This study investigated the effects of vitrification on morphology and mRNA expression of apoptotic genes in sheep immature cumulus oocyte complexes. Immature oocytes were collected from sheep ovaries and divided into groups for cryopreservation using different cryoprotectants. The oocytes were evaluated for morphology before and after vitrification and thawing. Real-time PCR was used to analyze expression of apoptotic genes BAD, BAK, BAX, BID, BOK, BCL2A1, BCL2, MCL1 in fresh and vitrified oocytes. Results showed varying recovery and damage rates among oocytes cryopreserved with different cryoprotectants. Morphological changes included cracked or split zona pell
Extraction and purification of product from fermentation is known as Downstream Processing ( DSP) or Product Recovery
It is an essential step in the manufacture of pharmaceuticals product
Cost of the product is determined by the DSP involved
The roles of group C and F streptococci in causing endemic pharyngitis are still controversial, although group C streptococci are implicated in the outbreaks of pharyngitis and associated disorders.
Syngulon - Selection technology May 2024.pdfSyngulon
Syngulon’s technology expands the capacity for selection of microorganisms. The ability to select individual microbes with a behavior of interest is essential, whether for simple cloning at the bench, or for industry-scale production. Synthetic biology uses the concept of “bioengineering” to improve or modify existing genetic systems to create microbes with desired behaviors, and Syngulon uses this approach to develop its selection technologies.
This selection technology is based on bacteriocins, ribosomally-produced peptides naturally made by most bacteria to kill competitive microbial species. These bacteriocins can have a limited or wide target range against other microbial species. This technology offers advantageous over antibiotic selection for several reasons: it avoids the use of antibiotics in the first place, helping to reduce the spread of antibiotic resistant microbes. The technology also increases product yield; as bacteriocins are generally smaller peptides, they do not impose a heavy metabolic burden on the producing cell. They can have a wide target specificity, helping to avoid genetic drift. Finally, our system is 100% plasmid-based (e.g. without chromosomal mutations), making it applicable for use in any E. coli strains.
Structurally characterized arabinogalactan from Anoectochilus formosanus as a...Cây thuốc Việt
In this study, the innate immuno-modulatory effects and anti-cancer action of arabinogalactan (AG), a derivative of a well-known orchid, Anoectochilus formosanus, were investigated. The innate immunomodulatory effects of AG were determined in vitro using RAW 264.7 cells for microarray analysis, and in vivo using BALB/c mice administrated with AG at 5 and 15 mg/kg intra-peritoneally for 3 weeks. The anti-cancer activity of AG was evaluated by CT26 colon cancer-bearing BALB/c mice. The microarray
analysis was performed to evaluate the innate immunity and demonstrated that AG significantly induced the expression of cytokines, chemokines, and co-stimulatory receptors, such as IL-1, CXCL2, and CD69.
An intraperitoneal injection of AG in mice increased the spleen weight, but not the body weight. The treatment of mitogen, LPS significantly stimulated splenocyte proliferation in AG treated groups. The AG treatment also promoted splenocyte cytotoxicity against YAC-1 cells and increased the percentage
of CD3+CD8+ cytotoxic T cells in innate immunity test. Our experiments revealed that AG significantly decreased both tumour size and tumour weight. Besides, AG increased the percentage of DC, CD3+CD8+ T cells, CD49b+CD3− NK cells among splenocytes, and cytotoxicity activity in tumour-bearing mice. In addition, the immunohistochemistry of the tumour demonstrated that the AG treatments increased the tumour-filtrating NK and cytotoxic T-cell. These results demonstrated that AG, a polysaccharide derived
from a plant source, has potent innate immuno-modulatory and anti-cancer activity. AG may therefore be used for cancer immunotherapy.
Extraction and purification of product from fermentation is known as Downstream Processing ( DSP) or Product Recovery
It is an essential step in the manufacture of pharmaceuticals product
Cost of the product is determined by the DSP involved
The roles of group C and F streptococci in causing endemic pharyngitis are still controversial, although group C streptococci are implicated in the outbreaks of pharyngitis and associated disorders.
