Industrial America From The American Steel Industry To The...

Industrial America from the American Steel Industry to the...
Industrial America from the American Steel Industry to the Early 1970's
The steel industry has been profoundly important to the development of USA by its value of output, input to the American manufacturing industries
and in terms of the extent of its employment in the past. It's been important because of its political clout of its corporations and finally it's been
important for strategic reasons.
Background to the American Steel Industry
The industry dates from mid 19th century when it grew out of the iron industry. There was huge demand for steel following the end of the Civil War
and the building of the great trans–continental railway. The industry centred in Pittsburgh where the classic... Show more content on Helpwriting.net ...
Appalachian deposits of iron ore become very much depleted and development of ore deposits to the West of Lake Superior was accelerated. The
Mesabi Range ores has been worked by Rockefeller since 1892. Open–cast production kept costs low, as did the great and advances in ore–carriers
which transported the ores east wards through the Great Lakes. Technological advance allowed lower grade taconite ores to be beneficiated and so
enabled them to bear the transport costs to the steel mills further east.
Demand for Steel: This continued to rise in aggregate throughout much of the first half of the 20th century. The nature of the demand altered however.
Much less steel was now needed for rails, but structural steel became increasingly important as did rods, wire, tubes and pipes; steel was needed for
tinplate and also very significant amounts were demanded by the transport industries.
Organisation of the industry: At the turn of the century, there was much horizontal integration and merger activity reflecting, amongst other things, a
desire to reduce competition and to increase the scale of enterprises. Some companies became involved in vertical integration, being particularly
anxious to secure their supplies of coking coal and iron ore (the US relied very heavily on indigenous
... Get more on HelpWriting.net ...

A Strategic Analysis Of Onesteel Limited
Student Name: ZUIJIA LIU Student Number: 42280099
MGTS3301 ASSIGNMENT
A Strategic Analysis of OneSteel Limited
Student Name: ZUIJIA LIU Student Number: 42280099 Tutor: Alexander Stathakis Lecturer: Martina Linnenluecke
MGTS3301–Business Policy and Strategy (A Strategic Analysis)
1
Student Name: ZUIJIA LIU Student Number: 42280099
Contents 1. Introduction.................................................................................3 1.1 Report Overview............................................................................3 1.2
Organisation Overview...................................................................3 2. External Environmental Analysis.......................................................4 2.1 Analysis
of Macro Environment........................................................4–5 2.2 Analysis of Industry Environment.....................................................5–6 2.2.1 Threat of
New Entrants..............................................................6 2.2.2 The ... Show more content on Helpwriting.net ...
Economical: Strong Australian currency affects steel manufacturing export and import (Smith 2011) Job cuts and industry shuts due to weak domestic
demand and downturn in the construction industry (ABC News 2011). Social: Changing in preference: the growing availability of alternative
materials may replace steels such metallic glass (Vieru 2011). Skilled worker shortage in Australia (BusinessSpectator 2012) Technological: With the
development of steel industry, new renewable resources are required due to nonrenewable resources will be less and less such as iron ore and carbon
(Szargut, Ziebik & Stanek 2002) Environmental: Steel Industry has impacts on air quality due to the emissions, which may lead climate change.
Environmental pollution requires steel business to reduce the emission in order to develop a clean energy future by advanced technology. Water
saving issue. (Costello 2011) Legal: Changes in taxation regulation such as the federal government passed 30% tax on iron ore and coal mining profit
(Scott 2012).

Among those external aspects, four factors should be addressed which are political, economical and environmental. From the political perspective, the
federal government offers this assistance to adapt and modify steel business models, which to ensure long–term
MGTS3301–Business Policy and Strategy (A Strategic Analysis)
4
Student

Tantalum: A Valuable Ore Essay
Coltan is a tantalum–bearing ore that is very rare, valuable and highly sought all over the world (Hayes & Burge 2003: 11). Tantalum has double the
density of steel and is extremely resistant to heat and corrosion (Hayes & Burge 2003: 11). In the majority of high–tech electronics such as computers,
mobile phones, and game consoles, it is used as capacitors or super–alloys to conduct electric charges in these electronic equipments (Bleischwitz et al.
2012: 20). Almost a decade ago, Australia was the leading country responsible for 60% of the world's tantalum production (Hayes & Burge 2003: 11).
However, in 2008, the largest Australian tantalum producer called Talison, faced a financial crisis and suffered a downfall in the global market
... Show
more content on Helpwriting.net ...
2012: 21). The country is very rich in coltan holding approximately 80% of the world's coltan reserves and as a result, is also associated as a
"blood diamond of the digital age" (Mantz 2008: 36). The production of Tantalum in the Kivus region began around the same time as the first year
Congo war in 1996 (Jackson 2003: 7). Coltan became a highly sought commodity beginning in the late 1990s and early 2000s with the sudden global
demand for cellular devices and Sony PlayStations (Mantz 2008: 36). This resulted in a "Klondike–style" rush within the DRC where people began to
surface–mine coltan in the World Heritage Site National Parks – controlled by rebel–armed groups (Hayes & Burge 2003: 11). Majority of the people
employed in the coltan mining industry are impoverished and low–skilled with about 8–10 million people (roughly 16% of the DRC population)
dependant on this activity for survival (Bleischwitz et al 2012: 11). On top of earning only about $1–5 USD per day, most of these miners are also in
dire debt to local traders and higher–level authorities (Bleischwitz et al 2012: 11). Armed conflict, poverty, and economic instability force most of the
people of the DRC into the mining industry (Garrett & Lintzer 2010: 401). Coltan mining in the Congo has thus, caused death to become a currency in
order for efficient capital flow within the group of digital distributors and investors (Mantz 2008: 37). Social and Political Impacts Corruption and
violence

A Report On Anglo Multinational Company
1. INTRODUCTION: –
1.1HISTORY OF ORGANISATION:–
BHP Billiton is Anglo–multinational company dealing out with mining, petrol products and metals, where its head quarter is been located in Australia.
The merging of both the company was done in the year 2001. Before merging both companies were carrying out their private business. BHP an
Australian company in year 1885 was formed under the name of Broken Hill Proprietary Company, mainly dealing with petroleum, mining and steel.
Along with that the company was participating in the invention, producing, and marketing of natural resources like iron ore, coal, copper, oil and gas,
diamonds, silver, lead, and zinc, and also did business like transport and logistics, corporate services. Furthermore, Billiton a company of Netherland
was named under an island known as Tin–rich was developed in 1860 and became part of Royal Dutch/Shell group in 1970. Billiton was a global
leader in mining of aluminum, steaming coal, nickel and growing copper portfolio.
1.2COMPANY STRUCTURE:– BHP Billiton is divided into 7 business units, Aluminum, Base metal, Stainless steel materials, Petroleum, Carbon
steel materials, Energy coal and Diamond specialty products. Along with these BHP Billiton possess a mineral discovering group, technology, freight
transport and logistic operations.
1.3COMPANY SCOPE:–
To maintain safety and environment policies, integrity, high performance, win–win relationship and respect of each and other companies. The

Disadvantages Of Science In Mining
Science in Mining
Introduction: There is a lot of physical strengths involved in mining. However, before people mine any landscape, they need people like: geologists,
mathematicians, biologists, engineers, economists, geographers, and other experts from narrower areas (mineralogists, geophysicists& petrologists) to
plan & acknowledge all of the outcomes of their decisions (how mining is going to affect environment: flora & fauna, locals or people living around
that area and the land itself).
A: Sciences: There are 2 major types of sciences that mining critically needs: Location– finds/plans/engineers/researches information about chosen area,
tells cost/outcomes/plans of the area.
–These are: Geography, Geophysics, Economic Geology, & Math.
Extraction– extracts/identifies types of rocks/soils, uncovers origin/deformation and helps to recover the land.
–These are: Geochemistry, Mineralogy, Petrology, Structural Geology, Mining Geology, & Mining Engineering.
B: Various types of Sciences help in mining of ores & minerals.
Geochemistry– helps to measure and identify properties/types of minerals in given environment.
Geography– provides with a correct location and information about land.
Geophysics– provides with information (e.g. temperature maps) about subsurface characteristics: geological structure, groundwater, impurities &
human artifacts.
Economic Geology– shows the rates/cost of certain metals/minerals, gives predictions about lifetime of ores and their costs.

