This study aimed to determine the localization of the mRNA transport protein She3 in Candida albicans and examine the phenotypic effects of deleting the SHE3 gene. GFP was tagged to She3 to visualize its localization using fluorescence microscopy. One strain exhibited potential nuclear localization of She3-GFP. Western blot detected a faint band for She3-GFP, suggesting it was expressed. Deletion of SHE3 affected filamentation on certain media but not lipase production, indicating She3 influences some virulence factors in C. albicans.

1. Investigation of the localization and phenotypic effects of the mRNA transport
protein She3 in Candida albicans
Amanda Estes- SMCC, INBRE
Mentor: Dr. Anne McBride- Bowdoin College
August 1, 2014

2. 1
Abstract
The yeast Candida albicans is a normally commensal microorganism that can become a
lethal opportunistic pathogen in individuals with immune deficiencies. The ability to form
hyphal cells contributes to its virulence. Optimal growth and host cell invasion by hyphae
require proteins to be located to its tip or its surface by protein transport or the localized
translation of transported mRNAs. She3 protein has been shown to be part of a complex that
transports mRNAs to the hyphal tip, but its localization in cells has not yet been determined.
This study aimed to determine where She3 can be found in C. albicans cells. Yeast cells were
transformed with DNA created to link the coding region of She3 with a green fluorescent protein
(GFP) gene so that She3 could be visualized in cells with epifluorescence microscopy. Budding
yeast cells exhibited nuclear fluorescence, and expression of a GFP-fusion protein was detected
by immunoblot, however further investigation needs to be done to confirm proper She3-GFP
fusion. In addition, the phenotypic effects of She3 were tested by growing cells of strains with
and without She3 on different media to test for filamentation and lipase production.
Filamentation was affected by She3 while lipase action was not.
Introduction
The diploid microorganism Candida albicans is a commensal fungus that is found in
warm-blooded animals. Although it lives as part of the normal microflora of about 70% of all
humans (Hube, 2004), C. albicans can become an opportunistic pathogen. In relatively healthy
individuals, C. albicans can cause local infections in epithelial tissues while in the
immunocompromised, it can progress to life-threatening systemic infections of the organs and
blood stream (Sudbery, 2011). The ability of Candida cells to change from round budding yeast
to long, thin, hyphal cells in response to environmental cues contributes to its pathogenicity
(Mayer, et al. 2013). Although yeast-form cells may be involved in some initial events of host
cell invasion (Saville, et al. 2003), the filaments of hyphae have unique features such as the
ability to adhere to host cells and invade them through endocytosis, that contribute to virulence
(Zhu and Filler, 2010).
In order to function properly, many proteins that contribute to hyphal growth and
other aspects of the cell’s ability to invade host tissues must be located in the hypha or on its
surface (Elson, et al. 2009). For these proteins to arrive at their target destinations, either the

3. 2
proteins themselves are transported, or they are translated from transported mRNAs (Elson, et al.
2009). C. albicans She3, a protein orthologous to an mRNA transport protein in Saccharomyces
cerevisiae that is important for Swi5p-dependent HO expression, has been shown to transport a
set of mRNAs to the hyphal tip (Elson, et al. 2009). In S. cerevisiae, mRNA is transported from
mother to daughter cell by a complex composed of the RNA binding protein She2 bound to She3
protein which itself is connected to Myo4 (myosin) motor protein (Bohl et al. 2000). She2 is
able to enter the nucleus where it binds to an mRNA and then shuttles it out of the nucleus to join
She3 and Myo4, which then moves along an actin fiber to the new cell (Bohl et al. 2000). The
analogous complex in C. albicans cannot contain either She2 or Myo4 proteins, since the C.
albicans genome encodes no She2 or Myo4 ortholog; instead, mRNAs encoding proteins
necessary for the most effective hyphal growth are likely to bind either directly to She3 or to
another mRNA-binding protein. The resulting complex could be transported to the yeast bud
and hyphal tip by another Type V myosin protein, Myo2, which copurifies with C. albicans She3
(Burnim, 2014). C. albicans is able to form hyphae in the absence of She3; however some
defects seen in hyphal formation of she3∆/∆ cells suggest that She3-dependent mRNA transport
may be important to this process, thus She3 may have an effect on virulence (Elson, et al. 2009).
Previous studies have shown the importance of She3 for proper hyphal growth and for
transport of many mRNAs in C. albicans (Elson, et al. 2009) and have identified some of the
proteins with which She3 associates (Burnim, 2014). Yet, no study has determined where She3
localizes in C. albicans budding or hyphal cells. Does She3 stay in the cytoplasm as it does in S.
cerevisiae, or can it be found in the nucleus? One focus of this study is determining the specific
location of She3 protein in C. albicans cells by tagging She3 with GFPγ so that it may be
visualized with epifluorescent microscopy. GFPγ is a variant of GFP engineered to exhibit a
more intense signal and to be more photostable than other versions (Zhang and Konopka, 2009).
These properties were expected to be helpful in visualization of She3, as the C. albicans cell
itself exhibits a fairly high background signal in fluorescence imaging. In addition, while the
presence of She3 has been observed to be important to proper hyphal formation on certain
filament-inducing media (Elson, et al. 2009), this study sought to observe the effects of SHE3
deletion using similar and previously untested types of media. By growing cells on media and in
environments that mimic filament-inducing conditions within a host (Nadeem, et al. 2013), the
effect that absence of She3 has on filamentous phenotypes was observed. Cells were also tested