Syngulon - Selection technology May 2024.pdfSyngulon
Syngulon’s technology expands the capacity for selection of microorganisms. The ability to select individual microbes with a behavior of interest is essential, whether for simple cloning at the bench, or for industry-scale production. Synthetic biology uses the concept of “bioengineering” to improve or modify existing genetic systems to create microbes with desired behaviors, and Syngulon uses this approach to develop its selection technologies.
This selection technology is based on bacteriocins, ribosomally-produced peptides naturally made by most bacteria to kill competitive microbial species. These bacteriocins can have a limited or wide target range against other microbial species. This technology offers advantageous over antibiotic selection for several reasons: it avoids the use of antibiotics in the first place, helping to reduce the spread of antibiotic resistant microbes. The technology also increases product yield; as bacteriocins are generally smaller peptides, they do not impose a heavy metabolic burden on the producing cell. They can have a wide target specificity, helping to avoid genetic drift. Finally, our system is 100% plasmid-based (e.g. without chromosomal mutations), making it applicable for use in any E. coli strains.
Structurally characterized arabinogalactan from Anoectochilus formosanus as a...Cây thuốc Việt
In this study, the innate immuno-modulatory effects and anti-cancer action of arabinogalactan (AG), a derivative of a well-known orchid, Anoectochilus formosanus, were investigated. The innate immunomodulatory effects of AG were determined in vitro using RAW 264.7 cells for microarray analysis, and in vivo using BALB/c mice administrated with AG at 5 and 15 mg/kg intra-peritoneally for 3 weeks. The anti-cancer activity of AG was evaluated by CT26 colon cancer-bearing BALB/c mice. The microarray
analysis was performed to evaluate the innate immunity and demonstrated that AG significantly induced the expression of cytokines, chemokines, and co-stimulatory receptors, such as IL-1, CXCL2, and CD69.
An intraperitoneal injection of AG in mice increased the spleen weight, but not the body weight. The treatment of mitogen, LPS significantly stimulated splenocyte proliferation in AG treated groups. The AG treatment also promoted splenocyte cytotoxicity against YAC-1 cells and increased the percentage
of CD3+CD8+ cytotoxic T cells in innate immunity test. Our experiments revealed that AG significantly decreased both tumour size and tumour weight. Besides, AG increased the percentage of DC, CD3+CD8+ T cells, CD49b+CD3− NK cells among splenocytes, and cytotoxicity activity in tumour-bearing mice. In addition, the immunohistochemistry of the tumour demonstrated that the AG treatments increased the tumour-filtrating NK and cytotoxic T-cell. These results demonstrated that AG, a polysaccharide derived
from a plant source, has potent innate immuno-modulatory and anti-cancer activity. AG may therefore be used for cancer immunotherapy.
Feeding plate for a newborn with Cleft Palate.pptxSatvikaPrasad
A feeding plate is a prosthetic device used for newborns with a cleft palate to assist in feeding and improve nutrition intake. From a prosthodontic perspective, this plate acts as a barrier between the oral and nasal cavities, facilitating effective sucking and swallowing by providing a more normal anatomical structure. It helps to prevent milk from entering the nasal passage, thereby reducing the risk of aspiration and enhancing the infant's ability to feed efficiently. The feeding plate also aids in the development of the oral muscles and can contribute to better growth and weight gain. Its custom fabrication and proper fitting by a prosthodontist are crucial for ensuring comfort and functionality, as well as for minimizing potential complications. Early intervention with a feeding plate can significantly improve the quality of life for both the infant and the parents.
Michigan HealthTech Market Map 2024. Includes 7 categories: Policy Makers, Academic Innovation Centers, Digital Health Providers, Healthcare Providers, Payers / Insurance, Device Companies, Life Science Companies, Innovation Accelerators. Developed by the Michigan-Israel Business Accelerator
International Cancer Survivors Day is celebrated during June, placing the spotlight not only on cancer survivors, but also their caregivers.
CANSA has compiled a list of tips and guidelines of support:
https://cansa.org.za/who-cares-for-cancer-patients-caregivers/
Rate Controlled Drug Delivery Systems, Activation Modulated Drug Delivery Systems, Mechanically activated, pH activated, Enzyme activated, Osmotic activated Drug Delivery Systems, Feedback regulated Drug Delivery Systems systems are discussed here.
