Medical Virology Final PPTDefinition and properties of a virus Viruses are filterable agents

Medical Virology
For under-graduate MLS students
 Course Code: MeLS-3163 (ECTS Credit: 5)
 Pre-requisite: None
Prepared by:
 Hadush Negash (MSc., Medical Microbiology and Immunology)
1
4/10/2024 Hadush Negash (MSc., Microbiologist)

Introduction to Medical Virology
1.1 Definition and properties of a virus
• Viruses are filterable agents
• Viruses are the smallest infectious agents
• Size: 20 - 400 nm in diameter)
• Are obligate intracellular
• Cannot make energy or proteins independent of a host cell
• Viral genomes may be RNA or DNA , but not both
• Viral components are assembled & do not replicate by division
2

1.2 Evolutionary origin of viruses
• How did these become independent genetic entities?
►Not clearly well elucidated, however three hypothesis:
A. Regressive theory
• Viruses are degenerate forms of intracellular parasites
• E.g. Leprosy bacillus, rickettsia & chlamydia have all evolved in this direction
• Lack their own rRNAs or protein synthesis machinery.
• Controversy on how RNA virus evolved???
3

B. Progressive theory
• From cellular RNA and DNA components
• Normal cellular nucleic acids that gained the ability to replicate autonomously &
hence to evolve
• DNA viruses came from plasmids or transposable elements
►They then evolved coat proteins & transmissibility
• Retroviruses derived from retro-transposons & RNA virus from mRNA
4

C. Co - evolution theory
• Viruses coevolved with life (free living cells)
• All of the above theories could be could be correct!
• No compelling reason to think that RNA viruses have evolved in the same way as DNA
viruses.
5

1.2 Definitions of terminologies
• Capsid: Protein coat that enclose the NA genome
• Nucleocapsid: Capsid plus NA
• Structural units: Basic protein building blocks of the coat
• Capsomers:
 Are viral morphological units
 Seen in electron microscope on the surface of Icosahedral viral particles.
Represent clusters of polypeptides
 Their number vary from one virus group to the other
6

• Envelope
 Lipid containing membrane that surrounds some viral particles
 Acquired during viral maturation by a budding process
 Virus encoded glycoprotein are exposed on the surface of the envelop
• Virion
 Complete and infective viral particle
• Defective virus: Viral particle functionally deficient in some aspects of replication E.g. HDV
requires helps from HBV
• Prions are abnormal infectious protein molecules that can spread & change the structure of
their normal counterparts (cellular proteins) →transmissibility
7

1.3 Structure of medically important viruses
A. Enveloped viruses comprise: Capsomers, envelope, nucleocapsid (NA plus
capsid)
B. Naked capsid viruses comprise: Capsomers & nucleocapsid
8
Basic virus structure

9
Fig 2. components of complete virus particle : A) Enveloped virus
with icosahedral symmetry. B) Virus with helical symmetry.
Basic virus structure

Fig. Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005
Structures compared
10

Capsid Symmetry: 3 types
1. Helical capsid: Capsomers and NA wined to form spiral like structure. E.g.:
Tobacco mosaic viruses
2. Icosahedral capsid: Regular polygon with 20 equilateral triangular faces and 12
vertices. E.g.: Adenoviruses and Herpes viruses
3. Complex capsid: A combination of helical and icosahedral shapes. E.g.:
Bacteriophages and pox viruses
11

Symmetry of virus
4/10/2024 Hadush Negash (MSc., Microbiologist) 12

Properties of naked capsid viruses
13
Properties of enveloped viruses

Classification of viruses
A. Type of Nucleic Acid
 DNA or RNA (Ss /Ds)
 Strategy of replication
B. Size & morphology
 Type of symmetry (Icosahedral, Helical, Complex )
 Number of capsomers or presence or absence of envelope
C. Presence of specific enzymes
E.g: - RNA and DNA polymerase
- Neuraminidase or reverse transcriptase
14

D. Host tissue or cell tropism
E.g.: Hepatitis viruses, HIV
E. Mode of transmission e.g. Arboviruses
F. Host range E.g. Animal, bacteria, plant
G. Type of disease E.g. encephalitis
15

HERPESVIRIDAE
HEPADNAVIRIDAE
ENVELOPED
PAPILLOMAVIRIDAE
POLYOMAVIRIDAE
(formerly grouped together as the
PAPOVAVIRIDAE)
CIRCULAR
ADENOVIRIDAE
LINEAR
NON-ENVELOPED
DOUBLE STRANDED
PARVOVIRIDAE
SINGLE STRANDED
NON-ENVELOPED
POXVIRIDAE
COMPLEX ds
ENVELOPED
DNA VIRUSES
All families shown are
icosahedral except for
poxviruses
16

FLAVIVIRIDAE
TOGAVIRIDAE
RETROVIRIDAE
ICOSAHEDRAL
CORONAVIRIDAE
HELICAL
ENVELOPED
ICOSAHEDRAL
PICORNAVIRIDAE
CALICIVIRIDAE
NONENVELOPED
SINGLE STRANDED +
sense
BUNYAVIRIDAE
ARENAVIRIDAE
ORTHOMYXOVIRIDAE
PARAMYXOVIRIDAE
RHABDOVIRIDAE
FILOVIRIDAE
SINGLE STRANDED
negative sense
REOVIRIDAE
DOUBLE STRANDED
RNA VIRUSES
ENVELOPED
HELICAL
ICOSAHEDRAL
NONENVELOPED
17

Positive & negative sense RNA
 Positive sense RNA can be translated directly into protein upon uncoating of the
virion in the cell
 Negative sense RNA must be transcribed by a virus coded, virion packaged RNA
dependent RNA polymerase immediately following uncoating
18
M K A K L L V L L C A L A A T D A D T I F1
* R Q N Y W S C Y V H L Q L Q M Q T Q Y F2
E G K T T G P V M C T C S Y R C R H N M F3
5’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata 3’
----:----|----:----|----:----|----:----|----:----|----:----|
3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 5’
X F A F S S T R N H A S A A V S A S V I F6
X S P L V V P G T I H V Q L * L H L C L F5
H L C F * Q D Q * T C K C S C I C V C Y F4
+
-

Classification of Human Viruses
"Group" Family Genome Genome size (kb) Capsid Envelope
dsDNA
Poxviridae dsDNA, linear 130 to 375 Ovoid Yes
Herpesviridae dsDNA, linear 125 to 240 Icosahedral Yes
Adenoviridae dsDNA, linear 26 to 45 Icosahedral No
Polyomaviridae dsDNA, circular 5 Icosahedral No
Papillomaviridae dsDNA, circular 7 to 8 Icosahedral No
ssDNA
Anellovirus ssDNA circular 3 to 4 Isometric No
Parvoviradae ssDNA, linear, (- or +/-) 5 Icosahedral No
Retro
Hepadnaviridae dsDNA (partial), circular 3 to 4 Icosahedral Yes
Retroviridae ssRNA (+), diploid 7 to 13 Spherical, rod or cone shaped Yes
dsRNA
Reoviridae dsRNA, segmented 19 to 32 Icosahedral No
ssRNA (-)
Rhabdoviridae ssRNA (-) 11 to 15 Helical Yes
Filoviridae ssRNA (-) 19 Helical Yes
Paramyxoviridae ssRNA (-) 10 to 15 Helical Yes
Orthomyxoviridae ssRNA (-), segmented 10 to 13.6 Helical Yes
Bunyaviridae ssRNA (-, ambi), segmented 11 to 19 Helical Yes
Arenaviridae ssRNA (-, ambi), segmented 11 Circular, nucleosomal Yes
Deltavirus ssRNA (-) circular 2 Spherical Yes
ssRNA (+)
Picornaviridae ssRNA (+) 7 to 9 Icosahedral No
Calciviridae ssRNA (+) 7 to 8 Icosahedral No
Hepevirus ssRNA (+) 7 Icosahedral No
Astroviridae ssRNA (+) 6 to 7 Isometric No
Coronaviridae ssRNA (+) 28 to 31 Helical Yes
Flaviviridae ssRNA (+) 10 to 12 Spherical Yes
Togaviridae ssRNA (+) 11 to 12 Icosahedral Yes
19

Baltimore Classification
• The Baltimore scheme of classification distinguishes between viruses whose
genomes can be utilized directly as mRNA (positive stranded RNA viruses) vs
those that require a virion-associated “transcriptase” to produce mRNAs
(negative stranded RNA and dsRNA viruses)
• Positive-sense RNA viruses vs other RNA viruses
• All RNA viruses must encode their own polymerase because cells do not have
RNA-dependent RNA polymerase activity
20

Baltimore Classification of animal virus

Major diseases caused by human viruses
"Group" Family Human pathogens (disease)
dsDNA
Poxviridae Variola (smallpox); Orf (pustular dermatitis); Molluscum contagiosum (pustular dermatitis)
Herpesviridae Herpes simplex 1,2 (oral, genital herpes); Varicella-zoster (chickenpox); Epstein-Barr (mononucleosis);
Cytomegalovirus (neonatal abnormalities); HHV6 (roseola); HHV8 (Kaposi's sarcoma)
Adenoviridae Adenovirus (respiratory infection, conjunctivitis)
Polyomaviridae Polyomavirus (benign kidney infection, respiratory disease, leukoencephalopathy)
Papillomaviridae Papillomavirus (warts, genital carcinoma)
ssDNA
Anellovirus Unknown
Parvoviradae B-19 (fifth disease, fetal death)
Retro
Hepadnaviridae Hepatitis B ("serum" hepatitis)
Retroviridae HIV (aids); HTLV (leukemia)
dsRNA
Reoviridae Rotavirus (infantile gastroenteritis)
ssRNA (-)
Rhabdoviridae Rabies virus (rabies)
Filoviridae Ebola virus (ebola)
Paramyxoviridae Parainfluenza virus (respiratory infection); Mumps virus (mumps);
Respiratory syncytial virus (respiratory infection); Measles virus (measles)
Orthomyxoviridae Influenza virus (influenza)
Bunyaviridae Hantaan virus (hemorrhagic fever with renal syndrome)
Arenaviridae Lassa fever virus (hemorrhagic fever)
Deltavirus Hepatitis D (fulminant acute hepatitis)
ssRNA (+)
Picornaviridae Poliovirus (polio), rhinovirus (URI), Hepatitis A ("infectious" hepatitis)
Calciviridae Norwalk (gastroenteritis)
Hepevirus Hepatitis E (acute hepatitis)
Astroviridae Astrovirus (gastroenteritis)
Coronaviridae Coronavirus (respiratory infection)
Flaviviridae Yellow fever virus (yellow fever); Hepatitis C (hepatitis)
Togaviridae Eastern Equine encephalitis virus (encephalitis); Rubella virus (rubella) 22