Case Study : Oxley Metals Limited Essay
1.Overview of allocated company
Company Name
Centrex Metals Limited (CXM)
Ranking in ASX
–
Location of the business headquarters
L 11 147 Pirie St
Adelaide, South Australia 5000
Australia
Size of the company (market capitalization)
Market capitalization is calculated by the shares outstanding times share price, indicating the total market value of company equity.
20,190,000
Number of employees
12
Number of branches/stores
There are mainly four projects: Oxley Potash Project(WA), Goulburn Polymetallic Project (NSW), Gundaroo Gold Project(NSW), and South Australia
Iron Ore Portfolio which includes Wilgerup Hematite Iron Ore Project, Port Spencer Joint Venture, Eyre Iron Magnetite Joint Venture and Bungalow
Magnetite Joint Venture.
Business/industries it is involved in
Centrex Metals Limited is a public iron ore mining company, which was found in 2001. This Australian company specializing in iron ore mining and
exploration, which has its own operation and tenement holdings over iron ore resources. Their targeted iron ore resources are mainly in Eyre
Peninsula located in south of Gawler Craton, South Australia; and they have been expanding their projects over Australia that are classified as Potash,
Base metals and Gold exploration. They have been cooperating globally to expand their business. Centrex Metal Limited has been switching their
business goal from iron ore over–exploration to diversify their products in order to lower its portfolio risks and their business

External Analysis Tools Pest, Porter 's Five Forces And...
1.The industry which Nucor operates can be described using the external analysis tools PEST, Porter's Five Forces and Major Strategic Groups.
Environmental Analysis – PEST
Political
State Tax Breaks: In the U.S., when a manufacturing firm is looking for a new location to set up operations, there is a large incentive for local
governments to offer large tax credits towards the organization in order to entice them to locate within their region. This is because the jobs that a
manufacturing plant brings greatly improve the prosperity of the region. An example of the tax breaks available is when Nucor opened a steel mill in
North Carolina costing $300 Million, Hertford County offered Nucor $155 Million in tax breaks to bring 300 jobs to the region.
Anti–Dumping Tariffs: During the early 2000's, U.S. Steel prices were plummeting to 20–year lows and all but the two largest manufacturers were
posting losses. In 2001, Bush posted anti–dumping tariffs in order to protect the US steel industry from bankruptcy. While this upset the World Trade
Organization, steel prices began to recover in 2002 and 2003 until Bush withdrew the tariff. In addition, China imposed their own three–year tariff on
Imports which improve steel prices as well.
Economic
Rising Energy and Ore Prices: Energy and ore prices have continued to increase, threatening integrated mill producers. In addition, U.S. steel scrap
prices have been increasing, affecting mini–mill producers the same. With these

The Impact Of Geospatial Modelling On Geological Science
Literature Review
Geospatial modelling is a fast advancing method that is progressively being applied in geological science. The basics to developing an outstanding
mineral prospectivity maps is the formation of subordinate spatial information maps which can by be utilized by the modelling programming from
geophysical, geochemical and geologic records (Partington and Sale, 2004). Available data should be reclassified in other to conform to themineral
exploration being applied.
Most mineral exploration prospect is carried out by examining prospect records of database of mineral occurrence. Though this kind of analysis has
proven to be efficient, other regions are now properly investigated, hence this kind of method is not appropriate to delineate subsurface ore deposit or
new ore body. A valid prospecting can only be achieve when available data are assembled and combined in other to conform to the mineral model
being applied.
The data accessible to evaluate the capability of a region for mineralisation are derived from different recent exploration exercise, government surveys
and research associations. These data includes regional geology map, remote sensing data, regional geochemistry data and geophysical data. Due to the
size, volume and diversities of the data, the interpretation and integration becomes so tedious. Therefore, it is important for exploration targeting that a
thorough investigation of the gathered datasets is done with regards to each other and that

Satin Spar Research Paper
Minerals can be used for a variety of different things. Without knowing it, they could be in the walls of a house, or there could be minerals in food.
Also in Hollywood, Gypsum is used as fake snow("Other Uses of Gypsum"). Gypsum has different forms like Alabaster, and Satin spar. Having
different forms contributes to the reason why it has many different uses. Alabaster is known as a healing rock and is used for meditation. It also is
very chalky while Satin spar is known for being very silky (Desy 1). Overall, Gypsum is utilized in everyday life because it can be used for a
variety of different things like industrial items and food. Gypsum takes part in a lot of different industrial uses. It can be used in a wallboards, glass,
and plaster. This means that there could be Gypsum in the walls of your house, so it really is in everyday life. It is also used in cement. Cement is
made by a process that consists of limestone, clay, water, and Gypsum. "Limestone is first heated with clay and then ground down. Gypsum is then
added to the mix and when the powder is mixed with water, a reaction between the gypsum, water and other chemical... Show more content on
Helpwriting.net ...
Gypsum is a great example because it can be used for industrial things, like a house, or can be in food items. Essentially, when Gypsum is used in a
house, there are many different benefits. It could be lifesaving if your house was on fire or overheating. In addition, Gypsum in food can help you
take in more calcium, which is essential to the human body. Gypsum has many other surprising uses that is not just for industrial or food use. Also
other minerals like Fluorite can be used in toothpaste or Diamonds can be used as jewelry or for industrial use to cut materials. Overall, minerals are
used in everyday life because they surround you. They are in the food at the grocery store, in the walls of houses, in toothpaste, and in many other
things that you use

Bioleaching of Gold Ore
RESEARCH ART I C L E
Insights intothe dynamics of bacterial communities during chalcopyrite bioleaching
Zhiguo He1,2, Fengling Gao1,2, Jiancun Zhao1,2, Yuehua Hu1,2 & Guanzhou Qiu1,2
1School of Minerals Processing and Bioengineering, Central South University, Changsha, Hunan, China; and 2Key Laboratory of Biometallurgy,
Ministry of Education, Changsha, Hunan, China
Correspondence: Zhiguo He, School of
Minerals Processing and Bioengineering,
Central South University, Changsha, Hunan
410083, China. Tel./fax: 186 731 88879815; e–mail: zhighe@gmail.com
Received 19 December 2009; revised 14 April
2010; accepted 17 June 2010.
Final version published online 3 August 2010.
DOI:10.1111/j.1574–6941.2010.00943.x
Editor: Alfons Stams ... Show more content on Helpwriting.net ...
Biological
4Fe3Гѕ Гѕ 2H2O
FEMS Microbiol Ecol 74 (2010) 155–164 c 2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
MICROBIOLOGY ECOLOGY
Acid generation (reaction 4):
S0 Гѕ 3=2O2 Гѕ H2O !
Biological
2HГѕ Гѕ SO2
4
Acid generation (reaction 5):
3Fe3Гѕ Гѕ 2SO2
4 Гѕ 6H2O ГѕMГѕ2MFe3Г°SO4Гћ2Г°OHГћ6 Гѕ 6HГѕ

