1. SHORT COMMUNICATION
A novel insertion variant of the human IL-23 receptor-a
chain transcript
G Mancini1
, S-h Kan1
and G Gallagher
Genetic Immunology Laboratory, HUMIGEN LLC, The Institute for Genetic Immunology, Hamilton, NJ, USA
Alternative splicing of mRNA is an important mechanism for organisms to enhance protein diversity from a limited number of
genes. In this report, we described a novel exon insertion in the interleukin 23 (IL-23) receptor between exons 9 and 10,
denoted as exon 9a. This 162 base-pair insertion was the only insertion variant discovered in more than 20 IL23R deletion
variants found in the mRNA of mitogen-stimulated peripheral blood mononuclear cells (PBMC). Sequence analysis revealed
that a pair of GT/AG splice donor–acceptor site and several putative cis-acting sequences were present; the insertion was
identified throughout the genome and found to contain homology to the L1 retrotransposon protein. This report describes an
insertion in the IL-23 receptor and due to consequent early termination within the intracellular region, causing a possible non-
responsive receptor isoform.
Genes and Immunity (2008) 9, 566–569; doi:10.1038/gene.2008.51; published online 10 July 2008
Keywords: IL-23 receptor; IL-23; Th17; splice variant; cryptic exon
The proinflammatory cytokine interleukin 23 (IL-23)
signals through a receptor complex comprising the
interleukin 12 receptor b1 (IL-12Rb1) and the interleukin
23 receptor a chain (IL-23Ra).1–3
Mature IL-23 comprises
two subunits, p19 and p40 (identical to the IL-12 p40
subunit), where the p19 subunit binds to IL-23Ra and the
p40 subunit binds to IL-12Rb1.4,5
The IL-23 receptor
complex has been observed to be selectively expressed
on the so-called ‘Th17’ subset of CD4þ
T lymphocytes.6
The function of IL-23 has not been clearly defined,
although it has been reported to work in tandem with
interleukin 6 (IL-6) and interleukin 21 (IL-21) for the
proliferation and functional development of CD4þ
Th17
cells.7–9
During the development of these cells, the
lineage-associated transcription factor RORgT is upregu-
lated. RORgT is then responsible for inducing the
transcription of IL-23R, with its subsequent expression
on the surface of Th17 cells.6
Binding of IL-23 to its
receptor activates STAT3 and IL-17 production is then
induced.10–13
Recently, a small number of IL23R splice variants were
identified in normal lymphoid cell lines and human
tumor cells.14
This study was recently independently
confirmed (Kan et al., personal communication) and
together these recent publications describe exon deletion
splice variants of the human IL-23 receptor complex. In
this report we demonstrate the presence of a novel exon
insertion in that part of the mRNA encoding the
intracellular region of the IL-23Ra, whose translation
would lead to a C-terminally truncated protein.
Additionally, we further support the occurrence of this
exon insertion by demonstrating its presence at low
level in the mRNA of mitogen-stimulated peripheral
blood mononuclear cells (PBMC) from healthy adult
volunteers.
We prepared total RNA from the PBMC of four healthy
adult volunteer donors, stimulated with either 5 mg mlÀ1
concanavalin A, 0.2 mg mlÀ1
lipopolysaccharide, 5 mg mlÀ1
phytohemagglutin, 20 ng mlÀ1
phorbol myristate acetate
plus 1 mM Ionomycin, and 1 mg mlÀ1
of polyinosinic-
polycytidylic acid double-stranded RNA. The RNA was
reverse transcribed and then the cDNA was subjected to
PCR using primers (P5 & P6) as previously described.14
These primers cover the region between exon 4 to exon
11, which encodes the major part of the human IL-23Ra
chain protein (Figure 1a). Following PCR, products
were cloned directly into TOPO-TA pCR2.1 (Invitrogen,
Carlsbad, CA, USA), for further screening and
characterization.
The wild-type (that is, non-variant; for example,
NM_144701) IL23R P5/P6 fragment contains two EcoRI
recognition sites (Figure 1a). Thus, when EcoRI is used to
release the PCR product insert from the cloning vector,
three fragments of the insert are visible: 403 bp (exon
4–7), 155 bp (exon 7–8) and 343 bp (exons 8–11;
Figure 1a). Among the many variants present, one
transcript generated from the phorbol myristate acetate
and Ionomycin-stimulated PBMC demonstrated a novel
digestion pattern that was incompatible with solely exon
deletion variation. This transcript yielded fragments of
505, 332, 155 bp, respectively (Figure 1b) suggesting
that more than one possible alternative splicing event
might have occurred in the transcript: a deletion within
Received 15 April 2008; revised and accepted 10 June 2008;
published online 10 July 2008
Correspondence: Dr G Gallagher, Genetic Immunology Laboratory,
HUMIGEN LLC, The Institute for Genetic Immunology, 2439 Kuser
Road, Hamilton, NJ 08690, USA.