Virus infectious cycle (Replications)
1. Adsorption or attachment
• Reactive viral sites interact with specific receptors on susceptible host cells
• Receptors on the virus capsid or envelope irreversibly binds to cellular receptors
on the cell member
► Limit the host spp. & cells infected
2. Penetration
• The coat of enveloped viruses fuse with host cell membrane & release the virus
nucleocapsid into host cytoplasm
• Other viruses enter into cell by endocytosis
23

24
3.Uncoating
• Viral capsid is broken by viral or cellular enzyme;
• Viral NA is released; Viral NA transported to within the host cell
► Transcribed to form new progeny virions
4. Biosynthesis or genomic activation
• m-RNA transcribes from viral DNA or; formed directly from some RNA viruses &
codes for viral proteins such as:
 Capsid / Envelope: - Encode structural proteins
- Are building blocks of virion

25
 Enzymes encode for:
- DNA / RNA polymerase
- Other replication enzymes
NB: Except Poxviruses, DNA viruses replicate in the nucleus; RNA viruses
mainly in cytoplasm
5. Assembly
A) Nucleus: E.g: Herpes virus, Adeno virus & others
B) Cytoplasm: E.g: Poliovirus
C) At the cell surface E.g: Influenza virus

26
N.B: Accumulation of virions at sites of assembly may form inclusion bodies
► Visible in stained cells with light microscope
6. Release
• Release of new intact infectious virions
• May occur by:
 Budding E.g: Enveloped viruses
 Lysis of infected host cells/ tissues

ANTIVIRAL CHEMOTHERAPY
• Many viruses encode activities (virulence factors) that promote the efficiency of
viral replication, viral transmission, the access and binding of the virus to target
tissue, or escape of the virus from host defense and immune resolution
• Loss of virulence factors results in attenuation of the virus
• Viruses also encode enzymes that are not present in un-infected cell.
• These enzymes are critical to viral replication but unnecessary for cellular function.
It is now possible to find specific inhibitors for viral growth.

The greatest success in antiviral chemotherapy has been achieved by using:
• Inhibitors of NA synthesis.
• The stages of attachment of virus to host cell
• Stage of uncoating of the viral genome
• Reverse transcription of certain viral genomes
• Regulation of viral transcription
• Translation of viral proteins
• Assembly
• Maturation and release of progeny virus

31
Antiviral agents and their targets

Viral vaccines
Purpose of viral vaccines is to utilize immune response of the host to prevent viral
disease
Several remarkably effective
• Small pox eradicated
• Reducing annual incidence several viral diseases
32

How Do Vaccines Work?
• Stimulates adaptive immune response
 Natural infection prevents reoccurrence of disease
 Humoral & Cellular responses
• Vaccines prevent or modify disease. Most do NOT prevent infection.
• Herd immunity reduces spread of disease.
 Disease agents require a certain level of transmission to be maintained
33

Requirements of a Vaccine
To be effective a vaccine should be capable of eliciting the following ;-
• Activation of APCs to initiate antigen processing and producing interleukins.
• Activation of both T and B cells to give a high a high yield of memory cells.
• Generation of TH and Tc cells to several epitopes, to overcome the variation in the
immune response in the population due to MHC polymorphism.
• Persistence of antigen, probably on dendritic follicular cells in lymphoid tissue, where
B memory cells are recruited to form antibody-secreting cells that will continue to
produce antibody.
34

Types of viral Vaccines
 Live whole virus vaccines
 Killed whole virus vaccines
 Subunit vaccines;- purified or recombinant viral antigen
 Recombinant virus vaccines
 Anti-idiotype antibodies
 DNA vaccines
35

Hadush Negash (MSc., Microbiologist)
Live attenuated vaccines
Virus alive and fully immunogenic but no virulence, Utilizes virus mutants
restricted in some steps in pathogenesis of disease
Live reduction in virulence by
- Administration of pathogenic or partially attenuated virus by unusual route,
- Passage of the virus in unnatural host or host cell.
17D strain of yellow fever was developed by passage in mice and then
in chick embryo.
 Polio viruses were passed in monkey kidney cells
Measles in chick embryo fibroblasts. 36
4/10/2024

Live Vaccines
• Attenuated strains
1. Use of a related virus from another animal
2. Administration of pathogenic or partially attenuated virus by an unnatural route
3. Passage of the virus in an "unnatural host" or host cell development of
temperature sensitive mutants (used in conjunction with the above
mentioned methods)
37
4/10/2024

Advantages
– Stimulates a broad immune response
• Neutralizing antibody
• Secretory IgA for mucosal tissues.
• Cell mediated immunity (CTL)
– All antigens are expressed
– Production costs are lower
Disadvantages
• Potential for genetic instability
• Risk of reversion to greater
virulence in host
– Potential for contamination
– Infection can persist or be more
severe in the immuno-
compromised
38

Inactivated whole virus vaccines
• Easiest preparations to use
• Simply inactivated
• The outer virion coat should be left intact but the replicative function should be
destroyed
• must contain much more antigen than live vaccines
• Extreme care no residual live virulent virus
• Inactivation by heat or chemicals like formaldehyde or beta- propiolactone
Caution: Excessive treatment can destroy immunogenicity whereas insufficient
treatment can leave infectious virus capable of causing disease.
39

Live vs dead vaccines
Feature Live Dead
 Dose low high
 No of doses single multiple
 Need for adjuvant no yes
 Duration of immunity many years less
 antibody response IgG IgA, IgG
 CMI good poor
 Reversion to virulence possible not possible
40

Virus host interaction & viral pathogenesis
Effects of viral infection on host cell
• On entry in to the body:
 The virus may replicate and remain at the primary site
 May disseminate to other tissues via the blood stream or the mononuclear
phagocyte and lymphatic system or through neurons.
• The blood stream and the lymphatic system are the predominant means of viral
transfer in the body.

• The transport of virus in the blood is termed viremia.
• The virus may be either free in the plasma or may be cell associated in lymphocytes
or macrophages.
• Replication of a virus in macrophages, the endothelial lining of blood vessels,
or the liver can cause the infection to be amplified and initiate the development of
secondary viremia.
• In many cases, a secondary viremia precedes delivery of the virus to the target
tissue (e.g. liver, brain, skin)
42

Determinants of viral disease
A. Nature of the disease and target tissue
 Portal of entry of virus
 Access of virus to target tissue
 Tissue tropism of viruses
 Permissiveness of cells for viral replication
 Viral pathogen (strain)

B. Severity of disease
• Immune status
• Competence of the immune system & prior immunity to the virus
• Immune pathology
• Virus inoculum size
• Length of time before resolution of infection
• General health of the person
• Nutrition & other disease influencing immune status
• Genetic make up of the person & age

C. Interaction of virus with target tissue
• Access of virus to target tissue
• Stability of virus in the body (temperature, acid and bile of the GIT)
• Ability to cross skin/mucous epithelial cells (cross the GIT in to the blood stream)
• Ability to establish viremia
• Ability to spread through the RES
• Target tissue
 Specificity of viral attachment proteins.
 Tissue –specific expression of receptors

D. Cytopathologic activity of the virus
• Efficiency of viral replication in the cell
 Optimum temperature for replication
 Permissiveness of cell for replication
• Cytotoxic viral proteins
• Inhibition of cell’s macromolecular synthesis
• Accumulation of viral proteins and structures (inclusion bodies)
• Altered cell metabolism (e.g. cell immortalization)

E. Host protective responses
• Antigen-non specific antiviral responses
 Interferon
 Natural killer cells and macrophages
• Antigen-specific immune responses
 T- Cell response
 Antibody Responses
• Viral mechanisms of escape of immune responses

Viral pathogenesis
Cytopathogenesis
Three potential outcomes from a viral infection of a cell:
 Abortive infection (failed infection)
 Lytic infection (cell death)
 Persistent infection (infection without cell death)
Persistent infection include:
• Chronic (Non-Lytic or productive) infection
• Latent (Limited viral macromolecular but no virus synthesis)infections
• Recurrent infections
• Transforming(Immortalizing)infections
48

Host cell permissiveness to virus
• Non-permissive cell: not allow replication of a particular type or strain of virus
• Permissive cell: cell provides the biosynthetic machinery to support complete
replicative cycle of virus
• Semi-permissive cell: cell may be very inefficient or support some but not all
steps of virus replications
49

Effect of virus on host cells
A. Direct and indirect damage
• Shut down host macromolecules synthesis & directly damage host cells
• Some indirectly affect the function of tissues or organs in the host. e.g. the
influenza virus damages the respiratory epithelium and ciliary’s activity is
severely affected.
B. Inclusion body formation: Accumulations of nucleic acids, proteins, and so on,
can be stained and are referred to as inclusion bodies.
E.g.: Negri bodies- rabies virus, owl’s eye-Cytomegalovirus and cowdry type A-
Herpes simplex virus

C. Cell fusion (syncytia formation)
• Enveloped viruses release specific proteins that become incorporated in to
cytoplasmic membrane of the infected cell. These proteins act as magnets on the
infected cell and attract uninfected cells to their surface. This results in infection of
the originally un infected cell.
• Repetition of this process results in the aggregation of several infected cells. These
aggregated cells eventually fuse, producing a giant multinucleated cell or syncytium
D. Changes in the surface antigens
• Viruses insert antigens in to the cell membrane of infected cells.
• These antigens make the cell a target to immunological destruction by virus –
specific antibodies

Host defense against Viral infection
Non-specific Immune defense
• Provide a local rapid response
• Activate the specific immune defense
 Body temperature and Fever: Limit replication & destabilized some virus
 Mononuclear phagocytic system: phgocytized viral & cell debris from virus infected
cells filter many virus from the blood
Macrophage-present antigen to T-cells
 NK-cells kill virus infected cells
52

Interferon
 the body firs active defense
 Interfere replication
 Initiate an anti-viral state in cells
 Block viral protein synthesis
 Inhibit cell growth
 Interferon alpha and beta activate NK cells
 Interferon alpha and gamma activate macrophage
 Increase MCH antigen expression
 Regulate activities of T cells
53

Specific host defense
Antibody mediated
Neutralize extra cellular virus
 Block viral attachment proteins
 Destabilizes viral structure
 opsonizes viruses for phagocytosis
 promote killing of target cells by the complement &ADDC
• Antibody resolves viral infections: Antibody blocks viremic spread to target tissue
Cell mediated
 Essential for controlling enveloped &non cytolytic infection
 Recognizes viral peptides presented by MCH molecules on cell surfaces
 CTLs (CD8) kills virus infected cells & as result eliminate the source of new
virus
 It respond to viral peptide-class I MCH protein complex
 CD4 (TH cells) important for the maturation of antibody response
 Respond to viral peptide-class II MCH protein complex
54

Epidemiology of viruses
• Infection of a population is similar to infection of a person, in that the virus must
spread through the population and is controlled by immunization of the population.
To endure (survive), viruses must continue to infect new, immunologically naïve,
susceptible hosts.

