SlideShare a Scribd company logo
Modelos	
  de	
  enfermedades	
  humanas	
  en	
  C.	
  elegans
Julián Cerón Madrigal!
Laboratori de Genètica Molecular, IDIBELL, Barcelona!
Métodos	
  innovadores	
  para	
  reemplazar	
  la	
  experimentación	
  animal	
  
CRISPR	
  
	
  
RETINOSIS	
  PIGMENTARIA	
  
	
  
CANCER	
  
1961
Discovery of
the genetic code:
every triplet of nucleotides
codes for one aminoacid
Le0er	
  from	
  Brenner	
  to	
  Perutz,	
  1963	
  
It	
  is	
  now	
  widely	
  realized	
  that	
  nearly	
  all	
  the	
  “classical”	
  problems	
  of	
  molecular	
  
biology	
  have	
  been	
  solved.	
  
I	
  would	
  like	
  to	
  tame	
  a	
  small	
  metazoan	
  organism	
  to	
  study	
  development	
  
directly.	
  	
  
First C. elegans publication, 1974
-­‐	
  959	
  somaBc	
  cells	
  
-­‐	
  302	
  neurons	
  
-­‐	
  Hermaphrodites	
  
-­‐	
  Easy	
  to	
  the	
  grown	
  in	
  the	
  lab	
  
-­‐	
  Strains	
  can	
  be	
  frozen	
  
C. elegans is small (0.25 to 1 mm long)
DissecJng	
  microscope	
  
C. elegans
life cycle
www.wormbase.org	

 www.wormbook.org	

Easy (and cheap) to cultivate	

Efficient for genetic analysis	

Invariable lineage	

Transparent
Apoptosis
C.	
  elegans	
  has	
  exactly	
  959	
  somaJc	
  cell	
  	
  
The apoptotic pathway is conserved
Three Nobel Prizes
2002 2006 2008
1994	
  
Osamu	
  Shimomura	
   MarJn	
  Chalfie	
  
RNAi by feeding in C. elegans
Aging	
  research	
  
Tools	
  and	
  techniques	
  
1974 1998
2011 2015
CRISPR	
  
	
  
RETINOSIS	
  PIGMENTARIA	
  
	
  
CANCER	
  
Convenience of C. elegans for CRISPR
CRISPR in C. elegans research
-  Produce mutations: point mutations or deletions
-  Produce endogenous reporters
The use of reporters in model systems
EXTRACHROMOSOMAL
(high copy)
3XFLAG tag
IF anti-FLAG
ENDOGENOUS
REPORTER
Previous	
  methods	
  for	
  generaJng	
  endogenous	
  reporters	
  
Paix	
  et	
  al.,	
  2016	
  
FP	
  inserJon	
  with	
  PCR	
  product	
  repair	
  templates	
  
(75%	
  efficiency	
  in	
  gtbp-­‐1)	
  
	
  
Dickinson et al., 2015
FP insertion with repair template plasmid
(12.5% efficiency in his-72)
In our hands: 1 positive after 72 injections and 366 worms genotyped
2016
Jeremy Vicencio
26 %
41 %
Vicencio et al , 2019
Diverse nucleases with distinct PAM sequences,
most of them not commercially available as protein
Cas9 vs Cpf1 (Cas12a)
New CRISPR systems in C. elegans to
evaluate:
- Toxicity
- Specificity
- Efficacy
Trends in Cell Biology DOI: (10.1016/j.tcb.2019.08.004)
Copyright © 2019 Elsevier Ltd Terms and Conditions
CRISPR
RETINOSIS PIGMENTARIA
CANCER
Prevalence:	
  1:4000	
  people	
  
15000-­‐16000	
  affected	
  in	
  Spain	
  
	
  
Retinitis Pigmentosa
No	
  cure	
  for	
  it	
  
Mechanism	
  not	
  unveiled	
  
≈50%	
  without	
  geneBc	
  diagnosBc	
  
NORMAL VISION TUNEL VISION
24 genes have been
associated to adRP
7 SPLICING-RELATED GENES:
PRPF3, PRPF4, PRPF6, PRPF8, PRPF31,
SNRPN-200 , RP9
Autosomal dominant Retinitis Pigmentosa and splicing
Autosomal dominant form: 30-40%
A C. elegans model for Retinitis Pigmentosa
Rubio-Peña et al, 2015
prp-­‐8(cer14[R2302del])	
  III	
  
prp-­‐8(cer22[R2303G])	
  III	
  
snrp-­‐200(cer23[V676L])	
  II	
  
snrp-­‐200(cer24[S1080L])	
  II	
  
Karinna Rubio-Peña
(PRPF8)	
  
(SNRNP200)	
  
Splicing-related Retinitis Pigmentosa mutations in C. elegans
CRISPR to mimic human mutations in worms
1-­‐	
  Study	
  mechanisms	
  of	
  the	
  disease	
  
2-­‐RNAi	
  screens	
  to	
  study	
  funcJonal	
  interacJons	
  of	
  the	
  mutated	
  
protein,	
  and	
  uncover	
  modifiers	
  of	
  the	
  disease	
  
3-­‐	
  Drug	
  screens	
  
Splicing-related Retinitis Pigmentosa mutations in C. elegans
Type of mutation Allele Description Phenotype
p rp -8
point mutation cer22 R2310/2303G No obvious phenotype
indel cer14 H2309/2302del pSte, pLva, pEmb
s n rp -200
point mutation cer23 V683/676L pLva, pEmb, pSte, pMlt
point mutation cer24 S1087/1080L No obvious phenotype
Compounds	
   DMSO	
  
