mM Pyronin Y (Thermo Scientific, Waltham, MA)
for 10 min. Stained embryos were washed three times in
PBS/PVP before mounting and observation by epifluores-
cence illumination on an Eclipse-Ti microscope (Nikon,
Tokyo, Japan).
Immunofluorescence
Embryos were fixed in 4% paraformaldehyde in PBS for
30 min, washed three times in wash buffer (PBS containing
0.1%Triton X-100), and permeabilized with PBS containing
0.5% TritonX-100 for 15 min. Embryos were then blocked
for 1 hr in blocking buffer (PBS containing 10% fetal calf
serum and 0.1%Triton X-100), and then incubated over-
night at 48C with primary antibodies diluted in blocking
buffer. After three rinses with wash buffer, embryos were
incubated for 1 hr with secondary antibodies (Alexa Fluor,
Life Technologies, Carlsbad, CA) diluted 1:600 in blocking
buffer. DAPI was used to stain nuclear DNA for blastomere
counting. Embryos were washed three times with wash
buffer, and then mounted and observed with the Eclipse-Ti
microscope (Nikon, Tokyo, Japan). Identical image-
capture settings were maintained for imaging all embryos.
Negative-control embryos were processed without primary
antibodies, but with secondary antibodies.
The primary antibodies used included: rabbit anti-NOP2
(sc-292098, 1:100 dilution; Santa Cruz Biotechnology,
Dallas, TX); goat anti-POU5F1/OCT4 (sc-8628, 1:200 di-
lution; Santa Cruz Biotechnology, Dallas, TX); mouse anti-
CDX2 (AM392-5M, 1:200 dilution; BioGenex, Fremont,
CA); and rabbit anti-TP53 (#9284, 1:100 dilution; Cell
Signaling Technology, Danvers, MA).
Statistical Analysis
All experiments were repeated at least three times.
Student’s t-test was used to evaluate the difference be-
tween groups, and a value of P < 0.05 was considered
statistically significant. Data are expressed as mean Æ
standard error of the mean.
ACKNOWLEDGMENTS
This work was supported in part by March of Dimes
Research Grant #6-FY11-367 and NIH 1R21HD078942-01
to J Mager.
TABLE 1. siRNA Sequences
Name Sequence Target location Source Catalog number
Scrambled 50
-CAGGGTATCGACGATTACAAA n/a Qiagen 1027280
Nop2 siRNA1 50
-GGACAGTGATGAAGATATG 460:478 Ambion 88181
Nop2 siRNA2 50
-CGAGTGGGTGGTAGACTAT 1627:1645 Ambion 173114
Nop2 siRNA3 50
-GGCTTGTCCACTGAACCTT 2027:2045 Ambion 173115
Nop2 siRNA4 50
-CAGGAGCATGAGCGGATCTTA 1202:1222 Qiagen SI01328978
Nop2 siRNA5 50
-AAGACGAACAAGGATGAGAAA 1481:1501 Qiagen SI01328992
Nop2 siRNA6 50
-AAGGAGGAAATCAATGACAAA 2437:2457 Qiagen SI01328971
Molecular Reproduction & Development CUI ET AL.
130 Mol. Reprod. Dev. 83:124–131 (2016)
8. REFERENCES
Bantis A, Giannopoulos A, Gonidi M, Liossi A, Aggelonidou E,
Petrakakou E, Athanassiades P, Athanassiadou P. 2004. Ex-
pression of p120, Ki-67 and PCNA as proliferation biomarkers
in imprint smears of prostate carcinoma and their prognostic
value. Cytopathology 15:25À31.
Biggers JD, Bell JE, Benos DJ. 1988. Mammalian blastocyst:
Transport functions in a developing epithelium. Am J Physiol
255:C419ÀC432.
Blanco S, Frye M. 2014. Role of RNA methyltransferases in tissue
renewal and pathology. Curr Opin Cell Biol 31:1À7.
Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM,
Strein C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM,
Krijgsveld J, Hentze MW. 2012. Insights into RNA biology
from an atlas of mammalian mRNA-binding proteins. Cell
149:1393À1406.
Cockburn K, Rossant J. 2010. Making the blastocyst: Lessons
from the mouse. J Clin Invest 120:995À1003.
de Beus E, Brockenbrough JS, Hong B, Aris JP. 1994. Yeast
NOP2 encodes an essential nucleolar protein with homology to
a human proliferation marker. J Cell Biol 127:1799À1813.
Fleming TP, Sheth B, Fesenko I. 2001. Cell adhesion in the
preimplantation mammalian embryo and its role in trophecto-
derm differentiation and blastocyst morphogenesis. Front Biosci
6:D1000ÀD1007.