4.1. Exposure
• People are exposed to viruses through out their lives.
• Some situations, vocations, lifestyles, and living arrangement increase the likelihood that a person
will come in contact with certain viruses.
• Many viruses are ubiquitous (found every where), as borne out by the fact that evidence of exposure
(antibodies to the virus) can be detected in most young children (HSV –1, HHV6, varicella – zoster
virus, parvovirus B19) or early adult hood (EBV and respiratory and enteric viruses).
• Poor hygiene and crowded living, school, and job conditions promote exposure to respiratory and
enteric viruses.
• Day care centers are consistent sources of viral infections, especially viruses spread by the
respiratory and fecal-oral routes.

• Vector-borne: E.g.: Arbo-viruses and other zoonoses.
• Sexual contact
• Health care workers are frequently exposed to respiratory and other viruses from
contaminated blood (HBV, HIV) or vesicle fluid (HSV).
4.2. Transmission of viruses
• Depends on the source of the virus (site of viral replication and secretion) and
the ability of the environment and the body
• Naked viruses can withstand drying, effect of detergents, and extremes of PH and
temperature to be transmitted by the respiratory, fecal-oral routes and through
contaminated objects.

• Unlike naked viruses, enveloped viruses are comparatively fragile. They require an
intact envelope for infectivity. These viruses must remain wet and are spread
through:
 Respiratory droplets, blood, mucus, saliva, or semen.
 Injection
 Organ transplantation
 Animal reservoir and vectors
• Arthropods, including mosquitoes, ticks, and sand f lies can act as vectors for toga
viruses, flavi-viruses, bunya viruses, and reo-viruses. These viruses are often
referred to as arbo-viruses because they are arthropod born.

• Age
• The geographic distribution
• Seasonal difference
• Out breaks of a viral infection often results from the introduction of a virus (such as
hepatitis A) in to a new location.
• The out breaks originate from a common source (e.g. food preparation)
• Pandemics are worldwide epidemics (example, HIV).
• The spread of a virus can be controlled by quarantine, good hygiene, changes in
lifestyle, vector control, or immunization.

Chapter II
Specimen collection & handling for
virological examination

Specimen collection & handling for virological examination
• Culture swabs and tissues must be kept moist in Viral Transport medium.
• Body fluids and wash specimens for viral culture should be transported in sterile
containers, without dilution in transport media.
• An increase in antibody titer suggests recent infection

Serologies requiring paired sera are as follows:
• Mumps titer
• Measles titer
• VZV titer
• Syndrome viruses
• Pericarditis/CNS syndrome viruses
• CSF for antibody determinations MUST be paired with a concurrent serum
specimen. PCR sampling for CNS infections over antibody determinations is
recommend

• Single sera are appropriate for a sero-status screen or to determine evidence of
past immunization for:
- CMV - VZV
- Hepatitis A, B, C - Mumps
- HIV-1& 2 - Rubella
- HSV 1&2 - Measles

Culture Swabs
• Dacron or cotton swabs are recommended for viral cultures
• Calcium alginate (“calgi-swabs”) are inhibitory to HSV and should NOT be used
for viral culture collection
Re: inhibit growth of the organism
Transport Media
• Viral Transport Media (VTM), C. trachomatis culture medium (CTM, M4 or M5), C.
pneumoniae culture medium (CPM), & C. trachomatis Aptima Combo 2 medium
• Viral & culture transport media contain different antibiotics and can’t be
interchanged

• VTM, CTM and CPM are stored at -20°C & must be thawed before use
• M4 and M5 media are stored at refrigeration temperature
• The shelf life of VTM is one year at -20°C & six months at +4°C
• C trachomatis Transport Media has a shelf life of six months at -20°C and two
months at +4°C
• C pneumoniae Transport Media has a shelf life of 1 year at -20°C and two months
at +4°C

Specimen Collection
Viral isolation (culture):
• Many viral agents are fastidious and can not be isolated in standard tissue culture
• Example: HHV6, HHV7, HHV8 & parvovirus need to be identified by molecular
techniques
• Should be obtained as early as possible after onset of illness
• Appropriate specimens for culture vary according to syndrome and suspected
agents

• Swabbing the sites with sterile swab and immediately immersing the swab into
thawed transport media
1. Urine
• Collect the first 20-30 mL of the urine
• Recommended that urine be collected at least 1 hour after last urination
• Transport specimen in leak proof polypropylene
2. Bone marrow
• Collect specimen in a heparinized syringe or transfer into a heparinized blood
tube

3. Buffy coat culture
• Draw blood into 10 mL EDTA or heparinized tube
• Cultures should be stored & transported at room temperature
4. Cervix specimen
• Clean off vaginal secretions and debris from the cervix
• For Viral cultures, swab the exocervix and endocervix
• Cut or snap off the swab into the transport media vial
• Cyto-brushes are recommended for collection of endocervical Chlamydia cultures
from non-pregnant females

5. Eyes, conjunctival swabs
• Both eyes should be sampled
• Apply traction to the lower eyelid to pull the mucosa away from the globe
• For infant, a piece of tissue paper on the lid will provide better traction:
Hold the swab vertically
Press the swab to the lower conjunctival sac
Vigorously rub the mucosal surface of the lower palpebral conjunctiva with the swab.
If Chlamydia is present, slight bleeding may occur
Cut swabs off into the transport media

6. Fluid specimen
• Fluid specimens should be collected into sterile containers
• For CSF’s, accept a minimum volume of 1 mL for viral culture
• For body fluids, collect a minimum of 5 mL for viral culture
7. Lesion swab
• Open vesicular-pustular lesions and vigorously rub the base to dislodge infected
cells
• Break off the swab into the transport media vial

8. Nasal wash
• Place a mucous trap “in line” in the suction tubing and rapidly instill sterile saline into
the nare
• Squeeze the solution and mucous back into a sterile leak-proof container
N.B: Do not use Viral Transport Media (which contains penicillin)
9. Nasopharyngeal swab and throat swab
• Insert the swab through the nostril into the posterior nasopharynx/throat
• Rotate the swab when removing it and cut swab off into the transport media
• Nasopharyngeal swabs can be pooled in the same transport media vial with a throat
swab

10. Rectal swab
• Gently insert swab into rectum
• Swab and gently rotate it
within the rectum
• Break off the swab into Viral
Transport Medium

Diagnostic Methods in Virology
1. Direct Examination
2. Indirect Examination (Virus Isolation)
3. Serology
Direct Examination of Specimen
1. Electron Microscopy morphology / immune electron microscopy
2. Light microscopy histological appearance - e.g. inclusion bodies
3. Antigen detection immunofluorescence, ELISA etc.
4. Molecular techniques for the direct detection of viral genomes (PCR)
75

Indirect Examination
1 Cell Culture
2 Interference, immunofluorescence etc.
2 Eggs pocks on CAM
3 Animals disease or death confirmation by neutralization
4 Serology
76

Electron Microscopy
106 virus particles per ml required for visualization, 50,000 - 60,000 magnification
normally used. Viruses may be detected in the following specimens.
Faeces: Rotavirus, Adenovirus, Norwalk like viruses, Astrovirus, Calicivirus
Vesicle Fluid: HSV,VZV
Skin scrapings: Papillomavirus, orf, Molluscum contagiosum
77

Problems with Electron Microscopy
• Expensive equipment
• Expensive maintenance
• Require experienced observer
• Sensitivity often low
• Requires at least 105 to 106/ ml particles in preparation
78

Immune Electron Microscopy
• Enhances sensitivity and specificity of EM
 Classical Immune electron microscopy: the sample is treated with specific anti-
sera before being put up for EM and seen agglutinated by the antibody.
 Solid phase immune electron microscopy: A grid is coated with specific anti-sera
the virus in the sample will be absorbed onto the grid by the antibody
Light Microscopy
• Histological changes in infected cells
• Viral inclusion bodies are basically collections of replicating virus particles
• Though not sensitive or specific it is useful adjunct in the diagnosis
79

80
Negri Body in neuron cell
(source: CDC)
Positive DFA test (Source: CDC
Histopathology
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 51-3.

Cytology: inclusion
bodies
Rabies Histopathology

Cultivation of virus from clinical specimen
• Viruses grow only on living cells
3 major types of cell / tissue culture
1. Primary tissue culture: Monkey Kidney
2. Semi-continuous cells: HEK and skin fibroblasts up to 50 times
3. Continuous cell line: HeLa, Hep2, BGM, Vero, LLC-MK2, MDCK
Other culture systems
• Embryonated egg: Influenza virus
• Suckling mice: Alphaviruses, Flaviviruses, Bunyaviruses, Rabies virus
82

Primary cell culture
+ enzymes
time

Subculture
enzymes
time

• Viruses can be cultivable or non-cultivable: Using EM, Histology, Ag detection
Cultivable
1 Effect on cell culture
2 Specific neutralization
3 Specific viral Ag in tissue culture
Growing virus may produce
1. Cytopathic Effect (CPE): such as the ballooning of cells or syncytia formation
2. Appearance of virus- encoded protein-specific antisera: HA of Influenza
3 Haem-adsorption: cells acquire the ability to stick to RBCs
4 Detection of viral specific nucleic acid-PCR
85

Identification of virus
Effect on cell culture
CPE
Inclusion body formation
Giant cell formation
86

Cytopathic Effect
Cytopathic effect of enterovirus 71 and HSV in cell culture: note the
ballooning of cells. (Virology Laboratory, Yale-New Haven Hospital, Linda
Standard, University of Cape Town)
Syncytium formation in cell culture caused by RSV (top),
and measles virus (bottom).
Urtesy of Linda Standard, University of Cape Town, S.A.)