933	
  compounds	
  screened	
  
in	
  prp-­‐8(cer14)	
  and	
  WT	
  
4	
  drugs	
  validated	
  on	
  agar	
  
Doxycycline
Flutamide
Dequalinium Cl
Dronedarone
Wild	
  Type	
   adRP	
  mutants	
  
Mild	
  effect	
   Strong	
  effect	
  
Some FDA-approved drugs can be harmful for adRP patients
prp-8 or snrp-200 mutants Rescue??
Drug
amenable to
high-throughput
screening
Drug screen
Functional replacement of RP genes
Human	
  Prpf3	
   683	
  aa,	
  16	
  Exons	
  
C.	
  elegans	
  prp-­‐3	
   621	
  aa,	
  5	
  Exons	
  	
  
Kiser	
  et	
  al.	
  2018	
  
Screen for modifiers of the disease
Validation of hits from the RNAi screen
N	
  =	
  2	
  
CRISPR	
  
	
  
RETINOSIS	
  PIGMENTARIA	
  
	
  
CANCER	
  
Cancer-related mutations mimicked in C. elegans
Avatar	
  Worms	
   (Quesada	
  et	
  al.	
  2011)	
  
SF3B1	
  is	
  mutated	
  in:	
  
20-­‐28%	
  	
  myelodisplasic	
  syndromes	
  (MDSs).	
  
5-­‐18%	
  chronic	
  lymphocyBc	
  leukemias	
  (CLL).	
  
15-­‐20%	
  uveal	
  melanomas,	
  5.6%	
  breast	
  cancer	
  	
  
C. elegans as a pre-clinical model to identify selective treatments
Normal	
  worms	
  
sHb-­‐1	
  
Mutant	
  worms	
  
sHb-­‐1*	
  
Tumor	
  cells	
  
SF3B1*	
  
Normal	
  cells	
  
SF3B1	
  
5’-CTCGAATTGCTTAAAGCTCACAAGAAAAGTATTCGAAGAGCTGCAATTAATAC/ATTTGGATTTATTG
S1090	
   A1095	
  I1096	
   F1101	
  WT	
  
MUTANT	
  
A1090	
   T1095	
  V1096	
   Y1101	
  
5’-CTCGAATTGCTTAAAGCTCACAAGAAAgcgATcaGAcGAGCaaCtgTgAAcAC/tTTcGGtTacATTG
Humanizing sftb-1 to make it sensitive to Pladienolide
Humanized sftb-1 is sensitive to Pladienolide
Resistance to cisplatin-based chemotherapy
ü 	
  EffecBve	
  treatment	
  for	
  many	
  cancer	
  types	
  
× 	
  	
  	
  Some	
  tumors	
  are	
  resistant	
  to	
  cisplaBn	
  	
  theraphies	
  (intrinsically	
  or	
  acquired)	
  
× 	
  	
  	
  Side-­‐effects	
  
CISPLATIN	
  
Identification of genes involved in cisplatin resistance/sensitivity
Functional validation of candidate genes to confirm resistance/sensitivity
C. elegans and chemotherapy
C.	
  elegans	
  to	
  validate	
  targets	
  
About	
  100	
  candidate	
  genes	
  to	
  influence	
  cisplaJn	
  response	
  in	
  the	
  region	
  9q32-­‐q33.1.	
  
	
  
Which	
  of	
  those	
  genes	
  are	
  implicated	
  in	
  the	
  cisplaBn	
  resistance	
  acquisiBon?	
  
Dr	
  Alberto	
  Villanueva	
  
(Piulats	
  et	
  al,	
  Clinical	
  Cancer	
  Research	
  2018)	
  
García-Rodríguez et al. Dis. Model. Mech. 2018
C. elegans to indetify new genes involved in chemoresistance
Modified	
  from	
  Galluzzi	
  et	
  al.,	
  2012)	
  
Cisplatin: molecular mechanism of action
ROS	
  
Adapted	
  from	
  Waissbluth	
  and	
  Daniel,	
  2013	
  
F27C1.2/CTR1A	
  C.	
  elegans	
  mutants	
  display	
  resistance	
  to	
  cisplaJn	
  	
  
Cisplatin transporters in human, worms and flies
Biomedical	
  Research	
  
C.	
  elegans,	
  a	
  pluricellular	
  model	
  that	
  can	
  fill	
  the	
  gap	
  
between	
  in	
  vitro	
  and	
  translaBonal	
  studies	
  
In	
  vitro	
  	
  
studies	
  
	
  
Preclinical	
  
research	
  
Clinic	
  
Basic	
  
research	
  
Pre-­‐	
  preclinical	
  
research	
  
 
Xènia	
  Serrat	
  	
  
	
  
Carmen	
  Marinez	
  
	
  
David	
  Brena	
  
	
  
Dmytro	
  Kukthar	
  
	
  
Jeremy	
  Vicencio	
  
	
  
Isabel	
  García	
  	
  
	