This document is designed as an introductory to medical students,nursing students,midwives or other healthcare trainees to improve their understanding about how health system in Sri Lanka cares children health.
Empowering ACOs: Leveraging Quality Management Tools for MIPS and BeyondHealth Catalyst
Join us as we delve into the crucial realm of quality reporting for MSSP (Medicare Shared Savings Program) Accountable Care Organizations (ACOs).
In this session, we will explore how a robust quality management solution can empower your organization to meet regulatory requirements and improve processes for MIPS reporting and internal quality programs. Learn how our MeasureAble application enables compliance and fosters continuous improvement.
INFECTION OF THE BRAIN -ENCEPHALITIS ( PPT)blessyjannu21
Neurological system includes brain and spinal cord. It plays an important role in functioning of our body. Encephalitis is the inflammation of the brain. Causes include viral infections, infections from insect bites or an autoimmune reaction that affects the brain. It can be life-threatening or cause long-term complications. Treatment varies, but most people require hospitalization so they can receive intensive treatment, including life support.
We are one of the top Massage Spa Ajman Our highly skilled, experienced, and certified massage therapists from different corners of the world are committed to serving you with a soothing and relaxing experience. Luxuriate yourself at our spas in Sharjah and Ajman, which are indeed enriched with an ambiance of relaxation and tranquility. We could confidently claim that we are one of the most affordable Spa Ajman and Sharjah as well, where you can book the massage session of your choice for just 99 AED at any time as we are open 24 hours a day, 7 days a week.
Visit : https://massagespaajman.com/
Call : 052 987 1315
PET CT beginners Guide covers some of the underrepresented topics in PET CTMiadAlsulami
This lecture briefly covers some of the underrepresented topics in Molecular imaging with cases , such as:
- Primary pleural tumors and pleural metastases.
- Distinguishing between MPM and Talc Pleurodesis.
- Urological tumors.
- The role of FDG PET in NET.
Can coffee help me lose weight? Yes, 25,422 users in the USA use it for that ...nirahealhty
The South Beach Coffee Java Diet is a variation of the popular South Beach Diet, which was developed by cardiologist Dr. Arthur Agatston. The original South Beach Diet focuses on consuming lean proteins, healthy fats, and low-glycemic index carbohydrates. The South Beach Coffee Java Diet adds the element of coffee, specifically caffeine, to enhance weight loss and improve energy levels.
Stem Cell Solutions: Dr. David Greene's Path to Non-Surgical Cardiac CareDr. David Greene Arizona
Explore the groundbreaking work of Dr. David Greene, a pioneer in regenerative medicine, who is revolutionizing the field of cardiology through stem cell therapy in Arizona. This ppt delves into how Dr. Greene's innovative approach is providing non-surgical, effective treatments for heart disease, using the body's own cells to repair heart damage and improve patient outcomes. Learn about the science behind stem cell therapy, its benefits over traditional cardiac surgeries, and the promising future it holds for modern medicine. Join us as we uncover how Dr. Greene's commitment to stem cell research and therapy is setting new standards in healthcare and offering new hope to cardiac patients.
The dimensions of healthcare quality refer to various attributes or aspects that define the standard of healthcare services. These dimensions are used to evaluate, measure, and improve the quality of care provided to patients. A comprehensive understanding of these dimensions ensures that healthcare systems can address various aspects of patient care effectively and holistically. Dimensions of Healthcare Quality and Performance of care include the following; Appropriateness, Availability, Competence, Continuity, Effectiveness, Efficiency, Efficacy, Prevention, Respect and Care, Safety as well as Timeliness.
Deep Leg Vein Thrombosis (DVT): Meaning, Causes, Symptoms, Treatment, and Mor...The Lifesciences Magazine
Deep Leg Vein Thrombosis occurs when a blood clot forms in one or more of the deep veins in the legs. These clots can impede blood flow, leading to severe complications.
Deep Leg Vein Thrombosis (DVT): Meaning, Causes, Symptoms, Treatment, and Mor...