E-mail: g.gallagher@humigen.org
1
These authors contributed equally to this work.
Genes and Immunity (2008) 9, 566–569
& 2008 Macmillan Publishers Limited All rights reserved 1466-4879/08 $32.00
www.nature.com/gene

2. the exon 4–7 region and an insertion in the exon 8–11
region.
Sequence analysis of the cloned variant IL23R tran-
script revealed that a compound splicing event had
occurred within this amplicon: a previously observed
(Kan et al., personal communication) partial deletion of
exon 5 (the first 71 nucleotides), together with a novel
162 nucleotide insertion between exons 9 and 10
(Figure 1c). The alignment of the insertion against the
IL23R gene showed its location to be within intron 9;
5.5 kb downstream of exon 9. A GT/AG splice donor–
acceptor site, required for the pre-mRNA processing,15,16
was discovered on both sides of this 162 bp insertion. In
addition, cis-acting sequences (a polypyrimidine tract
and a possible branch point sequence (CATCGAT)) are
located upstream of the AG splice acceptor site; these are
important and conserved in the splicing acceptor area for
correct binding and recognition of splicesome subunits17–22
(Figures 2a and b). Importantly, these suggest that this
162 bp insertion is likely to be a legitimate cryptic exon
when alternative splicing occurs. For nomenclature
purposes, we termed this cryptic exon ‘exon 9a.’
Although, this 162 bp exon is likely to be introduced as
an in-frame insertion, a TGA stop codon was identified
after the translation of 10 amino acids, causing an early
termination of the IL-23Ra chain protein. This early
termination would result in a truncated intracellular
domain of the IL-23Ra. The truncated intracellular
domain does not extend to the usual three signaling
tyrosine residues in the phosphorylation motif boxes.
Similar to the other splice variant, containing a 67 bp
partial deletion in the exon 11 of the IL23R, was also
found to show a putative intracellular region missing
two of the three signaling tyrosine residues.14
Thus,
binding of IL-23 to an IL-23R complex, containing these
truncated isoforms, may cease the initiation of the
downstream signal transduction. Hence, the 162 bp
insertion, causing a truncated IL-23R, suggests a possible
non-responsive receptor isoform in the IL-23 signaling.
To determine if the exon 9a insertion is found in
previous donors stimulated with various mitogens, a
primer set spanning the exon 9–9a and exon 10–9a
junctions, were used to amplify the cDNA obtained from
all donors with different stimuli for the nested PCR and
real time-PCR. The real time-PCR assay showed a
detection limit of 1 fg of plasmid containing exon 9a. In
Figure 2c, a band of the expected size (162 bp) and of
modest intensity was seen in all samples tested, follow-
ing nested PCR amplification. The low expression of
exon 9a suggests it is an isoform resulting from a rare
alternative splicing of the pre-mRNA. Similar results
were obtained from the real-time PCR showing the
existence of the exon 9a variant in low, but detectable
levels. Relative amounts of exon 9a were 0.003 (con-
canavalin A), 0.055 (lipopolysaccharide), 0.005 (phyto-
hemagglutin), 0.036 (phorbol myristate acetate plus
Ionomycin), and 0.009 (polyinosinic–polycytidylic acid)
of Glyceraldehyde 3-phosphate dehydrogenase, respec-
tively. Therefore, both amplification methods demon-
strated the scarce existence of exon 9a in the individual
cDNA of stimulated leukocytes.