  
	
  

More Related Content

What's hot

Talimogene (T-VEC) : virotherapy in melanoma
Talimogene (T-VEC) : virotherapy in melanomaTalimogene (T-VEC) : virotherapy in melanoma
Talimogene (T-VEC) : virotherapy in melanoma
Lorenzo Alonso
 
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
ANALYTICAL AND QUANTITATIVE CYTOPATHOLOGY AND HISTOPATHOLOGY
 
Talk 2008-meeting about NAD
Talk 2008-meeting about NADTalk 2008-meeting about NAD
Talk 2008-meeting about NADchenmiaomiao
 
20614 ftp
20614 ftp20614 ftp
20614 ftpsofiles
 
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
QIAGEN
 
Listeria monocytogenes from population structure to genomic epidemiology
Listeria monocytogenes from population structure to genomic epidemiologyListeria monocytogenes from population structure to genomic epidemiology
Listeria monocytogenes from population structure to genomic epidemiology
European Centre for Disease Prevention and Control (ECDC)
 
Widespread human T cell receptor beta variable gene polymorphism: implication...
Widespread human T cell receptor beta variable gene polymorphism: implication...Widespread human T cell receptor beta variable gene polymorphism: implication...
Widespread human T cell receptor beta variable gene polymorphism: implication...
Thermo Fisher Scientific
 
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Maryam Rafati
 
Insights into the tumor microenvironment and therapeutic T cell manufacture r...
Insights into the tumor microenvironment and therapeutic T cell manufacture r...Insights into the tumor microenvironment and therapeutic T cell manufacture r...
Insights into the tumor microenvironment and therapeutic T cell manufacture r...
Thermo Fisher Scientific
 
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...
Thermo Fisher Scientific
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
Aamir Wahab
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochure
Affymetrix
 
Clinical applications of NGS
Clinical applications of NGSClinical applications of NGS
Clinical applications of NGSEastern Biotech
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
QIAGEN
 
Oncolytic Virus Lecture
Oncolytic Virus LectureOncolytic Virus Lecture
Oncolytic Virus Lecturefondas vakalis
 
Parks kmer metagenomics
Parks kmer metagenomicsParks kmer metagenomics
Parks kmer metagenomics
dparks1134
 
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...
Mohamed Khalid Ali Xundhur
 
The Clinical Genome Conference 2014
The Clinical Genome Conference 2014The Clinical Genome Conference 2014
The Clinical Genome Conference 2014
Nicole Proulx
 

What's hot (19)

Talimogene (T-VEC) : virotherapy in melanoma
Talimogene (T-VEC) : virotherapy in melanomaTalimogene (T-VEC) : virotherapy in melanoma
Talimogene (T-VEC) : virotherapy in melanoma
 
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
Effect of miR-21 on Oral Squamous Cell Carcinoma Cell Proliferation and Apopt...
 
Talk 2008-meeting about NAD
Talk 2008-meeting about NADTalk 2008-meeting about NAD
Talk 2008-meeting about NAD
 
20614 ftp
20614 ftp20614 ftp
20614 ftp
 
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
 
Listeria monocytogenes from population structure to genomic epidemiology
Listeria monocytogenes from population structure to genomic epidemiologyListeria monocytogenes from population structure to genomic epidemiology
Listeria monocytogenes from population structure to genomic epidemiology
 
Widespread human T cell receptor beta variable gene polymorphism: implication...
Widespread human T cell receptor beta variable gene polymorphism: implication...Widespread human T cell receptor beta variable gene polymorphism: implication...
Widespread human T cell receptor beta variable gene polymorphism: implication...
 
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
 
Insights into the tumor microenvironment and therapeutic T cell manufacture r...
Insights into the tumor microenvironment and therapeutic T cell manufacture r...Insights into the tumor microenvironment and therapeutic T cell manufacture r...
Insights into the tumor microenvironment and therapeutic T cell manufacture r...
 
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...
Generation of Clonal CRISPR/Cas9-edited Human iPSC Derived Cellular Models an...
 
Next Generation Sequencing
Next Generation SequencingNext Generation Sequencing
Next Generation Sequencing
 
FFPE Applications Solutions brochure
FFPE Applications Solutions brochureFFPE Applications Solutions brochure
FFPE Applications Solutions brochure
 
Clinical applications of NGS
Clinical applications of NGSClinical applications of NGS
Clinical applications of NGS
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
 
Oncolytic Virus Lecture
Oncolytic Virus LectureOncolytic Virus Lecture
Oncolytic Virus Lecture
 
Embed Repro Test
Embed Repro TestEmbed Repro Test
Embed Repro Test
 
Parks kmer metagenomics
Parks kmer metagenomicsParks kmer metagenomics
Parks kmer metagenomics
 
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...
Gene expression profiling in apoptotic mcf 7 cells infected with newcastle di...
 
