This study investigated the effects of vitrification on morphology and mRNA expression of apoptotic genes in sheep immature cumulus oocyte complexes. Immature oocytes were collected from sheep ovaries and divided into groups for cryopreservation using different cryoprotectants. The oocytes were evaluated for morphology before and after vitrification and thawing. Real-time PCR was used to analyze expression of apoptotic genes BAD, BAK, BAX, BID, BOK, BCL2A1, BCL2, MCL1 in fresh and vitrified oocytes. Results showed varying recovery and damage rates among oocytes cryopreserved with different cryoprotectants. Morphological changes included cracked or split zona pell
Extraction and purification of product from fermentation is known as Downstream Processing ( DSP) or Product Recovery
It is an essential step in the manufacture of pharmaceuticals product
Cost of the product is determined by the DSP involved
The roles of group C and F streptococci in causing endemic pharyngitis are still controversial, although group C streptococci are implicated in the outbreaks of pharyngitis and associated disorders.
Syngulon - Selection technology May 2024.pdfSyngulon
Syngulon’s technology expands the capacity for selection of microorganisms. The ability to select individual microbes with a behavior of interest is essential, whether for simple cloning at the bench, or for industry-scale production. Synthetic biology uses the concept of “bioengineering” to improve or modify existing genetic systems to create microbes with desired behaviors, and Syngulon uses this approach to develop its selection technologies.
This selection technology is based on bacteriocins, ribosomally-produced peptides naturally made by most bacteria to kill competitive microbial species. These bacteriocins can have a limited or wide target range against other microbial species. This technology offers advantageous over antibiotic selection for several reasons: it avoids the use of antibiotics in the first place, helping to reduce the spread of antibiotic resistant microbes. The technology also increases product yield; as bacteriocins are generally smaller peptides, they do not impose a heavy metabolic burden on the producing cell. They can have a wide target specificity, helping to avoid genetic drift. Finally, our system is 100% plasmid-based (e.g. without chromosomal mutations), making it applicable for use in any E. coli strains.
Structurally characterized arabinogalactan from Anoectochilus formosanus as a...Cây thuốc Việt
In this study, the innate immuno-modulatory effects and anti-cancer action of arabinogalactan (AG), a derivative of a well-known orchid, Anoectochilus formosanus, were investigated. The innate immunomodulatory effects of AG were determined in vitro using RAW 264.7 cells for microarray analysis, and in vivo using BALB/c mice administrated with AG at 5 and 15 mg/kg intra-peritoneally for 3 weeks. The anti-cancer activity of AG was evaluated by CT26 colon cancer-bearing BALB/c mice. The microarray
analysis was performed to evaluate the innate immunity and demonstrated that AG significantly induced the expression of cytokines, chemokines, and co-stimulatory receptors, such as IL-1, CXCL2, and CD69.
An intraperitoneal injection of AG in mice increased the spleen weight, but not the body weight. The treatment of mitogen, LPS significantly stimulated splenocyte proliferation in AG treated groups. The AG treatment also promoted splenocyte cytotoxicity against YAC-1 cells and increased the percentage
of CD3+CD8+ cytotoxic T cells in innate immunity test. Our experiments revealed that AG significantly decreased both tumour size and tumour weight. Besides, AG increased the percentage of DC, CD3+CD8+ T cells, CD49b+CD3− NK cells among splenocytes, and cytotoxicity activity in tumour-bearing mice. In addition, the immunohistochemistry of the tumour demonstrated that the AG treatments increased the tumour-filtrating NK and cytotoxic T-cell. These results demonstrated that AG, a polysaccharide derived
from a plant source, has potent innate immuno-modulatory and anti-cancer activity. AG may therefore be used for cancer immunotherapy.
Extraction and purification of product from fermentation is known as Downstream Processing ( DSP) or Product Recovery
It is an essential step in the manufacture of pharmaceuticals product
Cost of the product is determined by the DSP involved
The roles of group C and F streptococci in causing endemic pharyngitis are still controversial, although group C streptococci are implicated in the outbreaks of pharyngitis and associated disorders.