From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 51-1.
Cytology: CPE
88
Hemadsorption

Problems with cell culture
• long period (up to 4 weeks)
• Poor sensitivity
• Susceptible to bacterial contamination and toxic substances in the specimen
• Many viruses will not grow in cell culture at all e.g. HBV and C, Diarrheal viruses,
parvovirus
89

Rapid Culture Techniques
• Viral antigens can be detected 2 to 4 days after inoculation
• The CMV DEAFF test is the best example, whereby
• The cell sheet is grown on individual cover slips in a plastic bottle.
• Following inoculation, the bottle then is spun at a low speed for one hour (to
speed up the adsorption of the virus) and then incubated for 2 to 4 days
• The cover slip is then taken out and examined for the presence of CMV early
antigens by immunofluorescence.
90

Shell-vial culture
Grow cells in monolayer on cover slip
 Remove medium
 Add 0.1-0.25 ml specimen
 Centrifuge 700 g x 40 mts at 35 C
 Add medium
 Incubate 35 C x 16-48 hrs.
 Fix cover slip, stain FA
 Examine Fluorescent microscope
Disadvantages:
 Not so sensitive as conventional culture
 One virus per vial
91

Virus isolation and quantitation
Quantitation of virus
• Physical methods
• Direct counting by EM
• Surface gp hemagglutination
• Serological tests RIA / Elisa
• Biological methods (infectivity assays)
Purification of Viruses
• Tissue culture medium
• Body fluids
• Infected cells / tissues
92

• Steps for purification
 Precipitation: Ammonium Sulfate / Ethanol / Polyethylene glycol or Ultrafiltration/
freeze drying/per evapration/ dialysis with PEG
 Hemagglutination and elution
Once concentrated separate from host cells
↓
Ultracentrifugation / density gradient centrifugation / column chromatography/ Gel
electrophoresis
93

Assessing purity of virus preparation
• Single sharp band in sucrose gradient
• Homogenous appearance in electron micrograph
• Failure of removal of any ‘contaminant’ without reducing infectivity
• Spectrometer gives approximate composition of virus in terms of nucleic acid and
proteins
94

Assays for viral proteins and nucleic acids
Proteins
• Electrophoresis-plot pattern
• RTPCR-Enzyme activity
• Ha and hemadsorption (influenza virus)
• Antigen detection(IFT, ELISA, Western blot)
Nucleic acid
• Restriction endonuclease-cleavage pattern
• Electrophoretic mobility of RNA for segmented RNA viruses(electrophoresis)
• DNA genome hybridization in situ
• PCR for DNA
• Southern and Northern blots
• RT PCR for RNA
95

Identification of Particles as Viruses
• Obtained only from infected cells/tissues
• Identical from various sources
• Degree of infectivity directly proportional to no. of particles
• Loss of infectivity physical/chemical
• Induce characteristic dis in vivo
• Anti-serum reacts with particles
• Passage in tissue culture→ viral progeny
96

Plaque assay
Plaque assay: An infectivity assay
that quantifies the number of
infection units in a suspension
• Plaque assay
• Pock assay
• Hem-agllutination assay
97
Plaque assay: method
1:100
1:10 1:10
1:10
1:10
1:10
10-2 10-3 10-4 10-5 10-6 10-7
virus
serial dilution
plate 1 ml
plaques
100 10 1
(1000)
(100,000) (10,000)
Titer = 1 x 107 pfu/ml

Growth of virus on embryonated eggs
Davis, Duylbecco, Eisen, Ginsberg “Microbiology” 4th ed, J.B. Lippincott 1990,
98

Titer = 32 HA units/ml
Hemagglutination test: method
1:8
1:2 1:2
1:2
1:2
1:2
8 16 32 64 128 256
virus
serial dilution
mix with red
blood cells
side view
top view
99

Hemagglutination assay. Seven different samples of influenza virus, numbered 1 through 7 at the left, were serially diluted as indicated at
the top, mixed with chicken red blood cells (RBC), and incubated on ice for 1 to 2 hours. Wells in the bottom row contain no virus.
Agglutinated RBCs coat wells evenly, in contrast to nonagglutinated cells, which form a distinct button at the bottom of the well. The HA
titer, shown at the right, is the last dilution that shows complete hemagglutination activity. (From Fields Virology, 4th ed, Knipe & Howley,
eds, Lippincott Williams & Wilkins, 2001, Fig. 2-8)
Hemagglutination assay: influenza virus
100

Measurement of Plasma HIV Viral Load
Significant prognostic value
Best predictor of long term clinical outcome
Gold standard techniques- nucleic acid based:
• RT-PCR based, bDNA, Nucleic Acid Sequence Based Amplification
•Drawbacks for resource constrained settings:
• Expensive (~$80US/test)
• Require high degree of technical expertise and expensive equipment
• Commercially available assays
• Cavidi ExaVir®Load Reverse Transcriptase Assay
• P24 Assay
101

Serology
• Detection of rising titers of antibody
• Acute- and convalescent-phase sera with rising titers of antibody to virus-
specific antigens and a shift from IgM to IgG
Conventional Methods for detection of antibodies
Classical Techniques Newer Techniques
1.Complement fixation
tests (CFT)
1.Radioimmunoassay (RIA)
2.Haemagglutination
inhibition tests
2.Enzyme linked immunosorbent
assay (EIA)
3.Immunofluorescence
techniques (IF)
3.Particle agglutination
4.Neutralization tests 4.Western Blot (WB)
5.Counter-
immunoelectrophoresis
5.RIBA, Line immunoassay
102

Criteria for diagnosing primary Infection
• 4 fold or more increase in titer of IgG or total antibody between acute and
convalescent sera
• Presence of IgM
• Sero-conversion
• A single high titer of IgG (or total antibody) - very unreliable
Criteria for diagnosing reinfection
• Fold or more increase in titer of IgG or total antibody between acute and
convalescent sera
• Absence or slight increase in IgM
103

Typical Serological Profile After Acute Infection
Note that during reinfection, IgM may be absent or present at a low level transiently
104

105

Complement Fixation Test
106
Complement Fixation Test in Microtiter Plate. Rows 1 and 2 exhibit complement
fixation obtained with acute and convalescent phase serum specimens,
respectively. (2-fold serum dilutions were used) The observed 4-fold increase is
significant and indicates recent infection.

CSF antibodies
• Used mainly for the diagnosis of herpes simplex and VZV encephalitis
• CSF normally contain little or no antibodies
• presence of antibodies suggest meningitis or meningoencephalitis
CSF antibody titer > _1_ is indicative of meningitis
Serum antibody titer 100
• Diagnosis depends on the presence of an intact blood-brain barrier
107

Immuno-fluorescence
108
Positive immunofluorescence test for
rabies virus antigen. (Source: CDC)
(Virology Laboratory, Yale-New
Haven Hospital)
Detection of Viral Antigen in Cells

Advantages and Disadvantages
Advantages
• Result available quickly, usually within a few hours.
Disadvantages
• Low sensitivity and specificity
• Requires good specimens
109

ELISAs
• Uses specific viral proteins from virus-infected cells or produced by
recombinant DNA technology
• Are sensitive and automated
110
Microplate ELISA for HIV antibody: colored wells indicate reactivity
ELISA for HIV antibody

Western blots
• Detects specific viral proteins
• Proteins are separated by size and transferred to an inert membrane, where they
are incubated with serum antibodies.
• Western blots are inherently difficult to quantitate or automate.
111
HIV-1 Western Blot
• Lane1: Positive Control
• Lane 2: Negative Control
• Sample A: Negative
• Sample B: Indeterminate
• Sample C: Positive

Molecular Methods
 Highly sensitivity and no longer depends on viable virus and its replication
 Detection of viral NA does not necessarily indicate virus-induced disease
• Reverse Transcriptase Chain reaction (RTPCR)
• nPCR
• Ligase Chain reaction (LCR)
• Nucleic acid Sequence Based Amplification
• bDNA
 The advantage of molecular techniques are:
 High sensitivity, specificity, and safety
112

Nucleic acid probes
• NA probes are segments of DNA or RNA that have been labeled with:
 Enzymes
 Antigenic substrates
 Chemiluminescent moieties and radioisotopes
• Probes are directed to either DNA/RNA targets from 20 to thousands of bases long
Nucleic acid hybridization
• Specimen is spotted on nitrocellulose membrane →and viral NA present in sample is
bound → denatured with alkali in situ → hybridized with labeled viral NA fragment →
detect hybridized product
113

In situ Hybridisation
114
biotinylated enzyme (AP)
streptavidine
HPV DNA in tissue
HPV gene probe biotinylated
chromogene colour

Polymerase chain reaction
• A portion of viral DNA/RNA is replicated a million times or more
• Detection of this amplified amplicon based on an enzymatic reaction involving the
use of synthetic oligonucleotides flanking the target nucleic sequence of interest
• These oligonucleotides act as primers for the thermo stable Taq polymerase
• Repeated cycles (usually 25 to 40)
 Denaturation of the template DNA (94oC)
 Annealing of primers to their complementary sequences (50oC)
115

Types of PCR assays
• RT-PCR
• NESTED PCR
• MULTIPLEX PCR
• REAL-TIME PCR
116

Biosafety in Virology Lab
Laboratory-Acquired Viral Infections reported:-
• Hepatitis A, B, and C - they account for the majority of known laboratory-acquired infections
• Influenza, adeno, and mumps viruses
• Polio and coxsackieviruses
• Lassa fever, Marburg, Crimean-Congo, Yellow Fever, Dengue and Hantaviruses
• VEE, EEE, Rift Valley fever, Chikungunya, Kyasanur Forest Disease, Japanese B
encephalitis, West Nile, St Louis, Russian spring-summer, and Louping ill and many other
arboviruses
• HIV and rabies
117