To understand the possible biological function of this
exon 9a insertion within the IL23R gene, a genome-wide
‘BLAT’23
search was carried out to determine if this
insertion exists elsewhere in the human genome. The
results from this search yielded approximately 200
sequences with more than 90% homology. Interestingly,
in most cases these homologous sequences, located on
multiple chromosomes (that is: chromosomes 1, 6, 8, 10,
22, X, etc.), also contained the entire set of splicesome
binding sites including the AG/GT donor–acceptor sites,
polypyrimidine tract and a branch site. These findings
c 1 2 3 4 6 7 8 9 10 119a
E9 E10
5.5 kb 10 kb
5
E9a
a
P5
E 3
297 124 161 146 157 90 103 91 1502
E 4
403 155
EcoRI EcoRI
343
E 5 E 6 E 7 E 8 E 9 E 10 E 11
P6
b
403 bp
343 bp
155 bp
505 bp
343 bp
332 bp
155 bp
1 32 4
Figure 1 Discovery and characterization of IL23R. (a) Primer set and digestion sites in the IL23R amplicon. The number in each box
represents the size of each exon. The P5 (50
-AATGCTGGGAAGCTCACCTACATA-30
)/P6 (50
-GCTTGTGTTCTGGGATGAAGATTTC-30
),
primer set amplifies the IL23R gene from exon 4 to exon 11. The wild type IL23R amplicon contains two EcoRI sites, that when digested, will
yield three fragments with the following sizes: 403, 343, and 155 bp. (b) Digestion products of the IL23R. P5/P6 PCR products were digested
with EcoRI (FastDigest Fermentas, Glen Burnie, MD, USA) for 30 min at 37 1C. The wild type (Lane 1) yields the digestion pattern 403, 343 and
155; HyperLadder IV (Bioline, Taunton, MA, USA) (Lane 2); the pD5 (71 nt) and exon 9a insertion (Lane 3) yields the digestion pattern: 505,
332 & 155 bp, and the pD5 (71 nt) (Lane 4) gives rise to the digestion pattern: 343, 332 and 155 bp. The 505 and 332 bp bands represent the exon
9a insertion and pD5 (71 nt), respectively. (c) Schematic of the pre-mRNA containing both the pD5 (71 nt) and exon 9a insertion splice events.
Shaded area indicates the partial deletion of exon 5. The exon 9a insertion is located in intron 9 that is 5.5 kb downstream of exon 9.
IL-23 receptor splice variant
G Mancini et al
567
Genes and Immunity

3. suggest that this insertional sequence may share similar
function throughout the human genome.
Accordingly, a ‘BLASTx’24
search was carried out
using the 162 bp insertion sequence; the results revealed
a 94% identity to a homologous reverse transcriptase
human retrotransposon L1 protein (AAB60345).25
L1
elements are autonomous non-long terminal repeat
retrotransposons, that is, long interspersed nuclear
elements, which have all the necessary machinery
needed to insert themselves into random locations
throughout the human genome.26,27
Moreover, encoded
in the insertion sequence are multiple stop codons, in all
three reading frames, which suggests that the insertion is
acting as a dominant cryptic exon carrying a termination
message to halt protein translation. Therefore, in some
cases, for example, environmental stress, mitogen
stimulation, we speculate that the IL23R may utilize this
cryptic exon by alternative splicing to generate a
different isoform of the IL-23R producing a shortened
intracellular region to cease downstream signaling. Thus,
the location in the genome in which the transposon is
inserted increases the diversity of the translated protein
isoforms.
In conclusion, we describe here a novel, in-frame,
insertional variant within the human IL23R mRNA
(exon 9a) between exons 9 and 10. The discovery of
such insertions containing high homology throughout
the human genome suggests that the insertion may
include an array of exon information, including splice
signaling for pre-mRNA processing, which could act as a
transposon shuttling itself within the genome to deliver
an early termination message for translation. Addition-
ally, the presence of the exon 9a insertion appears to be
present in small amounts in the cDNA of most mitogen-
stimulated PBMC. This is the first description of an
insertional variant of either the a or b domain of the
human IL-23R complex.
Accession number
The sequence reported in this brief communication has
been deposited in Genbank with an assigned accession
number: AM990337 though EMBL (The European
Molecular Biology Laboratory) Nucleotide Sequence
Database.
Acknowledgements
This work was funded intramurally by HUMIGEN LLC.
All authors are employees of HUMIGEN.