4. 3
on media to detect lipase activity, a hyphal function of C. albicans that may be affected by She3
but has yet to be investigated.
Methods and Materials
Creation of DNA to link GFPγ::URA3 to SHE3 DNA products were created to
integrate GFPγ into the C. albicans genome at the SHE3 locus, along with URA3, the gene for
uridine synthesis as the selectable marker. Pairs of short oligonucleotides were designed (Table
1) to amplify the 3’ end of the SHE3 coding region along with a plasmid template containing a
cassette of GFPγ::URA3 (Zhang and Konopka, 2009) and the 3’ SHE3 untranslated region
(Figure 1).
Amplification was performed using Fast Start Taq polymerase (Roche) according to the
manufacturer’s protocol and PCR with conditions chosen based on the success of similar
previous experiments conducted in the McBride lab (Zott, 2014): 94°C for 5 minutes, 94°C for 1
minute, 55°C for 1 minute, 72°C for 4 minutes, cycle back to second step 30 times, then 72°C for
4 minutes and 10°C holding step until removal of PCR products. The products were then
analyzed by gel electrophoresis to insure proper amplification of the cassette to the predicted size
of about 2,500 base pairs.
Table 1. Oligonucleotide primers used in this study
Primer Sequence (5’-3’) Description
AM544 CTAAAAGAAGATCAACCTATAATAACAACAACAACAACAACAGCAAAAGAA
ATTCGC
SHE3-GFPγ
forward
AM545 GCCTACAATATATAGTTAATTCCTTCATCGTTATCCATTTTTTTAAAAAAAAAC
TAACGTGTA
SHE3-GFPγ
reverse
Figure 1. Creation of DNA to link
GFPγ::URA3 template to SHE3. A plasmid
template cassette containing GFPγ and URA3
genes was amplified by PCR with a pair of
short oligonucleotides: a 5’ primer
corresponding to the 3’ end of She3 coding
region (blue) and 5’ beginning of GFPγ 3’
(green) and a 3’ primer corresponding to the 3’
end of URA3 (yellow) with the 3’end of She3
untranslated region (orange).