Denaturing gradient gel electrophoresis (DGGE) has been shown to detect differences in the melting behavior of small
DNA fragments (200–700 bp) that differ by as little as a single base substitution. It is well established that DGGE offers a rapid culture–independent
method for detecting and identifying predominant PCR–targeted populations (Casamayor et al.,
2000). DGGE is a powerful and convenient tool for a study such as the present one, which requires sampling of several points and at different times.
The objectives of this study were to determine the full extent of microbial diversity of an acid mine drainage (AMD) sample from the Yunfu pyrite
mine, and determine as to which population members are the most successful chalcopyrite–bioleaching strains. Firstly, we identified the complete
phylogeny of an AMD sample from the
Yunfu sulfidemine by restriction fragment length polymorphism
(RFLP). Then, we monitored the changes in the diversity of microorganisms during the bioleaching of chalcopyrite with biomass collected from the
AMD

Bhp Billiton Ltd Essay
1.1 Introduction
1.1.1 BHP Billiton Company Background
BHP Billiton Limited was founded in the year 2001 as a merger between Australian Broken Hill Proprietary Company and the Anglo–Dutch Billiton
Plc. BHP Billiton is a dual listed company and well known as the leading global resources and the largest mining company in the world measured from
its revenue. The headquarters is in Melbourne, Australia and a major management office in London, UK. They have more than 100,000 employees and
contractors across the 25 nations. BHP Billiton is the major producers of commodities namely energy coal, aluminum, iron ore, minerals, copper,
manganese, uranium, nickel, and mining in oil, gas, and diamond. They have more than 100 mining and ... Show more content on Helpwriting.net ...
Their main focus is to create effective strategic framework that capitalizes on the strong market consumer direction, cash optimization from their assets,
and maximizing their financial strength. By doing so, the company not only becomes effective, but also efficient and furthermore, it strengthens their
business position in the global market.
The other strength of BHP Billiton is their development expertise. Development expertise refers to professionals that are formed to be R&D
(Research and Development) division, which their duty is to develop new products to meet the market demands and give the best products for the
clients. Hence, it is their competitive advantages that distinct them from their competitors. Furthermore, with the diversity of their products, they are
able to mitigate their productions easily to other countries / nations since their productions are well distributed over the world.
Additionally, BHP Billiton is able to tackle all the possible challenges from their competitors by implementing effective strategies and approaches. This
particular strength is considered as the most powerful ability of BHP Billiton that can help them to maintain their performance in the business and
guard their crown over the competitors.
Weaknesses
As BHP Billiton has become a giant company in the industry,

Falvon Corporate Profile Essay
Corporate Profile
Get to know us, our business and how we perfected it. Falvon is highly active in Metals & Mining and Oil & Gas sectors.
Global Business
Falvon is a young international company operating in mining, metal recycling and Oil & gas sectors dealing in Iron Ore, Coal, Metal Scrap and
Bitumen.
Gain With Us
Favlon is always open towards to new projects.We also appreciate traders and brokers to gain with us.We have Opportunities in Coal,Iron Ore, Oil &
Gas, and Scrap Metal commodities.We are interested to hear from you.
Corporate profile main page
Falvon is a growing international company (ONT CORP#) active in oil & gas, mining, and metal recycling sectors with our corporate headquarters in
Mississauga, Ontario, Canada.We are... Show more content on Helpwriting.net ...
Falvon can supplies both magnetite and hematite iron ore grades.High Grade iron ore ranging from 63.5% + upto 71% possible. We can supply iron
ore Fe 56–58% also.We can supply iron ore from Australia, Brazil, Chile, Iran, India, and Mexico. We are happy to work with iron ore exporters,
traders and brokers.
Bitumen/Asphalt
Bitumen or Asphalt is a black in colour and highly viscous liquid or semi–solid form of crude oil.This product is found both in natural deposits or is
refined.The leading use of bitumen/asphalt (about 70%) is in road construction where it is used to create asphalt concrete with added particles.Other
main uses is for waterproofing products, roofing, and sealing.
Falvon offers a full range of high quality bituminous products which include Paving Bitumen, Viscosity Bitumen, Conventional Bitumen, PEN grade
Bitumen, Cutback Bitumen, Industrial Bitumen, Fluxed Bitumen, Polymer Modified bitumen (PMB), Bitumen Paints and other Bitumen

Mining of Tin
Tin Tin is one of the oldest elements that has been used and mined by mankind. Tin is used as cans in the food industry, construction products, oil filter
in the automobile industry, and miscellaneous applications, such as cookie pans, furnace filters, toys and bulletin board. The chemical symbol fortin is
'Sn' which originated from the latin word 'Stannum' which means tin in latin. After Britain was invaded by Anglo–Saxon, 'Stannum' was changed to
'tin' which we have been using until today. Tin is a white, silvery and soft element. It has an atomic number and an atomic weight of 118.70. The
melting point of tin is 505.8K, and tin exist as a solid in room temperature. In the periodic table, tin is in period 5, group 4. Tin is an element which is
rust and corrode resistant element. It will dissolve easily in concentrated acid and will also react with halogens to from other compound.In the earth's
crust, pure tin is not abundant. It was estimated that only 1 to 2ppm of pure tin exists in the earth's crust. Tin usually exists in a form of tin oxide
(SnO2), which is commonly none as Cassiterite. The colour of cassiterits are, brown, black or reddish brown Cassiterite is formed in 2 types of
geological earth structure, which is in the hydrothermal veins and in pegmatite, both by granite intrusion. In the hydrothermal veins contains hot fluid
with dissolve metal. The hot fluid comes from groundwater, seawater, magma, or chemical reaction from metamorphaism. As the hot fluid

History Of Gold, Legends, And The World Of The Legend Of...
Gold, legends have been made about it especially the legend of El Dorado but maybe the city isn't actually a city just a plot of land that has
produced 40% of all the worlds gold ore. Witwatersrand Basin located in Johannesburg, South Africa has been called the richest gold field ever
mined. In 1970 it produced 79% of the worlds gold output, but as a mineral that takes hundreds of years to produce it was mined out, by 2009 it
produced less that 9%. Gold has been a sign of wealth since the earliest civilizations, being made into jewelry, money, or other materialistic objects.
Therefore, making gold a nice commodity to have access to, although not many people do. The first person to mine Witwatersrand Basin was J.H.
Davis a British prospector came across the land in 1852 where he walked away with ВЈ600 worth in gold. Years later Jan Gerritze Bantjes was called
"the first and original discoverer of one of the gold fields" in June 1884 since none of the earlier miners owned the land. Due to the large area covered
in this basin many new fields were found each richer than the last. Today the land is mined by Witwatersrand GoldMining Company Ltd created in
1886 was the first mining company on the reef. Most of the mining conditions in the early 1900's was harsh and dangerous; the mines were dark and
the infrastructure of them were questionable. Due to the lack of machinery and advancements that we have available now these mines were dug by
men, mined by men, and destroyed by

Magma Contamination And Sulfide Immiscibility Of The...
MAGMA CONTAMINATION AND SULFIDE IMMISCIBILITY OF THE METEORIC IMPACT ZONE IN THE SUDBURY NI
–CU DEPOSITS:
ONTARIO, CANADA
WILLIAMS, Jane B. (University of Wisconsin–Eau Claire, willijan@uwec.edu)
Sudbury, Canada is the location of a world class Ni–Cu deposit phenomena. Numerous studies have produced an explanation for the complex evolution
of its deposition and enrichment thanks to the impaction of a meteorite 1.85 million years ago. The impact of the meteorite is thought to have caused
fracturing that led to the generation of magma from deep in the crust that helped in later filling the crater and producing the igneous complex (Faggart
et. al., 1985). The igneous complex (Figure 1a) has an elongated shape (60 km long and 27 km wide) with circular deposits surrounding it similar to a
bulls–eye. Evidence of the meteoric impact includes brecciation located in the center of the basin (Onaping Formation), deformation of the margin of
the intrusive complex (Huronian Group), shatter cones, and pseudotachylite. The meteor is thought to have flash melted the crust which proceeded to
differentiate into a granophyre and a leuconorite to norite composition. The granophyre makes up 60% of the complex and the leuconorite and norite
make up the remaining 40% (Figure 1b)(Barnes et. al., 2005). About 50% of the ore is found in the sublayer norite and the breccia that is associated
with the norite. This ore is mainly disseminated sulphides. The massive sulphides are located in the center