The Clinical Genome Conference 2014
The Clinical Genome Conference 2014The Clinical Genome Conference 2014
The Clinical Genome Conference 2014
 

Similar to Julián Cerón (IDIBELL)

ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...
ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...
ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...
CatalinaSoto30
 
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Clinical Surgery Research Communications
 
Seminario
SeminarioSeminario
Seminario
claracuadro
 
Updates in diagnosis of TB
Updates in diagnosis of TBUpdates in diagnosis of TB
Updates in diagnosis of TBGamal Agmy
 
Updates in diagnosis of tb
Updates in diagnosis of tbUpdates in diagnosis of tb
Updates in diagnosis of tbGamal Agmy
 
Comparative analysis of gene regulation in mouse rat and human
Comparative analysis of gene regulation in mouse rat and humanComparative analysis of gene regulation in mouse rat and human
Comparative analysis of gene regulation in mouse rat and human
constantina mylona
 
Paneles genómicos en tumores sólidos
Paneles genómicos en tumores sólidosPaneles genómicos en tumores sólidos
Paneles genómicos en tumores sólidos
Mauricio Lema
 
CRISPR cas9 mediated TERT disruption in cancer cells
CRISPR cas9 mediated TERT disruption in cancer cells CRISPR cas9 mediated TERT disruption in cancer cells
CRISPR cas9 mediated TERT disruption in cancer cells
ChiLerFam
 
Right vs Left Sidedness in Colon Cancer.pptx
Right vs Left Sidedness in Colon Cancer.pptxRight vs Left Sidedness in Colon Cancer.pptx
Right vs Left Sidedness in Colon Cancer.pptx
DrMalcolmBrigden1
 
B0211117
B0211117B0211117
CDAC 2018 Cantor liquid biopsies
CDAC 2018 Cantor liquid biopsiesCDAC 2018 Cantor liquid biopsies
CDAC 2018 Cantor liquid biopsies
Marco Antoniotti
 
Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014
Douglas Riegert-Johnson
 
Suppress lung cancer progression via up regulation of linc rna-p21
Suppress lung cancer progression via up regulation of linc rna-p21Suppress lung cancer progression via up regulation of linc rna-p21
Suppress lung cancer progression via up regulation of linc rna-p21
Clinical Surgery Research Communications
 
Molecular biology of colo rectal cancers
Molecular biology of colo rectal cancersMolecular biology of colo rectal cancers
Molecular biology of colo rectal cancers
Neha Seth
 
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Affymetrix
 
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...Simon Gemble
 

Similar to Julián Cerón (IDIBELL) (20)

MCC 2011 - Slide 4
MCC 2011 - Slide 4MCC 2011 - Slide 4
MCC 2011 - Slide 4
 
ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...
ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...
ATM-Deficient Colorectal Cancer Cells Are Sensitive to the PARP Inhibitor Ola...
 
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
Casc15 promotes lens epithelial cell apoptosis in age related cataracts by re...
 
Seminario
SeminarioSeminario
Seminario
 
Updates in diagnosis of TB
Updates in diagnosis of TBUpdates in diagnosis of TB
Updates in diagnosis of TB
 
Updates in diagnosis of tb
Updates in diagnosis of tbUpdates in diagnosis of tb
Updates in diagnosis of tb
 
Comparative analysis of gene regulation in mouse rat and human
Comparative analysis of gene regulation in mouse rat and humanComparative analysis of gene regulation in mouse rat and human
Comparative analysis of gene regulation in mouse rat and human
 
Paneles genómicos en tumores sólidos
Paneles genómicos en tumores sólidosPaneles genómicos en tumores sólidos
Paneles genómicos en tumores sólidos
 
CRISPR cas9 mediated TERT disruption in cancer cells
CRISPR cas9 mediated TERT disruption in cancer cells CRISPR cas9 mediated TERT disruption in cancer cells
CRISPR cas9 mediated TERT disruption in cancer cells
 
Poster_CBCD_2014
Poster_CBCD_2014Poster_CBCD_2014
Poster_CBCD_2014
 
Right vs Left Sidedness in Colon Cancer.pptx
Right vs Left Sidedness in Colon Cancer.pptxRight vs Left Sidedness in Colon Cancer.pptx
Right vs Left Sidedness in Colon Cancer.pptx
 
B0211117
B0211117B0211117
B0211117
 
CDAC 2018 Cantor liquid biopsies
CDAC 2018 Cantor liquid biopsiesCDAC 2018 Cantor liquid biopsies
CDAC 2018 Cantor liquid biopsies
 
Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014
 
Presentation about traineeship
Presentation about traineeshipPresentation about traineeship
Presentation about traineeship
 
Suppress lung cancer progression via up regulation of linc rna-p21
Suppress lung cancer progression via up regulation of linc rna-p21Suppress lung cancer progression via up regulation of linc rna-p21
Suppress lung cancer progression via up regulation of linc rna-p21
 
Molecular biology of colo rectal cancers
Molecular biology of colo rectal cancersMolecular biology of colo rectal cancers
Molecular biology of colo rectal cancers
 
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
 
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...
2011 - Cellular inhibitor of apoptosis protein-1 (cIAP1) can regulate E2F1 tr...
 