5. 4
Transformation of C. albicans with GFPγ::URA3 PCR product Strains used and
generated in this table are shown in Table 2. The genome of the parental C. albicans strain used
in this study, SE6 (Elson, et al 2009, Table 1), contains only one copy of SHE3 and no URA3.
Transformation of SE6 with the products of the PCR amplification of GFPγ::URA3 with primers
corresponding to the SHE3 coding region was used to create a link of GFPγ to SHE3 in the C.
albicans genome (Figure 2). Cells were transformed according to a protocol provided by the
laboratory of Julia Koehler. SE6 cells (10 mL) were grown overnight at room temperature and
harvested at OD600 of 5. PCR-amplified DNA was added to cells pelleted from 1.3 mL of
culture. Cells were incubated with 40µl of carrier DNA, 40% PEG, Tris EDTA, lithium acetate
and DTT for 1 hour at 30 °C, then heat-shocked in a 42 °C water bath for 45 minutes. Cells were
then collected by centrifuge at 1000rpm for 5 minutes, washed with growth medium lacking
uridine, plated on medium lacking uridine and incubated at 30⁰C for 3 days.
Table 2. Strains used in this study
C. albicans strain Genotypes Source Purpose
SE5
she3Δ/she3Δ
ura3Δ/ura3Δ Elson, et al 2009 Phenotypic assays
SE6
SHE3/she3Δ
ura3Δ/ura3Δ Elson, et al 2009
Phenotypic assays/She3-
GFP localization
AMC99 SLR1-GFP::URA3/slr∆ McBride lab
She-GFP localization
(+GFP)
AEC4 URA3/ura3∆ This study
She3-GFP localization
(-GFP)
SHE3-GFPγ::URA3/she3∆ This study She3-GFP localization
Figure 2. Integrative transformation of PCR
product into C. albicans chromosome. Primers
used to amplify GFPγ::URA3 template also
contain sequences corresponding to SHE3 coding
region 3’ end and beginning of the 3’untranslated
region, allowing for recombination at the coding
region of SHE3 during transformation.
AEC29

6. 5
Microscopy Forty uridine-prototrophic transformants as well as cells of positive and
negative controls (AMC99 with GFP and AEC4 without GFP) were grown shaking overnight in
ura- growth media with glucose in a multi-well plate at 30⁰C. Cultures were diluted in fresh
media and viewed in log phase after 2-3 hours of growth. Budding yeast-form cells (2-5µl) were
placed on agarose coated slides, and viewed with an Olympus BX51 microscope with 100x oil
immersion objective. Images were captured using Q-Capture software with exposure of 15ms
for bright field and 5s for GFP filters.
Western blot Anti-GFP immunoblotting was used to analyze expression of She3-GFP
in the cells that exhibited possible localized fluorescent signal (AEC29), cells known to express a
GFP fusion protein (AMC99) and cells without GFP (AEC4). Log-phase yeast cells were
collected and lysed in RIPA buffer in the presence of protease inhibitors. Total protein levels of
lysates were measured by BIORAD protein assay. Lysates were diluted to a concentration of
3µg/µl of protein (to load 30µg total protein in 10 µl) in Express PAGE loading buffer
(Genscript). Proteins were resolved by 10% SDS-PAGE and transferred to a nitrocellulose
membrane according to manufacturer’s protocol (Genscript). The blot was blocked with 5%
milk in phosphate buffered saline with Tween 20, rinsed, and then incubated with a 1:1000
dilution of anti-GFP primary antibody (Roche) overnight. The next day, the blot was rinsed and
incubated for 45 minutes with a 1:5000 dilution of anti-mouse IgG horseradish peroxidase-
conjugated secondary antibody. The blot was developed using chemiluminescence detection
(Pierce) and imaged in 1, 5, and 15 minute exposures to autoradiographic film.
Phenotypic plate assays Conditions within the C. albicans host that may induce
filamentation of yeast cells can be simulated by growing single colonies on solid media within a
moist environment with temperatures over 35⁰C and factors such as a high pH or nutrient
deprivation (Nadeem, et al. 2013). Filamentation of the ura∆/∆ strains SE5 (she3∆/∆) and SE6
(SHE3/she3∆) (Elson et al., 2009), was tested by spot-plating 5µl of 107
stationary phase cells on
RPMI and Spider media supplemented with uridine. Plates were incubated in a humidified
container at 37⁰C and observed after 8 days. Lipase activity of the same strains was tested by
spotting 3µl of cultures diluted to OD600~0.5 on egg yolk agar plates supplemented with uridine.
Plates were incubated at 37⁰C in humidified container for 2 days and observed every 24 hours.