CRYOPRESERVATION.pptx
1. CRYO2020: Rosemont ,Illinois U.S.A
EFFECTS OF VITRIFICATION ONMORPHOLOGY AND mRNA EXPRESSION IN
APOPTOTIC GENES IN OVINE IMMATURE CUMULUS OOCYTE COMPLEXES
Satish Kumar, Associate Professor
Maharishi Markandeshwar (deemed to be) University, Mullana, Ambala Haryana ,India
2. Introduction
Cryobiology is the study of the effects of low temperatures on living organisms.
In the future, it may be possible to cryopreserve human and animal cells, whole
organs, such as kidneys, hearts and livers for subsequent transplantation,
preserve corneas and other delicate tissues with minimal damage long enough to
allow them to be shared all over the world Oocyte is female gametocyte or germ
cell involved in reproduction.
Oocyte cryopreservation make possibility of salvaging genetic material from
prepubertal, infertile, pregnant or even from dead animal. Creating oocyte bank
and revival of extinct and endangered species in animals.
3. Apoptosis is a programmed cell death (PCD) as compared to accidental death of infected transformed or
damaged cells by activation of a specific biochemical pathway.
In vertebrates, apoptosis can be induced by a number of distinct death inducing stimuli, including the
lack of extracellular survival factors, steroid hormones, activation of membrane bound death receptors,
viral infection, heat shock, oxidative stress, excitotoxicity, ionizing radiation and various other cellular
insults.
Sheep are placid animals and, because of their size, can easily be handled. Sheep are quite similar in
body weight to humans, and sufficiently large to allow serial sampling and multiple experimental
procedures (Hubrecht and Kirkwood, 2010).
Researchers have successfully studied fetal circulatory system function, anesthesia, catheterization
techniques, and steroid radio immunoassays with sheep models. Subsequent to this, pregnant ewes
became common subjects in noninvasive studies by ultrasonography, by which the monitoring of fetal
physiology could be performed easily and safely.
Oocyte Cryopreservation
4. Objectives
1. Retrieval of immature cumulus oocyte complexes (COC) from sheep ovaries.
2. Cryopreservation of immature cumulus oocyte complexes (COC) by
vitrification.
3. Comparative morphological studies of cumulus oocyte complexes (COC)
before and after cryopreservation by Zoom stereo microscope
4. Apoptotic gene BAD, BAK,BAX,BID,BOK,BCL2A1,BCL2,MCL1 expression
study in non-vitrified and vitrified thawed cumulus oocyte complexes by Real
Time-PCR using GAPDH as reference genes
5. Solutions for oocyte collection
Normal saline containing antibiotics
Composition - Volume (1000ml)
Sodium chloride - 9.0 gm
Penicillin G - 0.12 gm
Distilled water - 1000 ml
Aspiration medium (for about 250-300 ovaries)
Composition -Volume (100 ml)
TCM-199 (Hepes modified) - 50 ml
DPBS - 50 ml
BSA - 0.3 gm
Gentamycin - 50g/ml
L-glutamine - As recommended by
the manufacturer
6. The aspirated oocytes were graded according to the following criteria already in use in the laboratory:
Grade-A: Oocytes with homogeneous cytoplasmic granulation, multilayerd unexpanded cumulus cell
layers associated with the oocyte.
Grade-B: Oocytes with homogeneous cytoplasmic granulation, 3-4 layers of unexpanded cumulus cell
layers associated with the oocyte.
Grade-C: Oocytes with homogeneous cytoplasmic granulation, with a few or irregularly arranged
unexpanded cumulus cell layers associated with the oocyte. Some of the oocytes with expanded
cumulus cells were also graded as C grade oocytes.
Grade-D: deformed or irregular ooplasm without no cumulus cells associated. C and D grade oocytes
were not used, though the number was recorded.
Oocytes of grades A and B were used for experimentation.
7. Experiment
The immature oocytes were divided into 3 groups after
morphological evaluation for observing effects of
different cryoprotectants and subjected to vitrification.
Oocytes were thawed at least after three weeks of
cryopreservation for morphological evaluation
The percentage of recovered oocytes recorded. This
experiment was replicated 6 times.