Gustafson WC, Taylor CW, Valdez BC, Henning D, Phippard A,
Ren Y, Busch H, Durban E. 1998. Nucleolar protein p120
contains an arginine-rich domain that binds to ribosomal
RNA. Biochem J 331:387À393.
Hong B, Brockenbrough JS, Wu P, Aris JP. 1997. Nop2p is
required for pre-rRNA processing and 60S ribosome subunit
synthesis in yeast. Mol Cell Biol 17:378À388.
Kosi N, Alic I, Kolacevic M, Vrsaljko N, Jovanov Milosevic N, Sobol
M, Philimonenko A, Hozak P, Gajovic S, Pochet R, Mitrecic D.
2015. Nop2 is expressed during proliferation of neural stem
cells and in adult mouse and human brain. Brain Res 1597:
65À76.
Latham KE, Solter D, Schultz RM. 1991. Activation of a two-cell
stage-specific gene following transfer of heterologous nuclei
into enucleated mouse embryos. Mol Reprod Dev 30:182À186.
Marcho C, Cui W, Mager J. 2015. Epigenetic dynamics during
preimplantation development. Reproduction 150:R109À
R120.
Marikawa Y, Alarcon VB. 2009. Establishment of trophectoderm
and inner cell mass lineages in the mouse embryo. Mol Reprod
Dev 76:1019À1032.
Maserati M, Walentuk M, Dai X, Holston O, Adams D, Mager J.
2011. Wdr74 is required for blastocyst formation in the mouse.
PLoS ONE 6:e22516.
Mitrecic D, Malnar T, Gajovic S. 2008. Nucleolar protein 1 (Nol1)
expression in the mouse brain. Coll Antropol 32:123À126.
Perlaky L, Valdez BC, Busch RK, Larson RG, Jhiang SM, Zhang
WW, Brattain M, Busch H. 1992. Increased growth of NIH/3T3
cells by transfection with human p120 complementary DNA
and inhibition by a p120 antisense construct. Cancer Res
52:428À436.
Saijo Y, Sato G, Usui K, Sato M, Sagawa M, Kondo T, Minami Y,
Nukiwa T. 2001. Expression of nucleolar protein p120 predicts
poor prognosis in patients with stage I lung adenocarcinoma.
Ann Oncol 12:1121À1125.
Schultz RM. 2002. The molecular foundations of the maternal to
zygotic transition in the preimplantation embryo. Hum Reprod
Update 8:323À331.
Stein P, Zeng F, Pan H, Schultz RM. 2005. Absence of non-
specific effects of RNA interference triggered by long double-
stranded RNA in mouse oocytes. Dev Biol 286:464À471.
Svoboda P, Stein P, Hayashi H, Schultz RM. 2000. Selective
reduction of dormant maternal mRNAs in mouse oocytes by
RNA interference. Development 127:4147À4156.
Wang F, Yuan JH, Wang SB, Yang F, Yuan SX, Ye C, Yang N,
Zhou WP, Li WL, Li W, Sun SH. 2014. Oncofetal long noncoding
RNA PVT1 promotes proliferation and stem cell-like property of
hepatocellular carcinoma cells by stabilizing NOP2. Hepatology
60:1278À1290.
Watson AJ, Damsky CH, Kidder GM. 1990. Differentiation of an
epithelium: Factors affecting the polarized distribution of Naþ,
K(þ)-ATPase in mouse trophectoderm. Dev Biol 141:104À114.
Wianny F, Zernicka-Goetz M. 2000. Specific interference with
gene function by double-stranded RNA in early mouse devel-
opment. Nat Cell Biol 2:70À75.
Yamanaka Y, Ralston A, Stephenson RO, Rossant J. 2006. Cell
and molecular regulation of the mouse blastocyst. Dev Dyn
235:2301À2314.
Zeng F, Baldwin DA, Schultz RM. 2004. Transcript profiling during
preimplantation mouse development. Dev Biol 272:483À496.
Zhang K, Dai X, Wallingford MC, Mager J. 2013a. Depletion of
Suds3 reveals an essential role in early lineage specification.
Dev Biol 373:359À372.
Zhang K, Haversat JM, Mager J. 2013b. CTR9/PAF1c regulates
molecular lineage identity, histone H3K36 trimethylation and
genomic imprinting during preimplantation development. Dev
Biol 383:15À27.
Nop2 IS REQUIRED FOR PREIMPLANTATION
Mol. Reprod. Dev. 83:124–131 (2016) 131