Lehrach
LehrachLehrach
Lehrach
 

More from Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch

La aplicación de la CEAL en los estados. Desarrollos recientes
La aplicación de la CEAL en los estados. Desarrollos recientesLa aplicación de la CEAL en los estados. Desarrollos recientes
La aplicación de la CEAL en los estados. Desarrollos recientes
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...
El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...
El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
La agenda de la UE en relación con los gobiernos locales
La agenda de la UE en relación con los gobiernos localesLa agenda de la UE en relación con los gobiernos locales
La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)
La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)
La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
La política d’habitatge com a pilar fonamental de l’Estat del benestar
La política d’habitatge com a pilar fonamental de l’Estat del benestarLa política d’habitatge com a pilar fonamental de l’Estat del benestar
La política d’habitatge com a pilar fonamental de l’Estat del benestar
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
Nuevos tipos de demanda de vivienda: el alquiler de habitaciones
Nuevos tipos de demanda de vivienda: el alquiler de habitacionesNuevos tipos de demanda de vivienda: el alquiler de habitaciones
Nuevos tipos de demanda de vivienda: el alquiler de habitaciones
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
Consejo Juventud de España. La aventura de la emancipación
Consejo Juventud de España. La aventura de la emancipaciónConsejo Juventud de España. La aventura de la emancipación
Consejo Juventud de España. La aventura de la emancipación
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
Joves i emancipació. Fundació Cipriano García
Joves i emancipació. Fundació Cipriano GarcíaJoves i emancipació. Fundació Cipriano García
Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...
Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...
Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
Volum i perfil de la demanda d’habitatge a Catalunya
Volum i perfil de la demanda d’habitatge a CatalunyaVolum i perfil de la demanda d’habitatge a Catalunya
2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf
2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf
2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
L’estat de l’emancipació residencial a Catalunya Context i factors associats
L’estat de l’emancipació residencial a Catalunya Context i factors associatsL’estat de l’emancipació residencial a Catalunya Context i factors associats
L’estat de l’emancipació residencial a Catalunya Context i factors associats
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...
Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...
Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
L’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatge
L’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatgeL’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatge
L’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatge
Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch
 
Workshop Moderated by David Martínez.pdf
Workshop Moderated by David Martínez.pdfWorkshop Moderated by David Martínez.pdf

More from Consorci Universitat Internacional Menéndez Pelayo Barcelona (CUIMPB) - Centre Ernest Lluch (20)

Las organizaciones y alianzas urbanas y el papel de la ciudad
Las organizaciones y alianzas urbanas y el papel de la ciudadLas organizaciones y alianzas urbanas y el papel de la ciudad
Las organizaciones y alianzas urbanas y el papel de la ciudad
 
La aplicación de la CEAL en los estados. Desarrollos recientes
La aplicación de la CEAL en los estados. Desarrollos recientesLa aplicación de la CEAL en los estados. Desarrollos recientes
La aplicación de la CEAL en los estados. Desarrollos recientes
 
El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...
El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...
El papel de la Unión Europea en la definición de la ciudad como sujeto jurídi...
 
La agenda de la UE en relación con los gobiernos locales
La agenda de la UE en relación con los gobiernos localesLa agenda de la UE en relación con los gobiernos locales
La agenda de la UE en relación con los gobiernos locales
 
La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)
La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)
La demanda d’habitatge a l’actualitat (…constatacions demogràfiques i futur)
 
La política d’habitatge com a pilar fonamental de l’Estat del benestar
La política d’habitatge com a pilar fonamental de l’Estat del benestarLa política d’habitatge com a pilar fonamental de l’Estat del benestar
La política d’habitatge com a pilar fonamental de l’Estat del benestar
 
L’habitatge de lloguer de temporada a Barcelona
L’habitatge de lloguer de temporada a BarcelonaL’habitatge de lloguer de temporada a Barcelona
L’habitatge de lloguer de temporada a Barcelona
 
Nuevos tipos de demanda de vivienda: el alquiler de habitaciones
Nuevos tipos de demanda de vivienda: el alquiler de habitacionesNuevos tipos de demanda de vivienda: el alquiler de habitaciones
Nuevos tipos de demanda de vivienda: el alquiler de habitaciones
 
Consejo Juventud de España. La aventura de la emancipación
Consejo Juventud de España. La aventura de la emancipaciónConsejo Juventud de España. La aventura de la emancipación
Consejo Juventud de España. La aventura de la emancipación
 
Joves i emancipació. Fundació Cipriano García
Joves i emancipació. Fundació Cipriano GarcíaJoves i emancipació. Fundació Cipriano García
Joves i emancipació. Fundació Cipriano García
 
Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...
Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...
Generació llogatera: la gran esquerda social. Enquesta sobre les condicions d...
 
Volum i perfil de la demanda d’habitatge a Catalunya
Volum i perfil de la demanda d’habitatge a CatalunyaVolum i perfil de la demanda d’habitatge a Catalunya
Volum i perfil de la demanda d’habitatge a Catalunya
 
2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf
2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf
2024.02.20_Miguel Comino Haro_POLÍTIQUES D'HABITATGE AMB.pdf
 
L’estat de l’emancipació residencial a Catalunya Context i factors associats
L’estat de l’emancipació residencial a Catalunya Context i factors associatsL’estat de l’emancipació residencial a Catalunya Context i factors associats
L’estat de l’emancipació residencial a Catalunya Context i factors associats
 
Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...
Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...
Les mesures a adoptar des de l'Àrea Metropolitana de Barcelona IMPSOL: nous p...
 