Mining Increases Countrys' Revenues and Economy Essay
MINING
ICMM (International Council on mining and metals) has conducted ten case studies of "mining countries" and with better methodology to have better
understanding and assessment, they found out that mining may contribute to national economies. According to (ICMM, 2010) mining may help to
reduce poverty and indirectly induce employment. From mining too, it helps to increase government revenue to help increase development of the
country.
Mining project starts with mineral ore exploitation and ends with post–closure period. Generally, each phase of its activity is influenced and associated
with different environmental impacts. The first phase of mining is start with exploratory phase. During this phase, surveys are made and that include ...
Show more content on Helpwriting.net ...
Metallic ores contain elevated levels of metals but they generate very large quantities waste called tailings. When active mining ceases, the mining sites
are closed. This is the last phase of mining activity, the post–closure period. The objective of site reclamation is that the site should be return to the
pre–mining conditions. The impacts persist for decades or even centuries.
Perhaps the harmful effects of mining operations are due to mining technology and techniques, which include enormous open pits in the ground. At a
very beginning of mining activities, the impacts have already started and the effects will last for decades. Trees are cut down to build road in order
for the large machineries to access as shown in Appendix A. Deforestation occurs and this may lead to soil erosion.
Before environmental laws and standards were adopted, most of the mining company dumped tailings (wastes) in the nearest location. Extracting
metals use high demand of water and for water disposal. It pollutes fresh water and as a result water is contaminated with harmful constituents such
as mercury (Appendix B). Example of former open pit mine is Butte, Montana known as the Berkeley pit (Appendix B). It was closed in 1982 but
the pit and its water present a serious environmental issue. In 1995, there was a flock of snow geese landed in the pit and a total of 342 carcasses
were found and today, Berkeley pit consists with highly contaminated water as stated by (Barbey, 2009).
Another

Statement Of Purpose In Mining Engineering
Statement of Purpose
To whom it may concern,
"In the mountains the shortest way is from pick to pick." Friedrich Nietzsche (1844–1900) I have always believed that various branches of sciences are
separated from a stout unique body that its roots are made from basic sciences of physics, mathematics and chemistry. Similar to three main colors of
Green, Blue and Red, their combination creates other majors.
It was perhaps my acquaintance with mathematics in high school that later shaped the rest of my life. I still vividly remember the day my mathematics
teacher approached me to encourage me to participate in a mathematics contest at the provincial level in 2004. There were almost three hundred
contestants to compete in different fields of mathematics, ranging from Algebra, Probability, Numeric theories and Geometry to Differential. When the
results came out, I realized I had outstripped all the candidates ... Show more content on Helpwriting.net ...
Furthermore, I strongly believe that an American academic environment is the best place for me to achieve this, because not only it would provide me
with a magnificent atmosphere to broaden my horizons, but also it has the reputation for being the best place to experience practical team work. I am
very excited about the prospect of studying Mining Engineering at this university, as I believe it will open the doors to a wealth of opportunities In
the future. The program is intensive and covers all topics of my interest in detail. So I corresponded with Dr. Elizabeth Holley, who works in the areas
of my interest such as Mineral Exploration especially for porphyry and epithermal deposits and her supportive response encouraged me to apply to
your university. I am confident that my solid background, creativity, communication skills and passion for learning will allow me to succeed in the

The Mining Industry And Its Effects On The Environment
1.INTRODUCTION
The world as we know it, is continuously evolving. With an increase in population, there exists a great deal of economic and social needs. The earth is
enriched with a vast of diverse precious minerals which play a significant role in our lives. These minerals are used in many sectors such as medicine,
construction, agriculture etc. To extract these precious minerals from the earth's crust, extensivemining operations are carried out daily. These
operations comprise drilling and blasting of ores to attain the minerals. During these operations great harm and damage is being done on the
environment.
The mining industry is by far the most influential industry with regards to setting a country's economy in motion. Different mines extract different
minerals from coal to diamond and gold. These resources are embedded within ores which have to be drilled and blasted to be extracted. After
retracting the resources the waste rock and waste that is detached from the ore during processing, is dumped away from the pit onto a surface waste
dump which is commonly known as mine tailings. Mine tailings are the largest mine wastes on earth and can reach several hundred meters in
elevation. This type of waste results to countless environmental effects.
Excluding water, concrete is the mostly used material on earth. It is considered as the most important material in the Building Environment due to its
extensive usage in the construction industry. Concrete is primarily used

Cadia Case Analysis Essay
LEGAL RESEARCH ESSAY
Cadia Holdings Pty Ltd v State of New South Wales (2010) 242 CLR 195
Word Count: 1,496
Introduction– Factual Background
Cadia Holdings Pty Ltd and Newcrest Operations Ltd (NOL) owned land in New South Wales, granted to them by the State of New South Walesunder
the Mining Act 1992 (NSW). From July 1998 to March 2008, Cadia conducted mining operations in which it recovered minerals including copper
and gold, and paid royalties to the Minister pursuant to the Mining Act 1992 (NSW). The Minister referred to the Case of Mines[1], claiming that the
mine owned by Cadia was a "royal mine" containing gold that belonged to the Crown prerogative, and as a consequence the copper was also the
property of the Crown. Cadia ... Show more content on Helpwriting.net ...
That precedent was set back in 1568 when Thomas Percy, the 7th Earl of Northumberland, was taken to court by Elizabeth, the Queen of England. The
Queen needed gold and silver to prepare for the long–expected conflict with Spain. A jury of Percy's peers found that the gold on his land wasn't really
his. In "The Case of Mines[8]", the jury concluded, "that by the law of all mines of gold and silver within the realm, whether they be in the lands of
the Queen, or of subjects, belong to the Queen by prerogative, with liberty to dig and carry away the ores thereof, and with other such incidents thereto
as are necessary to be used for the getting of the ore."[9] Under pressured circumstances, it proves that whether it's a monarch, a Parliament, or a
Congress, the State is always in pursuit of money with which to make war. Not much has changed.
The obiter dicta statement made by Kay LJ in the case of Attorney–General v Morgan[10] where the value of gold and copper in a mine were nearly the
same 'benefit of the doubt should be given to the owner of the mine.'[11] If this contention is persuasive and accepted by the Court, then the outcome
of the decision would have been different. The value of the gold extracted greatly exceeds the value of the copper despite the fact that the copper has a
higher quantity.
However, the Court has correctly applied the legislation, namely section 3 of the Royal Mines Act 1688 (Imp). Section 3