7. 6
Results
GFPγ::URA3 was amplified by PCR Analysis by gel electrophoresis indicated that
GFPγ::URA3 was amplified by PCR with 5’ and 3’ oligonucleotides that allow for
recombination with the SHE3 coding region, resulting in a band of about 2.5 kbp (Figure 3) and
minor band at about 5 kbp. SE6 cells transformed with the GFPγ::URA3 PCR product produced
56 colonies on plates with Ura- media after incubating in 30⁰C for 3 days. No colonies were
present on Ura- media plated with cells incubated without the GFPγ::URA3 PCR product.
Epifluorescence microscopy detected possible nuclear localization in strains
transformed with GFP::URA3 In order to determine the location of She3 in C. albicans
budding cells, the protein was tagged with GFP to make it visible by epifluorescent microscopy.
Microscopy of over 40 transformants revealed discernible specifically localized fluorescence in
at least one SHE3-GFPγ::URA3 transformant relative to cells known not to express GFP (Figure
4). While many transformants exhibited whole cell fluorescence or no signal at all, some had
areas of signal that may have been localized to the nucleus or cytoplasm, but no determination
could be made due to background cell fluorescence. One transformant (strain AEC29) exhibited
areas of fluorescence that appeared to be specific to the nucleus.
Figure 4. A She3-GFP fusion protein may localize to the nucleus in budding cells . Fluorescent and brightfield
images of the same field were taken of transformants. Brightfield and GFP-filtered images were taken at 15ms and 5s
exposures, respectively.
She3-GFP No GFP
Figure 3. Amplification of GFPγ::URA3 by PCR.
A GFPγ::URA3 cassette was amplified from plasmid
template DNA using primers designed to amplify the
cassette and 3’ end of the SHE3 coding region and the
3’ SHE3 untranslated region. Note minor band in
GFPγ::URA3 lane. PCR products were resolved in
0.8% agarose gel stained with ethidium bromide.

8. 7
Anti-GFP immunoblot detects weak signal of She3-GFP expression An immunoblot
was used to confirm expression of She3-GFP. A 15 minute film exposure of the anti-GFP
immunoblot detected a faint band between the protein size markers of 80-100 kDa (Figure 5) in
the AEC29 lane. Shorter exposures produced weaker bands in the same location. Based on its
amino acid composition, She3-GFPγ has a molecular mass of about 86 kDa. The AMC99 lane
contained a strong band corresponding to the positive control, Slr1-GFP. The strain used that is
known not to contain GFP, AEC4, produced no band in the corresponding lane.
Absence of She3 causes defects in filamentation on RPMI and Spider plates To test
the effect of She3 on filamentation phenotypes, she3∆/she3∆ and SHE3/she3∆ strains were
grown in single colonies on media and under conditions known to induce filamentation in wild-
type strains. After 8 days of growth in 37⁰C in a humidified container, both colonies on the
uridine-supplemented RPMI plate had developed a raised central region of white wrinkled
growth surrounded by a halo of filamentation (Figure 6A). However, SHE3/she3∆ colonies
contained more than double the ratio of peripheral filamentation growth to the central region than
she3∆/she3∆ colonies. The filamentous growth of SHE3/she3∆ colonies also appeared more
uniform, while she3∆/she3∆ colonies exhibited an expanded central region with a small
outgrowth of irregular filaments. On Spider agar with uridine, only SHE3/she3∆ colonies
produced a peripheral outgrowth of filaments (Figure 6B).
Figure 5. Weak band detected between 80-100
kDa in SHE3-GFP::URA3-transformed strain.
Cells of strains transformed with GFP::URA3
were grown overnight in Ura- medium and
collected at log phase. Cells were lysed in RIPA
buffer in the presence of protease inhibitors.
Proteins from lysates were resolved by SDS-
PAGE. Predicted size of She3-GFP is 86.3 kDa
Slr1-
She3-GFP?

9. 8
Lipase activity is not affected by She3 To determine if the absence of She3 inhibited
lipase activity, SE5 (she3∆/she3∆) and SE6 (SHE3/she3∆) strains were grown on egg yolk agar
plates supplemented with uridine and colony zones of precipitation were observed for phenotypic
differences. No differences in lipase action phenotypes were detected after observations at 24
and 48 hours. In addition, the SHE3/she3∆ colony was observed to have central wrinkling
whereas the same region of she3∆/she3∆ was smooth.
Discussion
She3 has been determined to play a role in the normal formation and function of C.
albicans hyphae and contributes to the cell’s ability to damage host cells (Elson, et al. 2009).
This study aimed to provide a more detailed understanding of the mechanism of action of the
transport protein by determining its localization in the cell as well as shedding light on the
importance of She3 by examining the effects of its absence on hyphal form and function in
colonies on previously untested media.
Figure 6. Filamentation is affected by She3.
Cells of each strain (107
in 5µl) were plated by
spotting on RPMI (A) and Spider (B) agar
supplemented with uridine and grown for 8 days at
37⁰C.
SHE3/she3∆ she3∆/∆
A. RPMI
B. Spider
Figure 7. Lipase activity is not affected
by the absence of She3. 3µl of diluted
cells from SHE3/she3∆ and she3∆/she3∆
strains were grown for 48 hours at 37⁰C.
SHE3/she3∆ she3∆/∆