162 bp
intron 9 5451 CACATCGATGTTTATCAGGGATATTGGCCTAAAATTTTCTTTTTTTTGTT 5500
exon9a 1 0
intron 9 5501 GTGTCTCTGCCAGGTTTTGGTATCAGAATGATGCTGGCCTCATAAAATGA 5550
exon9a 1 GTTTTGGTATCAGAATGATGCTGGCCTCATAAAATGA 37
*************************************
intron 9 5551 GTTAGGGAGTATTCCCTCTTTTTCTACTGTTTGGAACAGTTTCAGAAGGA 5600
exon9a 38 GTTAGGGAGTATTCCCTCTTTTTCTACTGTTTGGAACAGTTTCAGAAGGA 87
**************************************************
intron 9 5601 ATGGTACCAGCTCCTCTTTGTACCTCTGGTAGAATGTGGCTGTGAATCCG 5650
exon9a 88 ATGGTACCAGCTCCTCTTTGTACCTCTGGTAGAATGTGGCTGTGAATCCG 137
**************************************************
intron 9 5651 TCTGGTCCTGGACTTTTTTTGATTGGTAGGCTATTAATTACTGCCTCAAT 5700
exon9a 138 TCTGGTCCTGGACTTTTTTTGATTG 162
*************************
1 2 3 105 64 7 98 11
Exon 9 Exon 10
Figure 2 Sequence confirmation and the expression of the exon 9a insertion. (a) Sequencing analysis was performed with the CEQ DTCS kit
on the CEQ8000 Genetic Analysis System (Beckman Coulter, Fullerton, CA, USA). The result of a sample containing the exon 9a insertion
shows part of the 162 bp insertion between exons 9 and 10. BLAST24
and BLAT23
programs were used to search for sequences showing
homology to exon 9a. (b) The upper sequence is the genomic IL23R sequence within the intron 9 and the lower sequence of cryptic exon 9a.
Flanking the insertion, with solid arrowheads above, are the GT/AG donor–acceptor splice sites. Additionally, upstream of the sequence are
the putative splice factor binding sites, the polypyrimidine tract (with solid underline) and the branch point sequence ACATCGA (with
dashed underline). (c) The results of the nested PCR, first amplified with primers spanning the junctions of exons 9 and 9a
(50
-GATCATTCCGAACTGGGTTTTG-30
) and exons 10 and 9a (50
-TGGTATTAACAATAAGATCCTTCTTTTAATCCAA-30
), as the forward
and reverse primers, respectively. Later, amplification was carried out with primer pairs specific for exon 9a, forward primer:
50
-GTTTGGTATCAGAATGATGCTGGC-30
and reverse primer: 50
-CAATCAAAAAAAGTCCAGGACC-30
, yielding an amplicon size of
162 bp. Positive control (lane 1), negative control of first PCR (lane 2), water blank (lane 3), HyperLadder IV (Bioline, Taunton, MA, USA)
(lane 4), empty (lane 5), MegaMan cDNA library (Stratagene, La Jolla, CA, USA) (lane 6), peripheral blood mononuclear cell cDNA without
stimulation (lane 7), stimulated with concanavalin A (ConA) (lane 8), lipopolysaccharide (LPS) (lane 9), phytohemagglutin (PHA) (lane 10),
phorbol myristate acetate plus ionomycin (P/I) (lane 11). The results suggest the presence of exon 9a in all samples of cDNA, although in
slightly higher concentration in the unstimulated and ConA sample, due to band intensity.
IL-23 receptor splice variant
G Mancini et al
568
Genes and Immunity

4. References
1 van de Vosse E, Lichtenauer-Kaligis EG, van Dissel JT,
Ottenhoff TH. Genetic variations in the interleukin-
12/interleukin-23 receptor (beta1) chain, and implications
for IL-12 and IL-23 receptor structure and function. Immuno-
genetics 2003; 54: 817–829.
2 Parham C, Chirica M, Timans J, Vaisberg E, Travis M, Cheung
J et al. A receptor for the heterodimeric cytokine IL-23 is
composed of IL-12R beta 1 and a novel cytokine receptor
subunit, IL-23R. J Immunol 2002; 168: 5699–5708.
3 Beadling C, Slifka MK. Regulation of innate and adaptive
immune responses by the related cytokines IL-12, IL-23, and
IL-27. Arch Immunol Ther Exp (Warsz) 2006; 54: 15–24.
4 Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B et al.
Novel p19 protein engages IL-12p40 to form a cytokine, IL-23,
with biological activities similar as well as distinct from IL-12.
Immunity 2000; 13: 715–725.
5 Shimozato O, Ugai S, Chiyo M, Takenobu H, Nagakawa H,
Wada A et al. The secreted form of the p40 subunit of
interleukin (IL)-12 inhibits IL-23 functions and abrogates IL-
23-mediated antitumour effects. Immunology 2006; 117: 22–28.
6 Annunziato F, Cosmi L, Santarlasci V, Maggi L, Liotta F,
Mazzinghi B et al. Phenotypic and functional features of
human Th17 cells. J Exp Med 2007; 204: 1849–1861.