9. cDNA Synthesis and Primers
Total RNA was isolated from fresh and cryopreserved sheep oocytes (n=30 each)
using the RNAqueous- Micro Kit (Ambion Inc. )
cDNA was synthesized by First-strand cDNAs Superscript III, cDNA synthesis
kit (Invitrogen) according to the manufacturer’s instructions.
Primers used in the present study were designed from highly conserved region
from sheep, goat, bovine sequences available in NCBI databases using Primer 3
software . The primers were synthesized from the Sigma Company, Bangaluru.
The primer sequences, annealing temperature and sizes of amplified products
are shown in Table 2.
10. Reaction mix components and their
concentrations for cDNA synthesis
S.No. Component Sock Conc. Working conc. Per reaction
volume per reation
(20µl)
1 DNase treated RNA - - 5 μl
2 Random primer 50ng/μl 75ng/μl 1.5μl
3 dNTP’s 10mM 500μM 1μl
4 RNase OUT 40U/μl 40U 1μl
5 Reaction buffer 10X 1X 2μl
6 Mgcl2 25mM 2.5mM 2μl
7 DTT 100mM 2.5mM 0.5μl
8 Reverse Transcriptase 200U/μl 200U 0.5μl
9 DEPC Treated Water - - 6.5μl
11. Accession number of genes
Gene Sheep Goat Bovine
BAD
XM_004019650 XM_005699970 NM_001035459
BAK
XM_004018758 ---- NM_001098868
BAX
XM_004015363 XM_005692695 NM_173894
BID
GAAI0100248 XM_005681052 NM_001075446
BOK
XM_004015786 ---- NM_001098868
BCL2A1
XM_004015786 XM_005698059 NM_001037100
BCL2
XM_004020687 XM_005697325 NM_001166486
MCL1
XM_004002457 XM_005677664 NM_001099206
P53
X81705 XM_005677664 X81704
GAPDH
NM_001190390 XM_005680968 XM_001034034
12. List of primers used in the present study
GENE Sequence Annealing Tem./ Cycles Size
BAD F- CCAGAGCATGTTCCAGATCC
R- GTTAGCCAGTGCTTGCTGAG
60/40 125bp
BAK F- GCTACGACACAGAGTTCCAG
R- TTGATGCCGCTCTCAAACAG
60/40 108bp
BAX F- TGAATTGGACAGTAACATGGAG
R- GAAGGAAGTCCAATGTCCAG
60/40 229bp
BID F- CCTTCATCAACCAGAACCTCC
R- GTCTCAAGCCGTCTTCTCTG
60/40 182bp
BOK F- TTGTGTCTCTGTACTCGGTG
R- CAACAGCATGAAGAAGGCAG
60/40 166bp
BCL2A1 F- ACTGCCAGAACAATATTCAACC
R- GTAAGAATACCTTCAAAGGCGA
60/40 103bp
BCL2 F- CCTTCTTTGAGTTCGGAGGG
R-GTTCAGGTACTCGGTCATCC
60/40 100bp
MCL1 F- ACGATGTCAAGTCTTTGTCTC
R-CTGTGATGCTTTCTGCTAGTG
60/40 164bp
P53* F-GGAAGAATCGCAGGCAGAACT
R-GGAGAGCTCGGAGGACAGAA
60/40 109bp
GAPDH F-CCATACTCAGCCATCAAGGA
R-CTGTAGCCATATTCATTGTCGT
60/40 202bp
* Ebrahimi et.al. 2010
13. Real-time quantitative PCR (qPCR)
The quantification of mRNA was carried out by using CFX96 real time
system (Bio-Rad, Hercules, CA, USA). For qPCR, the relative
quantification method was used. For this, cDNA of test samples was
randomly diluted in 1:3 ratios.
Genes were quantified using the CFX 96 thermocycler (BioRad) and
detected using Maxima_ SYBR Green/ROX qPCR Master Mix (2X)
(Fermentas).
All reactions were run in triplicate, and three biological replicates were
carried out. Relative levels of expression were determined using 2-DDCt
20. Types of damages after vitrification of immature oocytes in
different cryoprotectants
0
10
20
30
40
50
60
Cracked ZP
Split In two halves
Leaked contents
Shrunken cytoplasm
Change in Shape
Partly/ Fully denuded