Routes of infection reported
Route of infection may not be same as natural route
• Oral: Eating, drinking, and smoking
• Through the skin: injuries by needles, sharp instruments, or glass
• Through the conjunctiva: Splashes of infectious material into the eye
• Through the lungs: Inhalation of airborne microorganisms
Hazard groups
• Micro-organisms have been classified into 4 hazard groups by the ACDP (Advisory
Committee on Dangerous Pathogens) on the basis of
• Pathogenicity to humans
• Risk to laboratory workers,
• Transmissibility to the community, and
• Whether effective prophylaxis is available.
118

Group 1: An organism that is most unlikely to cause human disease
Group 2: An organism that may cause human disease and which may be a hazard
to laboratory workers but is unlikely to spread to the community.
• Rarely produces infection and effective prophylaxis/treatment is usually
available (HSV, ortho/paramyxoviruses, picornaviruses, adenoviruses)
Group 3: An organism causing severe human disease and presents a serious
hazard to laboratory workers.
• Spread to the community but there is effective prophylaxis/treatment available
(HIV, HBV, Hantaviruses, Japanese B encephalitis, Rift Valley fever, Yellow
Fever, rabies.
Group 4: Organisms cause severe human disease and is a serious hazard to
laboratory workers.
• High risk of spread to the community and there is usually no effective
prophylaxis or treatment (Lassa fever, filoviruses, smallpox, Crimean-Congo
hemorrhagic fever, Russian spring-summer encephalitis, Kyasanur forest)
119

Safe Working Environment Level 1 & 2 Laboratories)
• Minimal risk to workers
• Access limited
• Floor-slip resistant, easily cleanable and resistant to most of the chemicals
• Same for walls and ceiling
• Windows sealable and fitted with blinds
• Doors fire resistant, fitted with vision panels
• Working bench surface impervious to liquids, resistant to chemicals
• Hand basin-disposable towels
• Ventilation system-to prevent distribution of infectious particles
120

Microbiological Safety Cabinets
There are three classes of safety cabinets.
Class I: Air is drawn from the room through
open front, and over the working area
• Passed through high efficiency particulate
air (HEPA) filters which remove infectious
particles, and is ducted to outside air
• A minimum airflow of 0.7 m/s must be
maintained through the front of the cabinet
121

Class II: Air is filtered and most of it is
Recirculated through the cabinet. This
cabinet protects the work as well as the
worker. About 70% of the air is
Recirculated through filters so that the
working area is bathed in clean (almost
sterile) air. The remaining 30% of air is
exhausted to the atmosphere and is
replaced by a "curtain" of room air which
enters at the working face.
122

Class III
123
• Class III: Are totally enclosed and leak-proof. The
operator works with gloves which are sealed into
the front of the cabinet by removable gaskets.
• Laminar flow (clean air) cabinets: These are not
microbiological safety cabinets. Air is drawn
through HEPA filters and passed onto the working
surface and the room. They are widely used in
pharmacies and the preparation of tissue culture.

Safe Working Environment Level 4 Laboratories
• Very severely restricted
• Laboratory should be isolated or physically separated from other building/s
• Airtight and access through airlocks
• Ensure that nothing passes outside the room without being sterilized
Infection Prevention
color-coded containers;
• Yellow: For incineration
• Light blue or transparent with blue inscription: For autoclaving
• Black: Normal household waste: local authority refuse collection
• White or clear plastic: soiled linen
124

Precautions Hepatitis and HIV agents
Standard Precautions
• Where standard precautions are used, there should be a set of standard
operating procedures and only skilled staff should be employed.
• They should have received HBV vaccine.
• The WHO recommends medical surveillance and base-line serum samples.
125

Decontamination
Autoclaves
Chemical Disinfection
1. Clear Phenolics.
2. Hypochlorite
3. Aldehydes
4. Alcohol and alcohol mixtures.
5. Quaternary ammonium compounds
6. Iodophors.
Decontamination procedures
1. Rooms
2. Equipment
3. Laboratory protective clothing
126

Medical
important
DNA viruses
1. Adenoviruses

Adenoviruses
128
Classification & structure:
 Family: Adenoviridae
 Non-enveloped with linear dsDNA Genome and core proteins
 70-90 nm in size
 More than 49 stereotypes known infections (mostly: 1-8, 11, 21, 35, 37, 40 & 41)
 Types 40 & 41 are enteric pathogens
Not easily affected by external environment, low PH, bile salts & proteolytic
enzymes
 Can replicate to high titer in the gastro intestinal tract

Adenoviruses
• Infections of;
• Respiratory
• GIT
• Eye
• Genito- urinary tract
• Icosahedral capsid with 252 capsomeres (12 pentons at vertices and 240 hexons)
• Each penton has a fibers with terminal knob projecting from it
129
4/10/2024

Fig.-- Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005,
Adenovirus Structure

ADENOVIRUS - Classification
Two Genera
 Avi-adenovirus: Infects birds
 Mast-adenovirus: Infects mammals
Time-course of infection
• Incubation period- 2-14 days
• Infective period continues for weeks
• Intermittent and prolonged rectal shedding
• Secondary attack rate within families up to 50%
131
4/10/2024

132
Clinical syndrome
Different based on organ or system involved
1. Respiratory system
• Upper respiratory infections: Common cold (rhinitis); pharyngitis & tonsillitis
• Lower respiratory infections: Bronchitis; acute respiratory disease & pneumonia
2. Eye: Acute follicular conjunctivitis & kerato-conjunctivitis
3. Gastrointestinal
 Gastroenteritis; mesenteric adenitis; hepatitis; appendicitis
 Diarrhea tends to last longer than other viruses that cause Gastroenteritis E.g. Rotavirus
► May cause fatal disease in immuno-compromised patients

From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005
Adenovirus diseases

Fig. Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005
Adenovirus pathogenesis

Diagnosis
 Culture
 Viral antigen detection
Treatment
 Live military vaccine

POXVIRUSES
Properties of Poxviruses
• Enveloped virus
• Largest and most complex virus
• Oval or brick shaped
• 400 nm L X 230 nm B
• Genome: dsDNA, linear,130-375 kbp
• DNA 3 %, Protein 90 %, Lipid 5 %
• Infection characterized by skin rash
136

Structure of Poxvirus
• v
137

100 nm
E. coli
Variolavirus
Influenzavirus Herpesvirus
Poliovirus
Adenovirus
The Size of Viruses
138

Pox virus Replication
• Unique DNA virus that replicates in
cytoplasm
• Virus attachment, penetration & un
coating
• Replication of viral DNA and synthesis of
viral proteins
• Maturation
140
Figure-24 Replication of vaccine virus

• About 9 poxviruses diseases in humans, but variola virus (VV) and vaccinia are
common
• VV strains are divided into variola major (25-30% fatalities) and variola minor
(same symptoms but less than 1% death rate).
• "Variolation" = Cow pox-Jenner 1756
Vaccinia and Variola
• The origins of Vaccinia virus are uncertain: Product of genetic recombination?
• Distinct species of Ortho-poxvirus
• Distinctly different from cowpox
• Variola narrow host range (only humans and monkeys) Vs Vaccinia broad
141

Pathogenesis of smallpox
• Portal of entry →mm of URT
Multiplication in lymphoid tissue local LN
Transient viremia RES
Secondary severe viremia
Clinical disease
Lesions in mouth and URT
Discharge in environment
Epidermis: → skin pustules → scabs (virus)
142

Variola eradication 1980
• There is no other reservoir for VV but man (including primates)
• VV causes only acute infections, from which the infected person either:
a) Dies
b) Recovers with life-long immunity
• Vaccinia virus is an effective immunogen. Very good vaccine
• WHO commitment 1965 → Eradication 1980
143

Terror????
• Bioterrorism or Re-emergence????
• Destruction of the last (official) remaining smallpox stocks held in Russia and
USA has now been postponed indefinitely.
• Monkeypox,
• Immunosuppression due to AIDS
• Sequence of camel pox: Most closely related Variola
144

Clinical Findings
• Incubation period about 12 days
• Sudden onset
• Fever 1-5 d
• Exanthema →malaise
• Skin exanthema 1-4 d → Pustule
2-6 d → crusts 2-4 weeks
• Fatality 5 to 40%
145
Smallpox

Smallpox
• v
146

Diagnosis
• Isolation and Identification of virus
• Vesicular fluid → CAM
• Cell culture
• Direct EM
• Viral antigen → agar gel precipitation
• PCR
• Serology HI, Nt, ELISA, RIA, IFT (AB after first week of infection)
147

Vaccination
148

Human infections with Ortho-poxviruses
• Vaccinia
• Buffalopox
• Monkeypox
• Cowpox
149

Orf virus Lesions
• Orf is species of Parapoxviruse
• Disease In sheep and goats-contact- humans-worldwide (contagious pustular
dermatitis)
150

Monkey Pox
• Zoonotic
• Captive monkey 1958
• Human infection 1970’s
• Central and Western Africa, Congo, Zaire
• 90 % children
• Lymphadenopathy Rashes fatality 10-11 %
151

Tanapox and Yaba Monkey tumor poxvirus infections
• Tanapox: Common in Africa; Kenya and DRC
• Natural host: Monkey / other reservoirs?
• Infected animal → Humans
• Febrile 3-4 days
• Severe headache, one or two skin lesions, no pustulation never- healing 4-7 weeks
152

Molluscum contagiosum
• Benign epidermal tumor: only humans
• Lesions small, pink, wart like tumors on face, back, arms and buttocks
• Member of Molluscipox genus that resembles Vaccinia virus
• Virus oval or brick shaped
• G+C content about 60 %
• Antibodies do not cross react with other pox viruses
• Genome has 163 genes about two-third resemble genes of smallpox and cowpox
viruses
153

Molluscum contagiosum
• Direct or indirect contact-children
• Sexually transmitted: young adults
• Similar with AIDS
• IP up to 6 weeks
• Lesions-itch-auto inoculation
• Lesions up to 2 years-regress spontaneously
• Poor immunogenic-second attacks are common(1/3 patients never produce
antibodies
154