Syngulon - Selection technology May 2024.pdfSyngulon
Syngulon’s technology expands the capacity for selection of microorganisms. The ability to select individual microbes with a behavior of interest is essential, whether for simple cloning at the bench, or for industry-scale production. Synthetic biology uses the concept of “bioengineering” to improve or modify existing genetic systems to create microbes with desired behaviors, and Syngulon uses this approach to develop its selection technologies.
This selection technology is based on bacteriocins, ribosomally-produced peptides naturally made by most bacteria to kill competitive microbial species. These bacteriocins can have a limited or wide target range against other microbial species. This technology offers advantageous over antibiotic selection for several reasons: it avoids the use of antibiotics in the first place, helping to reduce the spread of antibiotic resistant microbes. The technology also increases product yield; as bacteriocins are generally smaller peptides, they do not impose a heavy metabolic burden on the producing cell. They can have a wide target specificity, helping to avoid genetic drift. Finally, our system is 100% plasmid-based (e.g. without chromosomal mutations), making it applicable for use in any E. coli strains.
Structurally characterized arabinogalactan from Anoectochilus formosanus as a...Cây thuốc Việt
In this study, the innate immuno-modulatory effects and anti-cancer action of arabinogalactan (AG), a derivative of a well-known orchid, Anoectochilus formosanus, were investigated. The innate immunomodulatory effects of AG were determined in vitro using RAW 264.7 cells for microarray analysis, and in vivo using BALB/c mice administrated with AG at 5 and 15 mg/kg intra-peritoneally for 3 weeks. The anti-cancer activity of AG was evaluated by CT26 colon cancer-bearing BALB/c mice. The microarray
analysis was performed to evaluate the innate immunity and demonstrated that AG significantly induced the expression of cytokines, chemokines, and co-stimulatory receptors, such as IL-1, CXCL2, and CD69.
An intraperitoneal injection of AG in mice increased the spleen weight, but not the body weight. The treatment of mitogen, LPS significantly stimulated splenocyte proliferation in AG treated groups. The AG treatment also promoted splenocyte cytotoxicity against YAC-1 cells and increased the percentage
of CD3+CD8+ cytotoxic T cells in innate immunity test. Our experiments revealed that AG significantly decreased both tumour size and tumour weight. Besides, AG increased the percentage of DC, CD3+CD8+ T cells, CD49b+CD3− NK cells among splenocytes, and cytotoxicity activity in tumour-bearing mice. In addition, the immunohistochemistry of the tumour demonstrated that the AG treatments increased the tumour-filtrating NK and cytotoxic T-cell. These results demonstrated that AG, a polysaccharide derived
from a plant source, has potent innate immuno-modulatory and anti-cancer activity. AG may therefore be used for cancer immunotherapy.
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
How to Build a Module in Odoo 17 Using the Scaffold MethodCeline George
Odoo provides an option for creating a module by using a single line command. By using this command the user can make a whole structure of a module. It is very easy for a beginner to make a module. There is no need to make each file manually. This slide will show how to create a module using the scaffold method.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar Kanvaria
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
Delivering Micro-Credentials in Technical and Vocational Education and TrainingAG2 Design
Explore how micro-credentials are transforming Technical and Vocational Education and Training (TVET) with this comprehensive slide deck. Discover what micro-credentials are, their importance in TVET, the advantages they offer, and the insights from industry experts. Additionally, learn about the top software applications available for creating and managing micro-credentials. This presentation also includes valuable resources and a discussion on the future of these specialised certifications.
For more detailed information on delivering micro-credentials in TVET, visit this https://tvettrainer.com/delivering-micro-credentials-in-tvet/
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Introduction to AI for Nonprofits with Tapp Network
CRYOPRESERVATION.pptx
1. CRYO2020: Rosemont ,Illinois U.S.A
EFFECTS OF VITRIFICATION ONMORPHOLOGY AND mRNA EXPRESSION IN
APOPTOTIC GENES IN OVINE IMMATURE CUMULUS OOCYTE COMPLEXES
Satish Kumar, Associate Professor
Maharishi Markandeshwar (deemed to be) University, Mullana, Ambala Haryana ,India
2. Introduction
Cryobiology is the study of the effects of low temperatures on living organisms.