Fortescure metal group ltd Essay
Executive summary
The research group has undertaken an analysis of Fortescue Metal Group Limited ('FMG'). The analysis consists of two parts. Part 1 includes a macro
economic analysis which reviews FMG's economic environment and how this impacted on its performance during the years ended 30 June
2008 to 30 June 2012. During this period FMG's performance was primarily driven by an overall increase in the price of iron ore, underpinned by
higher levels of demand for this product from
China. It is considered that continued demand for iron ore by Chinese steel producers and continued growth in China's gross domestic product ('GDP')
is likely to support the forecast iron ore price of USD120 per metric tonne ('mt') and result in future ... Show more content on Helpwriting.net ...
FMG financial report for the year ended 30 June 2013, page 8.
3
. Ibid page 47. Revenue on sale of iron ore was, USD6,479m. Total revenue was USD6,681 and included shipping revenue.
4
http://www.rba.gov.au/publications/smp/2012– RBA 'Statement on monetary policy' (August 2012) page 6 'In general, the spot price for iron ore has
tended to move in line with developments in Chinese industrial production and steel production'.
5
http://www.indexmundi.com/commodities/?commodity=iron–ore&months=60 – webpage provides spot price data sourced from The Steel
Index and the IMF.
6
IBIS World 'B0801 Iron Ore Mining In Australia industry report', May 2013, page 5. 'Demand for iron ore is closely tied to steel production and
trends in economic growth that drive global demand for steel.'
7
http://www.oecd.org/sti/ind/OECD%20May12%20Summary%20%20Iron%20ore%20doc%20%283%29.pdf– OECD report on the iron ore market in
2011. At page 4 it is noted that China represented approximately 59% of total world imports for iron ore.
2
2
historically high levels, they are expected to decline in the medium term.8 However, the price of iron ore has been forecast at around USD120 per mt

out to 2018.9 During the year ended 30 June 2012
FMG shipped

Table of Contents Title Pagei Table of Contentsii ABSTRACTiii
1. INTRODUCTION4 2.1 HISTORICAL OVERVIEW OF BIOLEACHING4–5 2.2 TYPES OF BIOLEACHING5–7 2.3 GOLD ORES APPLICABLE
TO BIOLEACHING7 2.4 PRINCIPLES OF BIOLOGICAL GOLD ORE TREATMENT7–9 2.5 OPTOMIZING THE BIOLEACHING PROCESS9–11
2.6 ADVANTAGES OF BIOLEACHING OF GOLD ORE11
2.7 LIMITATIONS/DISADVANTAGES OF BIOLEACHING OF GOLD ORE 12
3. CONCLUSION12
Cited References13
Appendix A14
1. ABSTRACT Bioleaching has been applied to copper and uranium ... Show more content on Helpwriting.net ...
These investigations led to production of 8.4 tons of gold annually [1]. These successes led several other gold mining companies to follow with
bioleaching processes. Today bioleaching of gold containing ore has become increasingly important as bioleaching technology progresses and
gold reserves become increasingly depleted. 2.2 TYPES OF BIOLEACHING Types of bioleaching of gold ore can be divided into three
categories. Each method offers various advantages. Selection of the bioleaching type for a specific application depends on several factors including:
the ore composition, gold content, surrounding environment and amount of available reserves. 2.2.1 BIOREACTORS Bioreactors are employed
when the value of the gold recovery is sufficient to justify the costs of installing and operating the necessary equipment. Bioreactors are able to
process less gold ore at one time, but create a much faster oxidation process. This process usually utilizes higher grade ores compared to heap
leaching. This type of bioleaching is characterized by a reactor tank in which relatively finely ground ore and nutrients are added, as well as bacteria
containing solution to create a slurry (Figure 1). This mixture is then mechanically or air agitated. [pic] Figure 1: Bioreactor tanks for processing of
gold ore Available from: http://wiki.biomine.skelleftea.se/wiki/index.php/Tank_leaching

2.2.2 HEAP BIOLEACH PADS Heap bioleach

Metallurgy: Oxygen and Ore
Extractive Metallurgy
Minerals are naturally occurring chemical substances in the earth's crust obtainable by mining.
Out of many minerals in which a metal may be found, only a few are viable to be used as sources of that metal. Such minerals are known as ores.
Examples: Galena, PbS, etc.
It is usually contaminated with earthly or undesired materials known as gangue. The extraction and isolation of metals from ores involve the following
major steps:
Concentration of the ore,
Isolation of the metal from its concentrated ore, and
Purification of the metal. It is also called 'Refining'.
Stages of extraction of metals:
After the concentration of the ore is done, there are two main steps or stages in extractive metallurgy. They are: ... Show more content on
Helpwriting.net ...
Electro–refining is used to dissolve an impure metallic anode (typically from a smelting process) and produce a high purity cathode. Fused salt
electrolysis is another electrometallurgical process whereby the valuable metal has been dissolved into a molten salt which acts as the electrolyte, and
the valuable metal collects on the cathode of the cell. The fused salt electrolysis process is conducted at temperatures sufficient to keep both the
electrolyte and the metal being produced in the molten state.
Extraction of crude metal from concentrated ore:
The concentrated ore must be converted into a form which is suitable for reduction. Usually the sulphide ore is converted to oxide before reduction.
Oxides are easier to reduce (for the reason see box). Thus isolation of metals from concentrated ore involves two major steps , they are:
(a) conversion to oxide, and
(b) reduction of the oxide to metal
(a) Conversion to oxide
(i) Calcination: Calcinaton involves heating when the volatile matter escapes leaving behind the metal oxide: Fe2O3.xH2O в†’ Fe2O3 (s) + xH2O(g)

ZnCO3 в†’ ZnO(s) + CO2 (g) CaCO3.MgCO3(s) в†’ CaO(s) + MgO(s ) + 2CO2(g)
(ii) Roasting: In roasting, the ore is heated in a regular supply of air in a furnace at a temperature below the melting point of the metal. Some of the
reactions involving sulphide ores are:
2ZnS + 3O2 в†’ 2ZnO + 2SO2

How a Steel Mill Works
How A Steel Mill Works
The principal consumables employed in steel production are iron ore, coal, scrap metal and electrical energy. The importance of each of these
consumables depends upon the technological processes adopted at each mill. In a classic integrated mill, coal and iron ore are the main consumables.
In semi–integrated mills, scrap iron is the mainstay.
An integrated mill comprises four basic operations – reduction, refining, solidification, and rolling – to convert iron ore into semi–finished or finished
(rolled) steel products.
Reduction The objective is to convert iron ore – naturally occurring in the form of ferrous oxide – into pig iron.
In this operation, a coker converts coal into coke that is
then ... Show more content on Helpwriting.net ...
Among these are refractories, electrodes, and alloying elements.
Refractories are materials that work as thermal isolators and are used to coat critical steel mill equipment such as blast furnaces, ladles, and converters.
Their main function is to protect the equipment from extreme temperatures and to minimize wear and tear.
Electrodes constitute an important input in the operation of electric steel mills.
Alloying elements Metals such as zinc, tin, chrome and aluminum are employed in steel alloy production.
A steel mill uses industrial gases extensively. In addition to the jet of oxygen–fed converters in integrated mills, oxygen is frequently injected into blast
furnaces and electric furnances to improve overall operating conditions. Given the volume of oxygen utilized, steel mills usually house one or more
oxygen producing units. This used to be integrated vertically into the steelworks themselves. However, in recent years, initiatives have been widely
employed to outsource this operation to specialized companies.
There are also non–integrated manufacturers which operate via a single processing phase: reduction or rolling.
In the first case are pig iron producers, the so–called ironers, that utilize coal in blast furnaces to make pig iron. In the second case are the re–rollers of
plates and billets acquired from integrated or