L’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatge
L’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatgeL’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatge
L’aportació de la Generalitat per facilitar l’accés dels joves a l’habitatge
 
La política d'habitatge de Barcelona: joves
La política d'habitatge de Barcelona: jovesLa política d'habitatge de Barcelona: joves
La política d'habitatge de Barcelona: joves
 
Workshop moderated by Lazaro Tuñon.pdf
Workshop moderated by Lazaro Tuñon.pdfWorkshop moderated by Lazaro Tuñon.pdf
Workshop moderated by Lazaro Tuñon.pdf
 
Workshop Moderated by David Martínez.pdf
Workshop Moderated by David Martínez.pdfWorkshop Moderated by David Martínez.pdf
Workshop Moderated by David Martínez.pdf
 
Workshop moderated by Celia Ortega.pdf
Workshop moderated by Celia Ortega.pdfWorkshop moderated by Celia Ortega.pdf
Workshop moderated by Celia Ortega.pdf
 

Recently uploaded

Seminar of U.V. Spectroscopy by SAMIR PANDA
 Seminar of U.V. Spectroscopy by SAMIR PANDA Seminar of U.V. Spectroscopy by SAMIR PANDA
Seminar of U.V. Spectroscopy by SAMIR PANDA
SAMIR PANDA
 
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
Scintica Instrumentation
 
Structures and textures of metamorphic rocks
Structures and textures of metamorphic rocksStructures and textures of metamorphic rocks
Structures and textures of metamorphic rocks
kumarmathi863
 
Lab report on liquid viscosity of glycerin
Lab report on liquid viscosity of glycerinLab report on liquid viscosity of glycerin
Lab report on liquid viscosity of glycerin
ossaicprecious19
 
extra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdfextra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdf
DiyaBiswas10
 
Citrus Greening Disease and its Management
Citrus Greening Disease and its ManagementCitrus Greening Disease and its Management
Citrus Greening Disease and its Management
subedisuryaofficial
 
platelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptxplatelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptx
muralinath2
 
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Sérgio Sacani
 
erythropoiesis-I_mechanism& clinical significance.pptx
erythropoiesis-I_mechanism& clinical significance.pptxerythropoiesis-I_mechanism& clinical significance.pptx
erythropoiesis-I_mechanism& clinical significance.pptx
muralinath2
 
What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.
moosaasad1975
 
Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...
Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...
Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...
NathanBaughman3
 
filosofia boliviana introducción jsjdjd.pptx
filosofia boliviana introducción jsjdjd.pptxfilosofia boliviana introducción jsjdjd.pptx
filosofia boliviana introducción jsjdjd.pptx
IvanMallco1
 
4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf
4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf
4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf
ssuserbfdca9
 
Lateral Ventricles.pdf very easy good diagrams comprehensive
Lateral Ventricles.pdf very easy good diagrams comprehensiveLateral Ventricles.pdf very easy good diagrams comprehensive
Lateral Ventricles.pdf very easy good diagrams comprehensive
silvermistyshot
 
Cancer cell metabolism: special Reference to Lactate Pathway
Cancer cell metabolism: special Reference to Lactate PathwayCancer cell metabolism: special Reference to Lactate Pathway
Cancer cell metabolism: special Reference to Lactate Pathway
AADYARAJPANDEY1
 
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Sérgio Sacani
 
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
University of Maribor
 
Structural Classification Of Protein (SCOP)
Structural Classification Of Protein  (SCOP)Structural Classification Of Protein  (SCOP)
Structural Classification Of Protein (SCOP)
aishnasrivastava
 
Mammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also FunctionsMammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also Functions
YOGESH DOGRA
 
GBSN - Biochemistry (Unit 5) Chemistry of Lipids
GBSN - Biochemistry (Unit 5) Chemistry of LipidsGBSN - Biochemistry (Unit 5) Chemistry of Lipids
GBSN - Biochemistry (Unit 5) Chemistry of Lipids
Areesha Ahmad
 

Recently uploaded (20)

Seminar of U.V. Spectroscopy by SAMIR PANDA
 Seminar of U.V. Spectroscopy by SAMIR PANDA Seminar of U.V. Spectroscopy by SAMIR PANDA
Seminar of U.V. Spectroscopy by SAMIR PANDA
 
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
(May 29th, 2024) Advancements in Intravital Microscopy- Insights for Preclini...
 
Structures and textures of metamorphic rocks
Structures and textures of metamorphic rocksStructures and textures of metamorphic rocks
Structures and textures of metamorphic rocks
 
Lab report on liquid viscosity of glycerin
Lab report on liquid viscosity of glycerinLab report on liquid viscosity of glycerin
Lab report on liquid viscosity of glycerin
 
extra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdfextra-chromosomal-inheritance[1].pptx.pdfpdf
extra-chromosomal-inheritance[1].pptx.pdfpdf
 
Citrus Greening Disease and its Management
Citrus Greening Disease and its ManagementCitrus Greening Disease and its Management
Citrus Greening Disease and its Management
 
platelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptxplatelets_clotting_biogenesis.clot retractionpptx
platelets_clotting_biogenesis.clot retractionpptx
 
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
Earliest Galaxies in the JADES Origins Field: Luminosity Function and Cosmic ...
 
erythropoiesis-I_mechanism& clinical significance.pptx
erythropoiesis-I_mechanism& clinical significance.pptxerythropoiesis-I_mechanism& clinical significance.pptx
erythropoiesis-I_mechanism& clinical significance.pptx
 
What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.What is greenhouse gasses and how many gasses are there to affect the Earth.
What is greenhouse gasses and how many gasses are there to affect the Earth.
 
Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...
Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...
Astronomy Update- Curiosity’s exploration of Mars _ Local Briefs _ leadertele...
 
filosofia boliviana introducción jsjdjd.pptx
filosofia boliviana introducción jsjdjd.pptxfilosofia boliviana introducción jsjdjd.pptx
filosofia boliviana introducción jsjdjd.pptx
 
4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf
4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf
4. An Overview of Sugarcane White Leaf Disease in Vietnam.pdf
 
Lateral Ventricles.pdf very easy good diagrams comprehensive
Lateral Ventricles.pdf very easy good diagrams comprehensiveLateral Ventricles.pdf very easy good diagrams comprehensive
Lateral Ventricles.pdf very easy good diagrams comprehensive
 
Cancer cell metabolism: special Reference to Lactate Pathway
Cancer cell metabolism: special Reference to Lactate PathwayCancer cell metabolism: special Reference to Lactate Pathway
Cancer cell metabolism: special Reference to Lactate Pathway
 
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
Observation of Io’s Resurfacing via Plume Deposition Using Ground-based Adapt...
 
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
Comparing Evolved Extractive Text Summary Scores of Bidirectional Encoder Rep...
 
Structural Classification Of Protein (SCOP)
Structural Classification Of Protein  (SCOP)Structural Classification Of Protein  (SCOP)
Structural Classification Of Protein (SCOP)
 
Mammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also FunctionsMammalian Pineal Body Structure and Also Functions
Mammalian Pineal Body Structure and Also Functions
 
GBSN - Biochemistry (Unit 5) Chemistry of Lipids
GBSN - Biochemistry (Unit 5) Chemistry of LipidsGBSN - Biochemistry (Unit 5) Chemistry of Lipids
GBSN - Biochemistry (Unit 5) Chemistry of Lipids
 

Julián Cerón (IDIBELL)