7 Yen D, Cheung J, Scheerens H, Poulet F, McClanahan T,
McKenzie B et al. IL-23 is essential for T cell-mediated colitis
and promotes inflammation via IL-17 and IL-6. J Clin Invest
2006; 116: 1310–1316.
8 Wozniak TM, Ryan AA, Britton WJ. Interleukin-23 restores
immunity to Mycobacterium tuberculosis infection in IL-
12p40-deficient mice and is not required for the development of
IL-17-secreting T cell responses. J Immunol 2006; 177: 8684–8692.
9 Bettelli E, Korn T, Kuchroo VK. Th17: the third member of the
effector T cell trilogy. Curr Opin Immunol 2007; 19: 652–657.
10 Happel KI, Zheng M, Young E, Quinton LJ, Lockhart E,
Ramsay AJ et al. Cutting edge: roles of Toll-like receptor 4 and
IL-23 in IL-17 expression in response to Klebsiella pneumo-
niae infection. J Immunol 2003; 170: 4432–4436.
11 Dong C. Diversification of T-helper-cell lineages: finding the family
root of IL-17-producing cells. Nat Rev Immunol 2006; 6: 329–333.
12 Cho ML, Kang JW, Moon YM, Nam HJ, Jhun JY, Heo SB et al.
STAT3 and NF-kappaB signal pathway is required for IL-23-
mediated IL-17 production in spontaneous arthritis animal
model IL-1 receptor antagonist-deficient mice. J Immunol 2006;
176: 5652–5661.
13 Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL.
Interleukin-23 promotes a distinct CD4 T cell activation state
characterized by the production of interleukin-17. J Biol Chem
2003; 278: 1910–1914.
14 Zhang XY, Zhang HJ, Zhang Y, Fu YJ, He J, Zhu LP et al.
Identification and expression analysis of alternatively spliced
isoforms of human interleukin-23 receptor gene in normal
lymphoid cells and selected tumor cells. Immunogenetics 2006;
57: 934–943.
15 Smith PJ, Zhang C, Wang J, Chew SL, Zhang MQ, Krainer AR.
An increased specificity score matrix for the prediction of
SF2/ASF-specific exonic splicing enhancers. Hum Mol Genet
2006; 15: 2490–2508.
16 Black DL. Mechanisms of alternative pre-messenger RNA
splicing. Annu Rev Biochem 2003; 72: 291–336.
17 Ars E, Serra E, de la Luna S, Estivill X, Lazaro C. Cold shock
induces the insertion of a cryptic exon in the neurofibroma-
tosis type 1 (NF1) mRNA. Nucleic Acids Res 2000; 28:
1307–1312.
18 Sridharan V, Singh R. A conditional role of U2AF in splicing of
introns with unconventional polypyrimidine tracts. Mol Cell
Biol 2007; 27: 7334–7344.
19 Kwan T, Benovoy D, Dias C, Gurd S, Provencher C, Beaulieu P
et al. Genome-wide analysis of transcript isoform variation in
humans. Nat Genet 2008; 40: 225–231.
20 Garcia-Blanco MA, Baraniak AP, Lasda EL. Alternative
splicing in disease and therapy. Nat Biotechnol 2004; 22:
535–546.
21 Graveley BR. The haplo-spliceo-transcriptome: common
variations in alternative splicing in the human population.
Trends Genet 2008; 24: 5–7.
22 Jaillon O, Bouhouche K, Gout JF, Aury JM, Noel B, Saudemont
B et al. Translational control of intron splicing in eukaryotes.
Nature 2008; 451: 359–362.
23 Kent WJ. BLAT—the BLAST-like alignment tool. Genome Res
2002; 12: 656–664.
24 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z,
Miller W et al. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Res 1997; 25: 3389–3402.
25 Holmes SE, Dombroski BA, Krebs CM, Boehm CD, Kazazian
Jr HH. A new retrotransposable human L1 element from the
LRE2 locus on chromosome 1q produces a chimaeric insertion.
Nat Genet 1994; 7: 143–148.
26 Prak ET, Kazazian Jr HH. Mobile elements and the human
genome. Nat Rev Genet 2000; 1: 134–144.
27 Wicker T, Sabot F, Hua-Van A, Bennetzen JL,
Capy P, Chalhoub B et al. A unified classification system for
eukaryotic transposable elements. Nat Rev Genet 2007; 8:
973–982.
IL-23 receptor splice variant
G Mancini et al
569
Genes and Immunity