Diagnosis
• Clinically
• PCR detect viral DNA sequences
• EM detect viral particles
155

Herpesviruses
'Herpein' - 'to creep' = chronic/latent/recurrent
infections

Herpes virus types that infect humans
• Herpes simplex I & II: (cold sores, genital herpes)
• Varicella zoster: (chicken pox, shingles)
• Cytomegalovirus (microcephaly, infectious mono)
• Epstein-Barr virus (mononucleosis, Burkitt’s lymphoma)
• Human herpesvirus 6 & 7 (Roseola)
• Human herpesvirus 8 (Kaposi’s sarcoma)
4/10/2024 157

Classification of Human Herpesviruses
Family Herpesviridae
Sub family –herpesvirinae
Sub family Genus Official name Common
Alpha simplex HHV 1 Herpes simplex type 1
HHV 2 Herpes simplex type 2
________________________________________
Varicello HHV 3 Varicella Zoster virus
________________________________________________
Beta Cytomegalo HHV 5 Cytomegalovirus
Roseolo HHV 6 HHV 6
HHV 7 HHV 7
____________________________________________________________
Gamma Lymhocrypto HHV 4 Epstein-Bar virus
Rhadino HHV 8 Kapossi’s sarcoma associated herpes virus
4/10/2024 158

• Capacity to persist in host indefinitely in nucleus of the cell
• Varicella zoster and herpes simplex viruses establish latent infections in neurons
• Reactivation Varicella zoster: herpes zoster (shingles)
• HSV 1: recurrent labial herpes
• HSV 2 : genital herpes
• CMV, EBV and HHV-6 : persist in lymphocytes
4/10/2024 159

Herpesvirus Virion
Virion has 4 basic structures
1. Envelope,
2. Tegument
3. Icosahedral capsid-162 capsomers
4. DNA-containing core.
• Spherical 150- 250 nm Icosahedral
• Enveloped ds DNA linear 124-235 kbp
• More than 35 proteins in virion
• Envelope: 8nm spikes viral
glycoproteins Fc receptors.
• Replication nuclear, bud from nuclear
membrane
• Infection: Lytic, latent and recurrent
4/10/2024 160

Herpes virion properties
• Size:150-200nm
• Envelope: Present; associated glycoproteins-spikes.
• Tegument: Protein-filled region between capsid and envelope.
• Capsid: Icosahedral, 95-105nm diameter; 162 hexagonal capsomers.
• Core: Toroidal (DNA around protein), ~75nm diameter.
• Genome: Large, 130-230kbp and encode at least 100 different proteins and many virus-
specific enzymes , Linear, d/s DNA,, G+C 31-75 %
• Replication: Nuclear.
• Assembly: Nuclear.
• Common Antigens: None!
4/10/2024 161

Herpes Simplex Viruses
• Extremely widespread in the human population.
• Broad host range, being able to replicate in many types of cells and to infect many
different animals.
• They grow rapidly and are highly cytolytic.
• Responsible for a spectrum of diseases, ranging from gingivostomatitis to
keratoconjunctivitis, encephalitis, genital disease, and infections of newborns.
• The herpes simplex viruses establish latent infections in nerve cells; recurrences are
common

Properties of the Viruses
• There are two distinct HSVs: type 1 and type 2 (HSV-1, HSV-2).
• Their genomes are similar in organization
• They can be distinguished by sequence analysis or by restriction enzyme analysis of
viral DNA.
• The two viruses cross-react serologically, but some unique proteins exist for each
type.
• They differ in their mode of transmission
• HSV-1 is spread by contact, usually involving infected saliva
• HSV-2 is transmitted sexually or from a maternal genital infection to a newborn.

Characteristics
HSV-1 HSV-2
Clinical
Primary infection:
• Gingivostomatitis + -
• Pharyngotonsillitis + -
• Keratoconjunctivitis + -
• Neonatal infections ± +
Recurrent infection:
• Cold sores, fever blisters + -
• Keratitis + -
Primary or recurrent infection:
Cutaneous herpes
• Skin above the waist + ±
• Skin below the waist± +
• Hands or arms + +
• Herpetic whitlow + +
• Eczema herpeticum + -
• Genital herpes ± +
• Herpes encephalitis+ -
• Herpes meningitis ± +

Characteristics
HSV causes cytolytic infections
Lesions induced in the skin and mucous membranes by HSV-1 and HSV-2 are the
same and resemble those of varicella-zoster virus.
 Changes induced by HSV are similar for primary and recurrent infections .
Characteristic histopathologic changes include ballooning of infected cells production
of Cowdry type A intranuclear inclusion bodies formation of multinucleated giant cells.
• Cell fusion provides an efficient method for cell-to-cell spread of HSV, even in the
presence of neutralizing antibody.

Primary Infection
• HSV is transmitted by contact of a susceptible person with an individual excreting
virus.
• HSV-1 infections are usually limited to the oropharynx, and virus is spread by
respiratory droplets or by direct contact with infected saliva.
• HSV-2 is usually transmitted by genital routes.
• Virus then invades local nerve endings and is transported by retrograde axonal
flow to dorsal root ganglia, where, after further replication, latency is established
• Oropharyngeal HSV-1 infections result in latent infections in the trigeminal ganglia
• genital HSV-2 infections lead to latently infected sacral ganglia.

Clinical findings
Oropharyngeal Disease
• Primary HSV-1 infections are usually asymptomatic.
• Symptomatic disease occurs most frequently in small children (1-5 years) and involves the
buccal and gingival mucosa of the mouth
• Short incubation period (about 3-5 (2-12) days), and clinical illness lasts 2-3 weeks.
• Symptoms include fever, sore throat, vesicular and ulcerative lesions, gingivostomatitis, and
malaise. Gingivitis (swollen, tender gums) is the most striking and common lesion.
• Primary infections in adults commonly cause pharyngitis and tonsillitis. Localized
lymphadenopathy may occur.

• Recurrent disease is characterized by a cluster of vesicles most commonly localized
at the border of the lip .
• Intense pain occurs at the outset but fades over 4-5 days.
• Lesions progress through the pustular and crusting stages, and healing without
scarring is usually complete in 8-10 days.
• The lesions may recur, repeatedly and at various intervals, in the same location.
• The frequency of recurrences varies widely among individuals.

Keratoconjunctivitis
 HSV-1 infections may occur in the eye, producing severe keratoconjunctivitis.
 Recurrent lesions of the eye are common and appear as dendritic keratitis or
corneal ulcers or as vesicles on the eyelids.
 With recurrent keratitis, there may be progressive involvement of the corneal
stroma, with permanent opacification and blindness.
 HSV-1 infections are second only to trauma as a cause of corneal blindness in the
United States.

Genital Herpes
• Genital disease is usually caused by HSV-2
• Primary genital herpes infections can be severe, with illness lasting about 3 weeks.
• Genital herpes is characterized by vesiculo-ulcerative lesions of the penis of the
male or of the cervix, vulva, vagina, and perineum of the female.
• The lesions are very painful and may be associated with fever, malaise, dysuria,
and inguinal lymphadenopathy
• Viral excretion persists for about 3 weeks.
Skin infections
Intact skin is resistant, so cutaneous infections are uncommon in healthy persons
Localized lesions caused by HSV-1 or HSV-2 may occur in abrasions that become
contaminated with the virus (traumatic herpes).
These lesions are seen on the fingers of dentists and hospital personnel (herpetic
whitlow) and on the bodies of wrestlers (herpes gladiatorum)

Encephalitis
• A severe form of encephalitis may be produced by herpesvirus.
• HSV-1 infections are considered the most common cause of sporadic, fatal
encephalitis in the United States.
• The disease carries a high mortality rate, and those who survive often have
residual neurologic defects
• About half of patients with HSV encephalitis appear to have primary infections, and
the rest appear to have recurrent infection

Neonatal Herpes
• Acquired in utero, during birth, or after birth
• The mother is the most common source of infection in all cases
• It is estimated to occur in about one in 5000 deliveries per year
• The newborn infant seems to be unable to limit the replication and spread of HSV
and has a propensity to develop severe disease

Laboratory diagnosis
• Cytopathology
• A rapid cytologic method is to stain scrapings obtained from the base of a vesicle
(Giemsa's stain)
• Presence of multinucleated giant cells indicates that herpesvirus (HSV-1, HSV-2,
or varicella-zoster) is present

Isolation and identification of virus
• Inoculation of tissue cultures
• Identified by Nt test or immunofluorescence staining with specific antiserum
• Monoclonal antibody or by restriction endonuclease analysis of viral DNA
• PCR: Are sensitive and specific
Serology
• Antibodies appear in 4-7 days after infection and reach a peak in 2-4 weeks
• They persist with minor fluctuations for the life of the host
• Heterotypic anamnestic responses to VZ in persons infected with HSV, vice versa

Varicella-Zoster virus
Two almost universal human diseases
 Chickenpox (Varicella): Exanthema of childhood
 Herpes zoster (Shingles)
Disabling disease of
 Aged persons
 Immunocompromised patients
4/10/2024 176

Varicella-Zoster
• Varicella-Chicken pox
↓
Latency
↓
Zoster-Shingles
• VZ virus causes two distinct clinical entities
• Morphologically identical HSV
• No animal reservoir (except primates)
• Grow readily cell culture
• Intra-nuclear inclusions, ballooning, swelling
4/10/2024 177

Varicella-Zoster Virus
Normal individuals
• Primary infection (chickenpox) is one of the classical rash diseases of childhood
• Following primary infection, it remains latent in the cranial-spinal ganglia
• Reactivation leading to the appearance of shingles occurs in 10-20% of infected individuals
and usually occurs after the fourth decade of life
• Immunocompromised individuals
Primary infection
• Severe in children, anti malignancy drugs, leukemia, and lymphoma
• Life-threatening complications such as disseminated varicella, pneumonia, and encephalitis
4/10/2024 178

Immunocompromised individuals
Reactivation
• Immunocompromised: herpes zoster, appear
at an earlier age and more than one episode
may occur.
• Severe, disseminated disease may occur but
fatality is rare.
4/10/2024 179
• Herpes zoster -Shingles