In the future, it may be possible to cryopreserve human and animal cells, whole
organs, such as kidneys, hearts and livers for subsequent transplantation,
preserve corneas and other delicate tissues with minimal damage long enough to
allow them to be shared all over the world Oocyte is female gametocyte or germ
cell involved in reproduction.
Oocyte cryopreservation make possibility of salvaging genetic material from
prepubertal, infertile, pregnant or even from dead animal. Creating oocyte bank
and revival of extinct and endangered species in animals.
3. Apoptosis is a programmed cell death (PCD) as compared to accidental death of infected transformed or
damaged cells by activation of a specific biochemical pathway.
In vertebrates, apoptosis can be induced by a number of distinct death inducing stimuli, including the
lack of extracellular survival factors, steroid hormones, activation of membrane bound death receptors,
viral infection, heat shock, oxidative stress, excitotoxicity, ionizing radiation and various other cellular
insults.
Sheep are placid animals and, because of their size, can easily be handled. Sheep are quite similar in
body weight to humans, and sufficiently large to allow serial sampling and multiple experimental
procedures (Hubrecht and Kirkwood, 2010).
Researchers have successfully studied fetal circulatory system function, anesthesia, catheterization
techniques, and steroid radio immunoassays with sheep models. Subsequent to this, pregnant ewes
became common subjects in noninvasive studies by ultrasonography, by which the monitoring of fetal
physiology could be performed easily and safely.
Oocyte Cryopreservation
4. Objectives
1. Retrieval of immature cumulus oocyte complexes (COC) from sheep ovaries.
2. Cryopreservation of immature cumulus oocyte complexes (COC) by
vitrification.
3. Comparative morphological studies of cumulus oocyte complexes (COC)
before and after cryopreservation by Zoom stereo microscope
4. Apoptotic gene BAD, BAK,BAX,BID,BOK,BCL2A1,BCL2,MCL1 expression
study in non-vitrified and vitrified thawed cumulus oocyte complexes by Real
Time-PCR using GAPDH as reference genes
5. Solutions for oocyte collection
Normal saline containing antibiotics
Composition - Volume (1000ml)
Sodium chloride - 9.0 gm
Penicillin G - 0.12 gm
Distilled water - 1000 ml
Aspiration medium (for about 250-300 ovaries)
Composition -Volume (100 ml)
TCM-199 (Hepes modified) - 50 ml
DPBS - 50 ml
BSA - 0.3 gm
Gentamycin - 50g/ml
L-glutamine - As recommended by
the manufacturer
6. The aspirated oocytes were graded according to the following criteria already in use in the laboratory:
Grade-A: Oocytes with homogeneous cytoplasmic granulation, multilayerd unexpanded cumulus cell
layers associated with the oocyte.
Grade-B: Oocytes with homogeneous cytoplasmic granulation, 3-4 layers of unexpanded cumulus cell
layers associated with the oocyte.
Grade-C: Oocytes with homogeneous cytoplasmic granulation, with a few or irregularly arranged
unexpanded cumulus cell layers associated with the oocyte. Some of the oocytes with expanded
cumulus cells were also graded as C grade oocytes.
Grade-D: deformed or irregular ooplasm without no cumulus cells associated. C and D grade oocytes
were not used, though the number was recorded.
Oocytes of grades A and B were used for experimentation.
7. Experiment
The immature oocytes were divided into 3 groups after
morphological evaluation for observing effects of
different cryoprotectants and subjected to vitrification.
Oocytes were thawed at least after three weeks of
cryopreservation for morphological evaluation
The percentage of recovered oocytes recorded. This
experiment was replicated 6 times.
9. cDNA Synthesis and Primers
Total RNA was isolated from fresh and cryopreserved sheep oocytes (n=30 each)
using the RNAqueous- Micro Kit (Ambion Inc. )
cDNA was synthesized by First-strand cDNAs Superscript III, cDNA synthesis
kit (Invitrogen) according to the manufacturer’s instructions.