10. 9
Amplification of GFPγ::URA3 PCR products with primers containing SHE3 sequences
produced a band of the expected size when analyzed by gel electrophoresis, along with a minor
band of about 5 kbp (Figure 3). This extra band is most likely due to the detection of the plasmid
template DNA from which the GFPγ::URA3 cassette was derived (Zhang and Konopka, 2009).
Based on epifluorescence microscopy of cells transformed with DNA designed to link
GFP to She3, it is likely that She3-GFP localizes to the nucleus in budding yeast cells (Figure 4),
an interesting finding, as She3 is excluded from the nucleus in S. cerevisiae (Müller, et al. 2011).
However, out of over 40 strains, compared to the control strain known not to contain GFP, only
one transformant provided a discernible specific localization of fluorescent signal. Other cells
did not consistently show a fluorescent signal above background fluorescence, in spite of the
ability of these strains to biosynthesize uridine, which suggested successful transformation of the
GFPγ::URA3 cassette. The GFP tag on the She3 C-terminus may have impeded the expression
of She3-GFP with one strain having a fortuitous mutation that increased expression.
Alternatively, most of the cells may not have been at a stage in growth where the protein is being
expressed at high enough levels for visualization.
A Western blot was performed to confirm the expression of GFP linked to She3 in the
strain exhibiting the most perceptible specific fluorescent signal. A weak band close to the
expected size of 86 kDa was visible in the lane corresponding to this strain (Figure 5). Though
this result coupled with epifluorescence imaging of possible nuclear localization is promising,
further confirmation of She3-GFP expression is required. While the weak signal may be due to
the GFP tag on She3 causing destabilization of the protein, immunoblot analysis of a more
concentrated lysate might rule out the possibility that the visible band is a background signal
rather than an actual protein. Genomic DNA analysis through PCR with oligos that amplify the
5’ and 3’ points of insertion of the GFPγ::URA3 cassette should be performed in the future to
provide more definitive evidence that it has been successfully integrated at the 3’ end of SHE3.
After this analysis confirms the presence of a GFP tag on She3, DAPI staining will allow
confirmation of She3-GFP nuclear localization in budding cells. Additionally, cells should be
observed after the induction of filamentation, to investigate where She3 localizes in the hypha.
For example She3-GFP may localize in the hyphal tip as this is the ultimate destination of
mRNAs dependent on She3 for transport (Elson, et al. 2009).

11. 10
In the event that the above findings of this study are not confirmed in the future, a GFP
tag on the 5’ end of the SHE3 coding region may be more effective to pinpoint the localization of
She3 in budding and hyphal C. albicans cells. As mentioned previously, it may be that
GFPγ::URA3 was integrated at the 3’ end of the She3 coding region, but that the location of the
tag had a detrimental effect on the protein on its functional end, thus, expression was inhibited.
Confirmation of the findings in this study could suggest that C. albicans She3 has a role in
mRNA transport similar to that of She2 in S. cerevisiae, entering the nucleus to bind mRNA and
shuttling it out to the rest of a transport complex to be moved from the mother to the daughter
cell (Bohl, et al. 2000). Furthermore, since it has been shown that She3 copurifies with Myo2 in
C. albicans (Burnim, 2014), if no other proteins are found to copurify with She3, it may be that
the mRNA transport complex in C. albicans consists only of She3 as both the liaison to the
Myo2 motor protein, similar to the role of She3 in S. cerevisiae (Bohl, et al. 2000) and as the
primary mRNA transporter.
To test the effect of She3 on phenotypes of colonies in different environments, the
growth of strains with (SE6) and without (SE5) the protein was compared on different media.
The absence of She3 causes observable defects on the development of filaments on RPMI as
well as on Spider agar plates. On both media, colonies with She3 were able to form a periphery
of filamentous outgrowth from the central colony region, whereas colonies without She3 on
RPMI had very little outgrowth in relation to the central region and none on Spider agar. The
effect of She3 on phenotypes on RPMI medium is a novel finding. Another study (Elson, et al.
2009) had similar results with Spider agar, however, the study did not supplement with uridine,
as the strains used had a gene for uridine synthesis.
Lipase has been found to have a role in hyphal invasion of host cells, (Ghannoum, 2000),
but it is not clear if She3 plays a role in its presence at the hyphal tip. The effect of She3 on
lipase activity was tested by comparing the zones of precipitation on egg yolk agar. Colonies of
cells with and without She3 had almost identical zones of precipitation. This finding indicates
that She3 may not be involved in the transport of mRNA that is translated into lipase and that the
protein itself is transported by another means. The wrinkling of the SHE3/she3∆ colony
indicates filamentation.
In studies that continue this work, the results of the phenotypic plate assays used in this
study should serve as a model to determine if a tag of GFPγ on She3 might affect the protein’s