  • 1. Modelos  de  enfermedades  humanas  en  C.  elegans Julián Cerón Madrigal! Laboratori de Genètica Molecular, IDIBELL, Barcelona! Métodos  innovadores  para  reemplazar  la  experimentación  animal  
  • 2. CRISPR     RETINOSIS  PIGMENTARIA     CANCER  
  • 3. 1961 Discovery of the genetic code: every triplet of nucleotides codes for one aminoacid
  • 4. Le0er  from  Brenner  to  Perutz,  1963   It  is  now  widely  realized  that  nearly  all  the  “classical”  problems  of  molecular   biology  have  been  solved.   I  would  like  to  tame  a  small  metazoan  organism  to  study  development   directly.    
  • 5.
  • 6. First C. elegans publication, 1974
  • 7. -­‐  959  somaBc  cells   -­‐  302  neurons   -­‐  Hermaphrodites   -­‐  Easy  to  the  grown  in  the  lab   -­‐  Strains  can  be  frozen  
  • 8. C. elegans is small (0.25 to 1 mm long) DissecJng  microscope  
  • 10. www.wormbase.org www.wormbook.org Easy (and cheap) to cultivate Efficient for genetic analysis Invariable lineage Transparent
  • 11. Apoptosis C.  elegans  has  exactly  959  somaJc  cell    
  • 12. The apoptotic pathway is conserved
  • 14. 1994   Osamu  Shimomura   MarJn  Chalfie  
  • 15.
  • 16. RNAi by feeding in C. elegans
  • 18.
  • 19. Tools  and  techniques   1974 1998 2011 2015
  • 20. CRISPR     RETINOSIS  PIGMENTARIA     CANCER  
  • 21.
  • 22. Convenience of C. elegans for CRISPR
  • 23. CRISPR in C. elegans research -  Produce mutations: point mutations or deletions -  Produce endogenous reporters
  • 24. The use of reporters in model systems
  • 25. EXTRACHROMOSOMAL (high copy) 3XFLAG tag IF anti-FLAG ENDOGENOUS REPORTER
  • 26.
  • 27.
  • 28. Previous  methods  for  generaJng  endogenous  reporters   Paix  et  al.,  2016   FP  inserJon  with  PCR  product  repair  templates   (75%  efficiency  in  gtbp-­‐1)     Dickinson et al., 2015 FP insertion with repair template plasmid (12.5% efficiency in his-72)
  • 29. In our hands: 1 positive after 72 injections and 366 worms genotyped 2016
  • 31. Vicencio et al , 2019
  • 32. Diverse nucleases with distinct PAM sequences, most of them not commercially available as protein
  • 33. Cas9 vs Cpf1 (Cas12a)
  • 34.
  • 35. New CRISPR systems in C. elegans to evaluate: - Toxicity - Specificity - Efficacy
  • 36. Trends in Cell Biology DOI: (10.1016/j.tcb.2019.08.004) Copyright © 2019 Elsevier Ltd Terms and Conditions
  • 38.
  • 39.
  • 40. Prevalence:  1:4000  people   15000-­‐16000  affected  in  Spain     Retinitis Pigmentosa No  cure  for  it   Mechanism  not  unveiled   ≈50%  without  geneBc  diagnosBc   NORMAL VISION TUNEL VISION
  • 41. 24 genes have been associated to adRP 7 SPLICING-RELATED GENES: PRPF3, PRPF4, PRPF6, PRPF8, PRPF31, SNRPN-200 , RP9 Autosomal dominant Retinitis Pigmentosa and splicing Autosomal dominant form: 30-40%
  • 42. A C. elegans model for Retinitis Pigmentosa Rubio-Peña et al, 2015
  • 43. prp-­‐8(cer14[R2302del])  III   prp-­‐8(cer22[R2303G])  III   snrp-­‐200(cer23[V676L])  II   snrp-­‐200(cer24[S1080L])  II   Karinna Rubio-Peña (PRPF8)   (SNRNP200)   Splicing-related Retinitis Pigmentosa mutations in C. elegans
  • 44. CRISPR to mimic human mutations in worms 1-­‐  Study  mechanisms  of  the  disease   2-­‐RNAi  screens  to  study  funcJonal  interacJons  of  the  mutated   protein,  and  uncover  modifiers  of  the  disease   3-­‐  Drug  screens  
  • 45. Splicing-related Retinitis Pigmentosa mutations in C. elegans Type of mutation Allele Description Phenotype p rp -8 point mutation cer22 R2310/2303G No obvious phenotype indel cer14 H2309/2302del pSte, pLva, pEmb s n rp -200 point mutation cer23 V683/676L pLva, pEmb, pSte, pMlt point mutation cer24 S1087/1080L No obvious phenotype
  • 46. Compounds   DMSO   933  compounds  screened   in  prp-­‐8(cer14)  and  WT   4  drugs  validated  on  agar   Doxycycline Flutamide Dequalinium Cl Dronedarone Wild  Type   adRP  mutants   Mild  effect   Strong  effect   Some FDA-approved drugs can be harmful for adRP patients
  • 47. prp-8 or snrp-200 mutants Rescue?? Drug amenable to high-throughput screening Drug screen
  • 48. Functional replacement of RP genes Human  Prpf3   683  aa,  16  Exons   C.  elegans  prp-­‐3   621  aa,  5  Exons    
  • 49. Kiser  et  al.  2018   Screen for modifiers of the disease
  • 50. Validation of hits from the RNAi screen N  =  2  
  • 51. CRISPR     RETINOSIS  PIGMENTARIA     CANCER  
  • 52. Cancer-related mutations mimicked in C. elegans Avatar  Worms   (Quesada  et  al.  2011)   SF3B1  is  mutated  in:   20-­‐28%    myelodisplasic  syndromes  (MDSs).   5-­‐18%  chronic  lymphocyBc  leukemias  (CLL).   15-­‐20%  uveal  melanomas,  5.6%  breast  cancer    
  • 53. C. elegans as a pre-clinical model to identify selective treatments Normal  worms   sHb-­‐1   Mutant  worms   sHb-­‐1*   Tumor  cells   SF3B1*   Normal  cells   SF3B1  
  • 54. 5’-CTCGAATTGCTTAAAGCTCACAAGAAAAGTATTCGAAGAGCTGCAATTAATAC/ATTTGGATTTATTG S1090   A1095  I1096   F1101  WT   MUTANT   A1090   T1095  V1096   Y1101   5’-CTCGAATTGCTTAAAGCTCACAAGAAAgcgATcaGAcGAGCaaCtgTgAAcAC/tTTcGGtTacATTG Humanizing sftb-1 to make it sensitive to Pladienolide
  • 55. Humanized sftb-1 is sensitive to Pladienolide
  • 56. Resistance to cisplatin-based chemotherapy ü   EffecBve  treatment  for  many  cancer  types   ×       Some  tumors  are  resistant  to  cisplaBn    theraphies  (intrinsically  or  acquired)   ×       Side-­‐effects   CISPLATIN  
  • 57. Identification of genes involved in cisplatin resistance/sensitivity Functional validation of candidate genes to confirm resistance/sensitivity C. elegans and chemotherapy
  • 58. C.  elegans  to  validate  targets   About  100  candidate  genes  to  influence  cisplaJn  response  in  the  region  9q32-­‐q33.1.     Which  of  those  genes  are  implicated  in  the  cisplaBn  resistance  acquisiBon?   Dr  Alberto  Villanueva   (Piulats  et  al,  Clinical  Cancer  Research  2018)  
  • 59. García-Rodríguez et al. Dis. Model. Mech. 2018 C. elegans to indetify new genes involved in chemoresistance
  • 60. Modified  from  Galluzzi  et  al.,  2012)   Cisplatin: molecular mechanism of action ROS   Adapted  from  Waissbluth  and  Daniel,  2013  
  • 61. F27C1.2/CTR1A  C.  elegans  mutants  display  resistance  to  cisplaJn    
  • 62. Cisplatin transporters in human, worms and flies
  • 63.
  • 64.
  • 66. C.  elegans,  a  pluricellular  model  that  can  fill  the  gap   between  in  vitro  and  translaBonal  studies   In  vitro     studies     Preclinical   research   Clinic   Basic   research   Pre-­‐  preclinical   research  
  • 67.
  • 68.
  • 69.   Xènia  Serrat       Carmen  Marinez     David  Brena     Dmytro  Kukthar     Jeremy  Vicencio     Isabel  García