Primers used in the present study were designed from highly conserved region
from sheep, goat, bovine sequences available in NCBI databases using Primer 3
software . The primers were synthesized from the Sigma Company, Bangaluru.
The primer sequences, annealing temperature and sizes of amplified products
are shown in Table 2.
10. Reaction mix components and their
concentrations for cDNA synthesis
S.No. Component Sock Conc. Working conc. Per reaction
volume per reation
(20µl)
1 DNase treated RNA - - 5 μl
2 Random primer 50ng/μl 75ng/μl 1.5μl
3 dNTP’s 10mM 500μM 1μl
4 RNase OUT 40U/μl 40U 1μl
5 Reaction buffer 10X 1X 2μl
6 Mgcl2 25mM 2.5mM 2μl
7 DTT 100mM 2.5mM 0.5μl
8 Reverse Transcriptase 200U/μl 200U 0.5μl
9 DEPC Treated Water - - 6.5μl
11. Accession number of genes
Gene Sheep Goat Bovine
BAD
XM_004019650 XM_005699970 NM_001035459
BAK
XM_004018758 ---- NM_001098868
BAX
XM_004015363 XM_005692695 NM_173894
BID
GAAI0100248 XM_005681052 NM_001075446
BOK
XM_004015786 ---- NM_001098868
BCL2A1
XM_004015786 XM_005698059 NM_001037100
BCL2
XM_004020687 XM_005697325 NM_001166486
MCL1
XM_004002457 XM_005677664 NM_001099206
P53
X81705 XM_005677664 X81704
GAPDH
NM_001190390 XM_005680968 XM_001034034
12. List of primers used in the present study
GENE Sequence Annealing Tem./ Cycles Size
BAD F- CCAGAGCATGTTCCAGATCC
R- GTTAGCCAGTGCTTGCTGAG
60/40 125bp
BAK F- GCTACGACACAGAGTTCCAG
R- TTGATGCCGCTCTCAAACAG
60/40 108bp
BAX F- TGAATTGGACAGTAACATGGAG
R- GAAGGAAGTCCAATGTCCAG
60/40 229bp
BID F- CCTTCATCAACCAGAACCTCC
R- GTCTCAAGCCGTCTTCTCTG
60/40 182bp
BOK F- TTGTGTCTCTGTACTCGGTG
R- CAACAGCATGAAGAAGGCAG
60/40 166bp
BCL2A1 F- ACTGCCAGAACAATATTCAACC
R- GTAAGAATACCTTCAAAGGCGA
60/40 103bp
BCL2 F- CCTTCTTTGAGTTCGGAGGG
R-GTTCAGGTACTCGGTCATCC
60/40 100bp
MCL1 F- ACGATGTCAAGTCTTTGTCTC
R-CTGTGATGCTTTCTGCTAGTG
60/40 164bp
P53* F-GGAAGAATCGCAGGCAGAACT
R-GGAGAGCTCGGAGGACAGAA
60/40 109bp
GAPDH F-CCATACTCAGCCATCAAGGA
R-CTGTAGCCATATTCATTGTCGT
60/40 202bp
* Ebrahimi et.al. 2010
13. Real-time quantitative PCR (qPCR)
The quantification of mRNA was carried out by using CFX96 real time
system (Bio-Rad, Hercules, CA, USA). For qPCR, the relative
quantification method was used. For this, cDNA of test samples was
randomly diluted in 1:3 ratios.
Genes were quantified using the CFX 96 thermocycler (BioRad) and
detected using Maxima_ SYBR Green/ROX qPCR Master Mix (2X)
(Fermentas).
All reactions were run in triplicate, and three biological replicates were
carried out. Relative levels of expression were determined using 2-DDCt
20. Types of damages after vitrification of immature oocytes in
different cryoprotectants
0
10
20
30
40
50
60
Cracked ZP
Split In two halves
Leaked contents
Shrunken cytoplasm
Change in Shape
Partly/ Fully denuded