Essay Ocean Carriers Case
"Ocean Carriers" case Assume that Ocean Carriers uses a 9% discount rate. 1) Do you expect daily spot hire rates to increase or decrease next year? (5
points) 2) What factors drive daily hire rates? (5 points) 3) How would you characterize the long–term prospects of the capesize dry bulk industry? (10
points) 4) Should Ms Linn purchase the $39M capsize? Make 2 different assumptions. First, assume that Ocean Carriers is a US firm subject to
35% taxation. Second, assume that Ocean Carriers is located in Hong Kong, where owners of Hong Kong ships are not required to pay any tax on
profits made overseas and are also exempted from paying any tax on profit made on cargo uplifted from Hong Kong. (75 points) 5) What... Show more
content on Helpwriting.net ...
Linn expected that Australian and Indian ore exports would begin in 2003, and that new supplies would significantly increase trading volumes.
Demand for capesizes would likely increase with these higher trading volumes, possibly boosting prices. According to Exhibit 5, we can get the
following data: | 1994| 1995| 1996| 1997| 1998| 1999| 2000| Iron ore vessel shipments| 375| 397| 385| 424| 420| 410| 440| Growth rate| | 5.87%| –3.02%|
10.13%| –0.94%| –2.38%| 7.32%| Avg. spot rate| $16,851 | $20,149 | $11,730 | $14,794 | $10,105 | $9,427 | $22,575 | Growth rate| | 19.57%|–41.78%|
26.12%| –31.70%| –6.71%| 139.47%| Avg. 3–yr charter rate| $18,250 | $18,544 | $14,079 | $16,063 | $13,076 | $12,626 | $15,344 | Growth rate| |
1.61%| –24.08%| 14.09%| –18.60%| –3.44%| 21.53%| From the table above, we can find that worldwide iron ore vessel shipments and charter rates
had been very strongly associated historically. Iron ore vessel shipments and daily hire rate changed in the same direction. Moreover, 3–yr charter rates
changed much more than iron ore vessel shipments, while spot rates tended to fluctuate more widely than 3–yr charter rates. As mentioned above,
Australian production in iron ore expected to be strong and Indian iron ore exports expected to take off in the next few years. I expect worldwide iron
ore vessel shipments to

The Mining Act 1990
The Mining Act, 1990, has a significant role in protecting Ontario's vast mineral resources and brings forth a set of policies in which promote
responsible mining development and extraction. The provincial government plays an integral role in the provinces mining industry because the Act
requires that all mineral claims must be recorded and accepted by the Crown which from then the two parties discuss a lease fee for the mineral rights.
After locating a mineral claim in an area deemed open by the Crown, there are two options available for leases, the first being "The holder of a mining
claim may elect to apply for a lease of the mining rights only." (Government of Ontario, 2017), while the second option allows both the surface rights
and ... Show more content on Helpwriting.net ...
In 2009, the passing of Bill 173, also known as the Mining Amendment Act brought forth various changes that were created with the input of
representatives from the mining industry, environmental groups, municipalities, private citizens, and Aboriginal communities (Pratt & Smitherman,
2009). The discussions between the government and these groups helped lead to the implementation of new regulations that promote mineral
exploration and development in a manner that recognizes Aboriginal and treaty rights.
The Mining Act does a very good job at protecting certain aspects of the environment such as ensuring that over exploitation of minerals does not
occur, or making it mandatory to have a plan in place for closing the mine as well as assuring that there is money to do so. Although there are many
things that this Act does right, there are also areas in which there are issues and should be improved. One of the first issues pertaining to this Act is the
impact that it fails to mitigate regarding water quality. In areas where mining development occurs, the water quality is drastically affected and a study
found that "water from waste rock piles has an ionic profile distinct from unimpacted catchments" (Carey, Wellen, & Shatilla, 2015), meaning that in
order to mitigate the impact of the runoff measures must be put in place to limit it. Secondly, the Act does not involve

Essay On Lead Ore
Set out at Daylight proceeded on the Course of last night S 87В° W 3 ms passed a Willow Island, from the Point of last Course S 81В° W. 3 ms. to a
pt. on S. S: passd a [blank] Isd. in the middle of the river, passd a run [2] on the Ld S: above a pt. of rocks 3 ms. on which thir is a number of Deer
Licks, N 88В° W. 3 Ms. to a pt L S: N. 83В° W 2 ms. to the Mo of Mine River, [3] psd an Isd.
– This river is 90 yards wide & navagable for Perogues
about 90 Ms. I went out on the L S. about 4 ms. below this R. and found the Countrey for one mile back good Land and well watered the hills not high
with a gentle assent from the river, well timbered with oake, walnit Hickory ash, &c. the land Still further back becoms thin and open, with ... Show
more content on Helpwriting.net ...
the вЊ©mainвЊЄ [NB: West] [9] branch passes near the place where the Little osage Village formerly Stood on the Missouries, & heads between the
Osarge & Kansias Rivers, the left hand fork [10] head with nearer Branches of the Osage River, The french inform that Lead Ore has been found in
defferent parts of this river, I took Sjt. Floyd and went out 4 Ms. below this river, I found the land Verry good for a Mile or 1 В
Ѕ Ms. back and
Sufficiently watered with Small Streams which lost themselves in the Missouries bottom, the Land rose gradeuelly from the river to the Summit of the
high Countrey which is not more that 120 foot above High Water mark, we joined the Boat & Dined in the point above the mouth of this River, Capt.
Lewis went out above the river & proceeded on one mile, finding the Countrey rich, the wedes & Vines So thick & high he came to the Boat–
proceeded on passed an Island вЊ©aboutвЊЄ and Camped at the lower point of an Island on the L. S. Called the Island of mills [NB: mills] about 4
ms. above Mine River at this place I found Kanteens, Axs, Pumey Stone & peltrey hid & buried (I suppose by some hunters) none of them (except the
pumey Stone) was teched by one of our party, our hunters Killed 5 Deer to day, Commenced raining Soon after we Came too which prevented the
party Cooking their provisions– our Spies inform that the Countrey they passed thro: on S. S. is a fine high bottom, no water.

Zonolite Essay
In Libby, Montana, a corporation by the name of Zonolite used to mine vermiculite ore from years 1919 to 1990. Vermiculite was used in many
households within Libby as well as across the United States. It's is known to contain asbestos, which is harmful to the lungs and may cause
malignant mesothelioma (1). In 1968, W.R. Grace took over the Zonolite company, being fully aware of the dangers that asbestos possess. He failed
to acknowledge the workers at the Zonolite plant about asbestos. The workers of Zonolite used to work with passion, loving what they do for a living.
There weren't many jobs for a town that held less than 3,000 residence. Therefore, working for Zonolite for Libby residence was the main option for
many families to have great amount of income in the household (2). Grace used to be fully involved, not only with Zonolite, but with the entire Libby
community. He used to be involved with the school board, hospital board, and he even gave away vermiculite for Libby residence to use for their house
installation. How can someone involved in the community be so ignorant by not publicizing that vermiculite contains asbestos? This is where Grace
wanted Zonolite to dominate the vermiculite industry, regardless of the health risks involved. This shows the unethical business attributions that the
Zonolite company adheres to.... Show more content on Helpwriting.net ...
They were told to wear respirators in order to keep the "dust" out of their lungs. That "dust" was actually asbestos being caught in the air respirators.
After 15 minutes of using the respirator, a large amount of asbestos used to get caught within the respirator. This frustrated many of the workers, which
left most of them disposing there respirators and working without any protection against asbestos. Disposing the respirator did not alarm the workers at
the Zonolite plant since they thought it was just dust accumulating in the