Properties of VZ virus
• A ubiquitous and extremely contagious infection
• Morphologically identical HSV
• No animal reservoir
• Intranuclear inclusions
• CPE more focal much more slow
• Same virus chicken pox and zoster
• Only one serotype X HSV
4/10/2024 180

Varicella: a highly contagious disease of children
Route URT / conjunctiva
↓
Circulates in blood
↓
Multiple cycles of replication
↓
Localizes in skin → viral infection of capillary endothelial cells
Neonatal / complicated → Lung and & organs (severe disease)high mortality
4/10/2024 181

Varicella or Chicken pox
• Always acute disease
• IP 7-23 days and infectious 2 days before rash
• Rash-face, neck trunk, axillae, limbs, shoulder blades
• Maculae-papule-vesicle-crust- in crops
• Duration of disease-7 and 10 days, up to 2-4 wks
• Complications rare
• Mortality very low
4/10/2024 182

Chicken pox (neonatal)
• Varicella from mother
• High mortality about 30 %
• Congenital Varicella
• Varicella in pregnancy rarely crosses placenta “Congenital varicella syndrome”
Chicken pox (adults) (Primary)
• Serious
• Pneumonia most common complication
• Mortality 10-40 %
4/10/2024 183

Zoster or Shingles
• The consequence of reactivation of latent VZV from the
dorsal root ganglia
• No history of recent exposure
• Incidence is highest among individuals in the sixth decade
of life and beyond
• Recurrent herpes zoster is exceedingly rare except in
immunocompromised hosts
• Unilateral vesicular eruption within a dermatome, often
associated with severe pain
4/10/2024 184
Zoster in AIDS patient

Zoster
• Skin lesions similar to varicella
• Often only single ganglion involved
• Limited to skin of an individual dorsal root ganglion
• Acute inflammation of sensory nerves and ganglia
• Trigger of reactivation ?? Waning immunity
4/10/2024 185

Clinical manifestations of Zoster
• Very painful
• Virus: nerve to cell
• Area supplied by nerve-crop of vesicles
• Incapacitating disease
• Unilateral common in trunk, head, neck
• Any age
• Facial paralysis (trigeminal nerve)
4/10/2024 186

Diagnosis
• Cytology-multinucleated giant cells and Intracellular viral antigen-IF
• EM diff poxviruses
• Molecular methods-PCR,EIA
• Clinically
• Serology-CF, Nt (cell culture)
Immunity
• Primary Varicella: life long immunity to Varicella Zoster can occur
• CMI important in recovery
4/10/2024 187

Treatment and Prevention
• Acyclovir: Severe varicella or zoster infections.
• A live attenuated vaccine controversial in immunocompromised individuals
• VZIG can be used to prevent primary infection in susceptible individuals
4/10/2024 188

Cytomegalovirus
• The largest of the Herpesviruses, genome ~240kbp
• CMV infection are 'slow' - 7-14 days
• CMV infection is common more than 50 % population experienced infection by the age of 40
• Most infections are asymptomatic occurs in people except with immune defects (T-cell
defects) /pregnancy / newborns (congenital)
Normal individuals
• Primary infection is usually asymptomatic, occasionally an infectious mononucleosis-like
illness
• Reactivations or re-infections are common throughout life and are usually asymptomatic
4/10/2024 189

Immunocompromised individuals
• Both primary and recurrent infection may lead to symptomatic disease
• Primary CMV infection is usually more severe than recurrent infection, with the
exception of bone marrow transplant recipients, where primary and recurrent
infections are just as severe
4/10/2024 190

Clinical manifestations
• Fever
• Pneumonitis (most severe manifestation, mortality rate of 85%)
• Hepatitis
• GI manifestations e.g colitis
• Encephalopathy
• Retinitis
• Poor graft function
4/10/2024 191

AIDS patients
• CMV disease is present in 7.4% to 30% of all AIDS patient
• Sight-threatening retinitis, colitis, and encephalopathy are the most common manifestations
of CMV disease in AIDS patients
Solid organ transplant recipients
• Most common infection, leading cause of morbidity and mortality
• Occurs 1-3 months following transplant
• Primary infection more severe than recurrent infection
• Fever, pneumonitis, GI manifestations, hepatitis, and poor graft function
• Does not appear to be associated with organ rejection
4/10/2024 192

Congenital CMV infection
• Mother infected in pregnancy: fetus at high risk
• Maternal infection usually asymptomatic
• Fetal infection asymptomatic to severe and disseminated
• Fetus damaged at any stage
• Severe developmental defects mental retardation/deafness
Perinatal CMV Infection
• Infected birth canal / maternal milk or other secretions
• Protracted interstitial pneumonitis
• Poor weight gain, adenopathy, rash. Hepatitis & anemia persist for months to years
4/10/2024 193

Laboratory diagnosis (CMV)
 Cytology/histology: large cytomegalic 25-
35 um intranuclear inclusions-”owl’s eye”
 Culture: Gold standard
 4-6 weeks
 Nucleic acid antigen detection IFA, IE
 Serology
 PCR
4/10/2024 194
Cytopathic Effect of
CMV
DEAFF test for CMV
CMV pp65 antigenemia test

Treatment (CMV)
• Ganciclovir: Is the drug of choice. However, it is associated with neutropenia and
thrombocytopenia
• Forscarnet: Can be used as the 2nd line drug but it is associated with renal toxicity
• Cifofovir (HPMCC): Approved for the treatment of CMV retinitis. It is also
associated with renal toxicity
• Fomivirsen: Intravitreal fomivirsen is approved for the treatment of CMV retinitis
• CMV hyperimmune globulin: Found to be effective against CMV pneumonitis
4/10/2024 195

Epstein-Barr Virus
• Ubiquitous
• Acute infectious mononucleosis / nasopharyngeal carcinoma
• Burkitt’s Lymphoma and other lymphoproliferative disorders
• Dual cell tropism for human B-lymphocytes (non-productive infection) and
epithelial cells (productive infection)
• Highly host specific: No suitable animal host
• V DNA genome about 172 kbp
• Two viral types: EBV1 and EBV2
4/10/2024 196

Depending on:
• Variation in genome
• Structure
• Antigen expression
• Biologic properties
• Primary infection-infected saliva
• Incubation period 30-50 days
• Initiate infection in oropharynx
• Replication B cells or epithelial cells
• PI asymptomatic/ subclinical in child
• Sore throat, head ache
• Fever, malaise, fatigue
• Enlarged LN
• Few-hepatitis
4/10/2024 197

Young adults:
• Infectious mononucleosis: Autoantibodies
 Self limiting lasts 2-4 weeks
 Symptoms like primary infection
• Oral Hairy Leukoplakia
 Wart like growth on tongue of some HIV persons and transplant patients
 It is an epithelial focus of EBV replication
• Burkitt’s lymphoma
4/10/2024 198

Hairy leukoplakia
Often presents as white plaques or warts on the lateral surface of the tongue and is
associated with EBV infection
4/10/2024 199

Burkitt's lymphoma
• Tumor of jaw
• African children/ young adults contain EBV DNA
• Most cases express EBNA 1 antigen Common in males of Chinese origin
• Genetic and environmental factors
EBV DNA
High levels of antibody to HBV
4/10/2024 200

HHV-6 and HHV-7
• HHV-6 and HHV-7
Develop latency following primary infection
Reactivated from time to time in immune suppressed individual
• HHV-6 infection is firmly associated with roseola infantum
It is associated with :
• Neurological manifestations (febrile convulsions, meningitis, and encephalitis)
• A variety of symptoms in transplant recipients such as fever, graft vs host disease,
liver and CNS manifestations.
• HHV-7 is not associated conclusively with any human disease
4/10/2024 201

Human Herpes Virus 8
• Associated with Kaposi’s sarcoma
• HHV-8 DNA is found in almost 100% of cases of Kaposi’s sarcoma.
• Most patients with KS have antibodies against HHV-8
• HHV-8 does not have a ubiquitous distribution
• Homosexuals
• Fosarnet, Ganiclovir, Cidofovir
4/10/2024 202

Human Parvoviruses
•Parvoviruses are the smallest DNA viruses
►In Latin, parvum meaning “small”
• Posses ssDNA genome
• One known human pathogen (parvovirus B19)
•The family Parvoviridae consists of two subfamilies:
 Densovirinae ……. are all viruses of insects
 Parvovirinae……...contains viruses of vertebrates

Human parvovirus B19 (B19V)
Structure
• In electron micrographs of negatively stained preparations B19V appears as :
 Non-enveloped
 Icosahedral with a diameter varying from 18 to 25 nm
• The virus do not contain lipids or carbohydrates
• As with all parvovirus particles, B19V:
 Stable over a wide range of pH
 Resistant to lipid solvents

 Not quite resistant to heat as other parvoviruses
 Inactivated by formalin, β-propiolactone, oxidizing agents & γ-irradiation

Autonomous parvovirus replication
Fig. From Medical Microbiology, 5th
ed., Murray, Rosenthal, Kobayashi
& Pfaller, Mosby Inc., 2002.