12. 11
function in proper filamentation. If the GFP tag is on the functional end of She3, it may prevent
She3’s interaction with mRNAs, causing defects in the hyphal activity, including filamentation.
Phenotypes of colonies from strains modified with the tag can be compared to SHE3/she3∆ and
she3∆/∆ colonies to observe possible defects in filamentation.
This study and those of others have been able to utilize the established S. cerevisiae
mRNA transport system as a model to gain insight into a similar system in C. albicans (Burnim,
2014, Elson, et al. 2009, Zott, 2014). Better understanding of the C. albicans system,
specifically how proteins get localized to the hyphal tip, can provide information about factors
that contribute to pathogenicity of this and possibly other infectious microbes.

13. 12
References
Bohl F, Kruse C, Frank A, Ferring D, Jansen RP. She2p, a novel RNA binding protein tethers
ASH1 mRNA to the Myo4p myosin motor via She3p. EMBO J 2000, 19: 5514–5524
Burnim S. Identification of mRNA transport protein complexes in the pathogenic yeast Candida
albicans. Bowdoin College Biochemistry Program Honors Thesis 2014
Elson SL, Noble SM, Solis NV, Filler SG, Johnson AD: An RNA transport system in Candida
albicans regulates hyphal morphology and invasive growth. PLoS genetics 2009, 5(9):e1000664.
Hube B. From commensal to pathogen: stage-and tissue-specific gene expression of Candida
albicans. Current Opinion Microbiology 2004. 7.4: 336-341.
Ghannoum MA. Potential role of phospholipases in virulence and fungal pathogenesis. Clinical
Microbiology Review 2000. 13: 122–143;
Mayer F.L., Wilson D., and Hube, B. Candida albicans pathogenicity mechanisms. Virulence
2013. 4: 119-128
Müller M, Heym RG, Mayer A, Kramer K, Schmid M, Cramer P, Urlaub H, Jansen RP, Niessing
D: A cytoplasmic complex mediates specific mRNA recognition and localization in yeast. PLoS
biology 2011, 9(4):e1000611.
Nadeem S, Shafiq A, Hakim S, Anjum Y, and Kazm S. U. Effect of growth media, pH and
temperature on yeast to hyphal transition in Candida albicans. Open Journal of Medical
Microbiology 2013, 3(3):185-192.
Saville, SP, Lazzell AL, Monteagudo C, Lopez-Ribot JL: Engineered control of cell morphology
in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during
infection. Eukaryotic cell 2003. 2(5):1053-1060.
Sudbery, P.E. Growth of Candida albicans hyphae. Nat. Rev. Microbiology 2011, 9, 737-748.
Zhang C, Konopka JB. A photostable green fluorescent protein variant for analysis of protein
localization in Candida albicans. Eukaryotic cell 2010, 9(1):224
Zhu W., and Filler, S.G. Interactions of Candida albicans with epithelial cells. Cell
Microbiology 2010. (12),273-282.
Zott, AE. Investigating dependence of protein localization on mRNA transport in pathogenic
yeast C. albicans. Bowdoin College Biochemistry Program Honors Thesis 2014