Internal Weakness Of Tata Steel
Internal Analysis of Tata Steel Strengths of Tata Steel
Abundant Resources of iron ore: Tata Steel has abundant resources of iron ore in India and across the world too in various other countries. They have
mines at four locations in India at Noamundi, Joda , Khondbond, Katamati. All these mines are located in Jharkhand and Odisha.
Noamundi is a world class open cast ore mine equipped with latest technology.
Apart from these TataSteel has iron ore projects in Canada, Mozambique, South Africa and Ivory Coast.
Low cost production and cheap labour: Tata Steel has done downward integration and is thus able to produce steel at low cost due to easy availability of
iron ore for its steel plants. Tata Steel also pays attention to the operational costs.
Global Competitiveness through Mergers ... Show more content on Helpwriting.net ...
In turn electricity production is also dependent on coal. So, coal is the most widely used source of energy in India for heavy industries. In the
scenario of electricity or coal costs rising Tata Steel would face.
Dependence on manufacture of steel making machinery from abroad : India lags behind on facilities for producing machinery for steel production to
be installed in steel plants. All the steel producing firms including Tata Steel have to import almost all the machinery and equipment to be installed in
the plants from other countries. This tends to push up the set up costs to be investing while setting up the plants. China on the other hand has a hub of
such capital industries which gives them cost advantage.
Opportunities for Tata Steel
Huge infrastructure demand: According to a PWC report Asian infrastructure market will be about 60% of the whole world. India is on the path to
become the manufacturing hub in its endeavours to overtake China in that

International Business
Group Assignment: BHP BILLITON
International Business Theory & Practice (MGF 5966)
Lecturer/Tutor
Mr. Sharif Rasel
Name & ID
Junaidul Haque – 263 512 50
Dalaphone Phengrattanavong – 266 785 94
Girish Balar – 274 718 53
Maike Nan – 263 994 90
Due Date – Week 11
Introduction
BHP Billiton, which is Broken Hill Proprietary Billiton, is an Anglo–Australian multinational mining and petroleum company. BHP started its operation
in Melbourne in 1885 which is one of Australia's largest and oldest companies, and it focused on development, discovery, production, and marketing of
natural resources. In value–added flat steel products, BHP was also a market leader. In 1860, Billiton was established in The Hague,... Show more
Meanwhile, the CSR activities create communities a trustworthy of the organization by contributing benefit for society. For example, BHP Billiton has
been a part of communities which made the grant to ANDA project to help vulnerable and displaced people in Colombia. The company also invested
$13.4 m in the five rivers conservation project. This will create secure, lasting conservation position for the land and make an endowment for the
long–term management of the property in Tasmania, Australia. Those projects have assisted human perception to think positive regarding the
organization.
In addition, BHP Billiton works to improve risk profile by enhancing the identification and management of health, safety, society and environment risks.
The company has shown a reduction of 5.7 % in potential employee exposures to carcinogens and airborne pollutants. It is their sustainability focus on
people to maintain people and operation safe, concentrate on people health and well–being as well as developing their employee. Thus, it is a motive

for the BHP Billiton's employee to bring up the innovation.
Apart from that, BHP Billiton also developed a code of business conduct by initiated land and biodiversity management plans for all of its operations as
these included controls to prevent the damage of the environment and compensation influence to biodiversity and ecosystems services. With this plan,
the firm has created the value of

Additional Exploration Activities Case Study
III.Analysis
a.Additional Exploration Activities TMM May Conduct Pre–Approval of Mine Plan
Prior to the approval of TMM's mine plan, there is likely to be a range of activities that they are authorized to conduct based on the language of the
lease. Any activity that fits in the category of category of casual use and does not create any undue and unnecessary degradation is unlikely to require a
mining plan. Moreover, any activity to acquire proof of a valuable deposit, such as exploratory boring is likely to be within the scope of TMM's
authority, so long as they conform with health and safety regulations.
The Ninth circuit case of Sierra Club v. Penfold describes the three different categories of mining operation activities that BLM created.... Show more
36 C.F.R. В§ 261.10. In the Montana case of United States v. Nordwick, an operator was charged with constructing and maintaining structures on
National Forest lands without an approved mining plan. 673 F. Supp. 397, 398 (D. Mont. 1987). The court held that because Defendant failed to
"maintain his structures, equipment, and other facilities in a safe, neat, and workmanlike manner" and failed to submit a mining plan as prescribed by
the regulations he was guilty. Id. at 401. Therefore, it can be concluded that based on Nordwick, along with the regulations, that TMM does not have
the authority to maintain any structures in the Superior National Forest before the submission and approval of a mining

Global Economy Is Finally Stabilizing Following The Global...
The global economy is finally stabilizing following the global financial crisis and Great Recession. Our base–case outlook for average annual real
growth between 2015 and 2020 is between 3 and 4 percent Lower global commodity prices are an important factor supporting stronger economic
growth. Although economies that are dependent on commodity exports may suffer, lower input prices for industry as well as lower fuel prices for
households will provide a boost to aggregate demand and global growth. We expect emerging economies to continue to grow by more than 4 percent
(contributing $16.2 trillion to global growth through 2020 at market exchange rates), while the growth rate of advanced economies is forecast to
exceed 2 percent (contributing $13.5 trillion through 2020) for the first time since 2010. The United States is leading the recovery among advanced
markets, and we expect the country to be a significant contributor to global growth through 2020. However, we anticipate economic performance to
continue to diverge within both the emerging and developed market groupings based on key policy choices, as governments grapple with structural
reforms in the context of reduced fiscal and monetary stimulus. In this regard, strong leadership and bold government actions will determine whether
national economies can escape from the new mediocre of stable but low growth. Australia resources industry (BHP) Australia has a rich haven of
resources in the oil, gas and energy industries.

Strategy Analysis for Iron Ore Segment on BHP Billiton
STRATEGY ANALYSIS FOR IRON ORE SEGMENT OF BHP BILLITON
1. Company background,
BHP Billion, a merging cooperation of BHP and Billion in 2010 (BHP Billiton, 2011), is a world leading company in mining and resource exploiting.
According to ASX data, BHP Billion has the largest business scales in the Australian market, AU$166 billion of market capital and AU$71 billion of
annual operating revenue in FY13 (Australian Securities Exchange, 2014). Over 128,800 employees and contractors work in 26 countries worldwide to
create value for their shareholders (BHPB Annual Report, 2013). The core business has been classified into five units: petroleum, copper,iron ore, coal
and aluminum, making 20%, 18%, 17%, 31% and 14% respectively in the revenue of FY13. It can be seen from Graph 1 that although iron ore was
not the segment with the largest assets, it still returned with the largest revenue and highest ROA rate in 2013. The following paragraphs will focus on
the strategy analysis on the segment of iron ore and how it can conquer possible threats
2. SWOT Analysis & Porter five forces analysis
2.1 SWOT Analysis
2.1.1 Strength
Firstly, BHPB owns abundant resource in Western Australia, the second largest reserves stock (U.S. Geological Survey, 2014) with well
–developed
infrastructures on transportation. In addition, the joint venture in Brazil also provides supply to North America. Better geographical location
contributes to the logistical expense of United States to be

Overseas Countries Trends Used Of Such Products Or...
Selected overseas countriesTrends in use of such products or services
Overseas country 1: China
China is evenly switch from an industrialized based development measure and export attend economy to a consuming attend retrenchment with a more
tenable development rate. This user target need less value exhaustive manufacturing. With an increasing average stylish China and raising urban
population there is developed demand for a fresh environment system and increase feature of life. Afterward the importunity for coal and another
material resources has experienced an accelerated lessening. This flow has an abundant effect on the worldwide economy and especially Australia
based on historical of China grand balances of reliance on their capability exports.
Overseas country 2: Japan The related between Japan and Australia, particularly in relationship to theiron ore manufacturing, has been its that has
looked forward a switch from antagonism in market in 1930s and began expensive in market since 1960s. Japan is approximately below par graced
with mining raw materials, as examine in contrast with Australia minerals. Therefore, both of them have an essential economic correspondent.
Throughout the time Japan had a voracious worldly goods for substantial for commercial enterprise, Australia wanted to accept finished manufacturing
things from Japan. This interconnected related has allowanced both Australia and Japan to take a pleasure in raw material of economic development
over the