Helper dependent parvovirus (AAV) replication
AAV DNA
integrates into
chromosome 19
Infection without adenovirus
Infection with adenovirus
Superinfect with
adenovirus
Lytic
replication

Pathogenesis
Two studies of adult volunteers have provided a basis for understanding the
pathogenesis of B19 infection, which has two phases:
First phase of the illness
Characterized by viremia that develops approximately 6 days after intranasal
inoculation of B19 into susceptible individuals who lack serum antibodies to the virus
• Viremia lasts about 1 week; its clearance is correlated with the development of IgM
antibodies to B19, which remain detectable for up to a few months
• IgG antibodies develop several days later and persist indefinitely

• Non-specific systemic symptoms lasting 2 or 3 days occur early during
the viremic phase, include:
 Headache, malaise, myalgia, fever, chills, and pruritus
 Accompanied by reticulocytopenia and excretion of the virus from the
respiratory tract
• Several days after the onset of symptoms:
 Decline in haemoglobin conc. (maintained for 7 to 10 days)
 Examination of bone marrow samples reveals a marked depletion of
erythroid precursor cells
 Transient mild lymphopenia, neutropenia, & thrombocytopenia

A second phase
• Begins around 17 or 18 days after virus inoculation & after:
 Clearance of viremia
 Cessation of viral shedding in throat secretions
 Resolution of reticulocytopenia
• This phase occurs in the presence of rising serum titers of antibody to B19

Fig. From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby
Inc., 2005.
Parvovirus pathogenesis

Epidemiology of parvovirus B19
• Worldwide, infections occurring in all populations
• In temperate climates, infection occurs throughout the year
• Outbreaks are more common in late winter, spring and the early summer months
Transmission
• Unknown route of transmission but may be respiratory or through direct contact
• B19 can be transmitted during therapy with clotting factor concentrate & other
plasma derivatives
• Is now known that infusion of plasma pools containing high titre virus (>107 IU ml−1)
can transmit infection

B19V Infection in Pregnancy
• Maternal B19 infections usually do not adversely affect the fetus
• More often, the fetus remains uninfected.
• Couples in which the pregnant woman is infected should be counselled as to the
relatively low risk of fetal infection
• It is estimated that fewer than 10% of maternal B19 infections in the first 20 weeks of
pregnancy lead to fetal death

Laboratory diagnosis
Specimens:
 Serum (principal specimen)
 Tissue biopsy
A. Virus Detection
Culture of B 19 in erythroid progenitor cells derived from:
 Human bone marrow, umbilical cord, peripheral blood, or fetal liver sources
 Failed to grow in conventional cell culture lines & animal model

B. Serologic tests
• ELISA (detection of B19-specific IgM & IgG antibodies)
• Haemagglutination-based assays
C. Molecular technique
• Detection of viral DNA by quantitative PCR is the mainstay of detection of B19V
• Low levels of viral DNA (<104 IU (genome copies) ml−1) can be detected for months,
or even years after acute infection

Treatment
 No specific treatment
• Except intravenous administration of human Ig in cases of persistent infection in
immuno-compromised patient
• No vaccine for B19 is currently available
Prevention and control
• Isolating of susceptible individuals …. If possible
• Vaccination of animals to prevent animal B19V

General properties
• Genome is circular dsDNA, non-enveloped with icosahedral symmetry
• More than 80 types of HPV
• Possess capsomeres surround the genome
• Major & minor capsid protein comprises outer protein coat of the virus
• Three major regions comprise the HPV genome :
 Eearly region (E1-8) consists of genes responsible for transcription, plasmid
replication, & transformation
 The late region codes for the major (L1) and minor (L2) capsid proteins
 Control region contain regulatory elements for transcription & replication
218

HPV Gene Coding Regions
219
• Replication is in host cell
nucleus
• Undergo cell transformation

HPV gene products & their function
220

Fig. Differentiation of normal cutaneous squamous epithelium & papillomaviral activities in productively
infected benign lesions. The various epithelial strata & the host-differentiation, stage-specific, gene-
expression profile are indicated in the left and center panels. Source: Virology, 4th ed, Knipe & Howley, eds,
Lippincott Williams & Wilkins, 2001.
Papillomavirus replication & differentiation of the epidermis

Fig. Replication cycle of a papillomavirus. To establish a wart or papilloma, the virus must infect a basal epithelial cell. Initial steps in
the replication cycle include : attachment (1), uptake (2), endocytosis (3), and transport to the nucleus and uncoating of the viral DNA
(4). Early-region transcription (5), translation of the early proteins (6), viral DNA replication (7), vegetative viral DNA replication (8),
transcription of the late region (9), production of the capsid proteins L1 and L2 (10), assembly of the virion particles (11), nuclear
breakdown (12), and release of virus (13). (From Fields Virology, 4th ed, Knipe & Howley, eds, Lippincott Williams & Wilkins, 2001.
Papillomavirus replication

Fig. Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller,
Mosby Inc., 2005..
Papillomavirus pathogenesis

Epidemiology
• HPV prevalence and diseases are type specific with regional & ethnic variation
• HPV 16,18,33 and 45 are mostly found in cervical cancers worldwide
• HPV 16 & 18 present in 50% & 20% of all cases respectively
• HPV 16 & 18 are predominant types in newborns
• HPV 6 & 11 are commonly associate with genital warts (Condyloma acuminatum)
• HPV 2,4,29 & 57 occur in common skin warts
• No complete data on HPV prevalence in developing countries ??????
224

Clinical genital tract and mucosal HPV’s
(From Fields Virology, 4th ed, Knipe & Howley, eds, Lippincott Williams
& Wilkins, 2001.)

Transmission
1. Sexual contact
• Grater than 95% of infection is through sexual contact
2. Vertical transmission
 Less frequent mode of transmission
 Difficult to detect due to the latency period between the infant’s exposure at birth
& symptom presentation
3. Other pathways: Non-sexual transmission, e.g. contact with infected urogenital
secretions or bathing together
►No such cases have been clearly documented???
226

Risk factors for HPV
1. Sexual behavior
• Having multiple sexual partners is the main risk factor
2. Immune suppression
• A person with a pre-existing immuno-compromised state and/or concurrent genital
infection has a 17-fold increased risk of developing the diseases
• Increased risk of HPV in people with HIV infection
E.g: A study of 207 HIV-exposed women in New York showed that HPV prevalence
was 23% among HIV sero-negatives & 46% among HIV sero-positives.
The HIV+ women also had higher rates of oncogenic HPV types, which progressed to
cancer (as well as other HPV types). 227

3. Age
• Young women, between the ages of 15 and 25 have a two fold higher risk of
developing an HPV infection than women over 35
4. Other possible risk factors
Pregnancy, smoking, cconcurrent herpes infections, others
►Associated with increased HPV infection, but their significance is not conclusive
5. Socioeconomic variables
Poverty, domestic violence, sexual abuse, inadequate health care & lack of
information
►Can facilitate disease transmission , prevent early detection & treatment 228

Diagnosis
 Cytology (PAP smear; poikilocytosis)
 Immuno-histochemistry
 Nucleic acid
 Electron microscopy
Treatment/prevention
 Surgery
 Recombinant subunit (VLP) vaccine
Prevention & Control
• Early detection & treatment
• Follow up of pre-malignant lesions

Hepatitis B Virus
Relevance
• 250 million people infected worldwide
• Africa & East Asia, 50% population is seropositive, 5-15% chronically infected
• Carriers are 200x more likely develop hepatocellular carcinoma than non-
carriers
• 300,000 cases per year in the US; 4,000 fatalities
• 70-90% of maternal-neonatal infections result in chronic infection
• Enveloped virion containing partial double-stranded circular DNA genome
• Replication occurs through an RNA intermediate
• Virus encodes and carries a reverse transcriptase

CDC website: http://www.cdc.gov/ncidod/diseases/hepatitis/slideset/hep_b/slide_1.htm
• It has a strict tissue tropism to the liver
• Infected cells produce and release large
amounts of HBsAg particles lacking DNA
• Viral DNA can integrate into the host
chromosome

Hepatitis B Virion, Dane particle and HBSAG
From Murray et. al., Medical Microbiology 5th
edition, 2005, Chapter 66, published by
Mosby Philadelphia,,

Nomenclature for Hepatitis B Virus components

The growth cycle of Hepatitis B virus
From Murray et. al., Medical Microbiology 5th edition, 2005,
Chapter 66, published by Mosby Philadelphia,,

 Incubation period: Average 60-90 days
Range 45-180 days
 Clinical illness (jaundice): <5 yrs, <10%
5 yrs, 30%-50%
 Acute case-fatality rate: 0.5%-1%
 Chronic infection: <5 yrs, 30%-90%
5 yrs, 2%-10%
 Premature mortality from
 chronic liver disease: 15%-25%
Clinical Features

Prevalence of Hepatitis B carriers
Figure 66-9. Worldwide prevalence of hepatitis B carriers and primary hepatocellular
carcinoma. (Courtesy Centers for Disease Control and Prevention, Atlanta.)
From Murray et. al., Medical Microbiology 5th edition, 2005,
Chapter 66, published by Mosby Philadelphia,,

Figure 66-11. Clinical outcomes of acute hepatitis B infection. (Redrawn from White DO, Fenner
F: Medical virology, ed 3, New York, 1986, Academic Press
Clinical outcomes of Hepatitis B infections
From Murray et. al., Medical Microbiology 5th edition, 2005, Chapter 62, published by Mosby Philadelphia,,

Immunological events of acute vs. chronic HBV infection
From Murray et. al., Medical Microbiology 5th edition, 2005, Chapter 66, published by Mosby Philadelphia,,
A) Acute B) Chronic

Clinical interpretation of the Hepatitis B antigen panel
CDC WEB site: http://www.cdc.gov/ncidod/diseases/hepatitis/b/Bserology.htm

Determinants or acute and chronic HBV infection
From Murray et. al., Medical
Microbiology 5th edition, 2005,
Chapter 66, published by Mosby
Philadelphia,,

Prevention of Hepatitis B prophylaxis and vaccination

The HIV and Hepatitis B Reverse Transcription Systems
Flint, S.J., Enquist, L.W. et. al., “Principles of Virology”ASM Press, 2000, Chapter 7

Notes:
HDV infection can be acquired either as a co-infection with HBV or as a superinfection of persons with chronic HBV
infection. Persons with HBV-HDV co-infection may have more severe acute disease and a higher risk of fulminant
hepatitis (2%-20%) compared with those infected with HBV alone; however, chronic HBV infection appears to occur
less frequently in persons with HBV-HDV co-infection. Chronic HBV carriers who acquire HDV superinfection usually
develop chronic HDV infection. In long-term studies of chronic HBV carriers with HDV superinfection, 70%-80%
have developed evidence of chronic liver diseases with cirrhosis compared with 15%-30% of patients with chronic
HBV infection alone.
CDC website: http://www.cdc.gov/ncidod/diseases/hepatitis/slideset/hep_d/slide_1.htm

Medical Virology Final PPTDefinition and properties of a virus Viruses are filterable agents

Medical Virology Final PPTDefinition and properties of a virus Viruses are filterable agents

Recommended

Recommended

More Related Content

Similar to Medical Virology Final PPTDefinition and properties of a virus Viruses are filterable agents

Similar to Medical Virology Final PPTDefinition and properties of a virus Viruses are filterable agents (20)

Recently uploaded

Recently uploaded (20)

Medical Virology Final PPTDefinition and properties of a virus Viruses are filterable agents