Executive Officer Chief Executive Of The Aluminium And...
In 2013, BHP had shuffled senior management in order to bring key business closer to their head office. BHP Billiton has said that Mike Yeager, the
head of petroleum, Alberto Calderon, chief executive of the aluminium and nickel division, and Marcus Randolph, head of ferrous and coal, would all
be departing their roles.However, Calderon would remain as an adviser to the new CEO Andrew Mackenzie until the first half of 2014. Yeager would
be retiring in July, while Randolph's role had been made redundant.
Talk about the changing of management team
Show the new management team
What will this team change for BHP development
On the 18 of April 2013 BHP Billiton had released an important announcement that came with a whole new managing team; ... Show more content on
Helpwriting.net ...
There are five business leadership roles that will be filled by executives with deep operational experience. The Iron Ore business will be retained by
Jimmy Wilson. Peter Beaven take the role of President, Copper which let him have responsibilities for the assets under the former Base Metals
business. The President of Enery Coal– Dean Dalla Valle would be responsible for the coal assets, and consolidating the businesses of Metallurgical
and Engery Coal. Daniel Malchuck will take the role of President, Minerals Exploration to assume the responsibility for the businesses of Aluminium,
Maganese and Nikel businesses. Following Mike Yeager's retirement on 1 July 2013, Tim Cutt
– President, Diamonds and Specialty Products will return
to be the President of the Petroleum business. Tim used to be the leader of production activies in Petroleum before joining the Diamonds and Speacialty
Products business.
The new GMC was considered having the addition of two roles to make a strong emphasis on functional excellence. Geoff Healy was currently a
Partner of Herbert Smith Freehill and will take the role as Chief Legal Counsel. The President of Governace would be taken by Jane McAloon along
with retaining responsibilities as Group Company Secreatry.
This new managing

RESEARCH ART I C L E Insights intothe dynamics of bacterial communities during chalcopyrite bioleaching Zhiguo He1,2, Fengling Gao1,2, Jiancun
Zhao1,2, Yuehua Hu1,2 & Guanzhou Qiu1,2 1School of Minerals Processing and Bioengineering, Central South University, Changsha, Hunan, China;
and 2Key Laboratory of Biometallurgy, Ministry of Education, Changsha, Hunan, China Correspondence: Zhiguo He, School of Minerals Processing
and Bioengineering, Central South University, Changsha, Hunan 410083, China. Tel./fax: 186 731 88879815; e–mail: zhighe@gmail.com Received
19 December 2009; revised 14 April 2010; accepted 17 June 2010. Final version published online 3 August 2010. DOI:10.1111
/j.1574–6941.2010.00943.x Editor: Alfons Stams Keywords DGGE;... Show more content on Helpwriting.net ...
A Geneamp thermocycler (Biometra, T–Grandient, Germany) was used to incubate reactions through an initial denaturation at 94 1C for 2min,
followed by 35 cycles of 94 1C for 40 s, 55 1C for 30 s, and 72 1C for 1min, and completed with an extension period of 10min at 72 1C. Products from
the amplification reactions of expected size (about 1500 bp) were pooled and purified before ligation. PCR amplification of the archaeal 16S rRNA
gene was carried out following the PCR program described above with two different sets of archaea–specific primers, which were as follows:
S–D–Arch–0025–a–S–17 (50–CT GGTTGATCCTGCCAG–30) (Robb et al., 1995) or S–D–Arch– 0344–a–S–20
(50–ACGGGGCGCAGCAGGCGCGA–30) (Weisburg et al., 1991) with S––Univ–1517–a–A–21 (50–ACGGC TACCTTGTTACGACTT–30) (Raskin
et al., 1994) to yield 1500– or 1120–bp PCR products, respectively. Cloning, RFLP, and sequencing The purified PCR products were ligated into the
vector PGEM–T (Promega Corporation), and used to transform DH5a competent host cells. About 120 white colonies were randomly selected from
each library. The transformation efficiency was around 5108 CFUmg1 DNA, as determined using an external control provided with the PGEM–T
vector system (Promega Corporation). For RFLP determination and sequencing, the inserted fragments were amplified with the vector–specific T7 and
SP6 primers. These unpurified PCR products were digested with two restriction

Silver Ore Synthesis
As an employee for a company that processes silver ore, you are developing a method for recovering silver metal. The ore sample is crushed,
dissolved in strong acid, and treated with a solution of sodium chloride to isolate the silver as silver chloride. The precipitate is dried and collected
for further processing into silver metal. You test the procedure by dissolving 10.00 g of ore in an aqueous acidic solution and diluting the solution
with water, so that the final volume is 1.0 L. To the solution of dissolved ore, 1.0 L of a 0.025 M NaCl solution is added, to precipitate silver chloride.
The mixture is then filtered and the solid washed with 1.0 L of water. a. The specific ore used consists of a mixture of silver sulfide and

Rio Tinto 's Largest International Mining Companies
Company Overview
Rio Tinto is one of the world's largest international mining companies. Headquartered in London, the company is a dual listed company as Rio Tinto
plc and Rio Tinto Limited but operates as a single economic entity. Rio Tinto's diverse mining interests focus on delivering shareholder value by owning
and operating metals and minerals mines which deliver the world's most sought out commodities. The company operates in ten countries worldwide
and maintains control of whole or partly owned entities throughout the world. Currently, Rio Tinto's average number of employees totaled 66,331 with
approximately one half of all Rio Tinto's employees conducting mining activities in Australia and New Zealand.
Rio Tinto's business models delivers shareholder value through exploration and evaluation of potential metals and mineral deposits in new geographical
regions, developing new mining operations worldwide, improving existing mining processes from extraction to delivery, and ensuring operations
ending in designated regions are sustainable and beneficial for future land uses. (Rio Tinto Annual Report, 2013)
Company History
Formed in 1873 by investors, Rio Tinto began its quest to supply the world with copper extracted from ancient copper workings in southern Spain. The
success of Spain's southern copper mines eventually caught the eye of Consolidated Zinc Corporation in 1905 which resulted in both companies to
merge into Rio Tinto–Zinc Corporation. The

Rio Tinto : The Leading Mining Groups
Rio Tinto is one the leading mining groups in the world whose main focus is to find, mine and process the Earth's mineral resources for different
benefits both domestic and international. It is in its true essence a mining and metals' company. It has its operations in more than 40 countries
expanding across 6 continents and has an employee base of around 66000 in 2014. (RIO TINTO, 2014) Its strongest representation is in the North
American and Australian territory though it also has its bases spread over in Asia, Europe, South America and Africa. It has its main headquarters in
the United Kingdom and the Rio Tinto group is comprised of two companies: Rio Tinto plc в€’ a London and New York Stock Exchange listed
company в€’ and Rio Tinto Limited, which is listed on the Australian Securities Exchange. Rio Tinto claims that because of their global presence and
with their expertise in technology and marketing it enables them to supply a quality and right product at the right time. (RIO TINTO, 2014)
Their vision is to be a company that is admired and respected for delivering superior value, as the industry's most trusted partner. Their operations give
them the opportunity to create mutual benefit with the communities, regions and countries in which they work, and their metals and minerals are
transformed into end products that contribute to higher living standards. (RIO TINTO, 2014)
Its major products are aluminum, copper, diamonds, gold, industrial metals, iron ore, thermal and

Industrial America From The American Steel Industry To The...

Recommended

Recommended

More Related Content

More from Pamela Smith

More from Pamela Smith (10)

Recently uploaded

Recently uploaded (20)

Industrial America From The American Steel Industry To The...