0 Suppose that a subsidy plan is introduced for lowincome .pdfajay1317
- Rely as little as possible on automatic stabilizers 19. The paradox of thrift is an example of: - Too
much saving relative to exports - A fallacy of composition - Automatic stabilizers - Fractional
reserve banking 20. If the US dollar purchases more Mexican pesos: - The dollar has depreciated
- The peso has appreciated - Both the dollar and the peso have appreciated - The peso has
depreciated 21. True/False: It is possible for a country to invest more than it saves while running a
balanced fiscal budget and a trade surplus. - True - False.
+ 1D 1W1M3M1Y5Y Your position Shares Market value 15 145.pdfajay1317
- Part (a) State the null hypothesis. H0:m=e H0:me H0:m<e H0:me Part (b) Part (c) Part (d) State
the distribution to use for the test. (Enter your answer in the form z or tdf where df is the degrees
of freedom. Round your answer to two decimal places.) x Part (e) What is the test statistic? (If
using the z distribution round your answer to two decimal places, and if using the t distribution
round your answer to three decimal places.) -- Select-- V= Part(f) What is the p-value? (Round
your answer to four decimal places.) Explain what the p-value means for this problem. If H0 is
false, then there is a chance equal to the -value that the sample mean salary of mechanical
engineers is $300 more than the sample mean salary of electrical engineers. If H0 is true, then
there is a chance equal to the p-value that the sample mean salary of mechanical engineers is
$300 more than the sample mean salary of electrical engineers. If H0 is true, then there is a
chance equal to the p-value that the sample mean salary of mechanical engineers is at least $300
less than the sample mean salary of electrical engineers. If H0 is false, then there is a chance
equal to the p-value that the sample mean salary of mechanical engineers is at least $300 less
than the sample mean salary of electrical engineers..
proxyc CSAPP Web proxy NAME IMPORTANT Giv.pdfajay1317
/* # INPUT: a node z in the AVL Tree # OUTPUT: the new root node r of the subtree originally
rooted at z before the restructure/rebalancing at z # PRECONDITION: z is the only unbalanced
node in the subtree that it roots; the difference in height of its children is exactly 2 #
POSTCONDITION: the subtree originally rooted at z is a proper AVL subtree with node heights
properly set AVLTreeMap: : Node* AVLTreeMap::rebalance(AVLTreeMap::Node* z) {
AVLTreeMap::Node* r=z; // Your code here return r;.
AIDS is a diagnostic term applied to HIVinfected persons .pdfajay1317
. 1.1 Based on your understanding of the packaging of DNA, describe the structure displayed in
Figure 1 (5) Figure 1 Two copies of four different kinds of proteins come together to form a
structure with DNA 1.2 Identify and describe the secondary structural elements visible for the
proteins and DNA in Figure 1. Indicate if the structures contain tertiary or quaternary structure and
provide a reasoning for your answer (10) 1.3 Describe and illustrate how you could differentiate
between these three DNA strands using DNA melting experiments: Strand 1:
5AGCGGGGCGGCAGCGCGGAT3 Strand 2: 5ATGCCGATATTTTTAGCGCA3 Strand 3:
5ATTTTAAATTAGCATTTAAT3.
Three Theories of DNA Replication Who were the two scien.pdfajay1317
- In other words, we would take $992,596 today and convert it at today's rate into 99,378,882. -
Next, we would lend the 99,378,882 to the Japanese government at the 2.5% rate. - In 90 days
the Japanese Government would repay us 100MLet X== we need today. Then: X(1+0.025/4)={
100mX=799,378,882. - Hence the $ we would need today to convert into would be: 799,378,882
50.009988==$992,596..
The lemonade stands are perfectly competitive because A t.pdfajay1317
. If, in today's respective markets for one-month, three-month and six-month mortgage coupon
payments, trading determines a market price of ninety-nine and one-half ($99.50) dollars per one
hundred dollars of coupon payment receivable in one month, ninety-eight and one-fourth ($98.25)
dollars today per one hundred dollars ($100.00) of coupon payment receivable in three months,
and ninety-seven and one-fourth ($97.25) dollars per one hundred dollars ($100.00) of coupon
payment receivable in six months. A mortgage lender has just originated a twenty year, interest-
only Canadian mortgage with a balance of $500, 000.00 and an announced annual mortgage
coupon rate, r, of 6%. He offers to sell either you or your classmate, today, a security composed of
a single three-month coupon plus a single six-month coupon, each of which could alternatively be
traded on an individual basis in these markets.
a. What should you offer to pay for this security today?
b. What would your classmate offer to pay for this same security if he used the announced annual
coupon rate of 6% and the Canadian method of converting annual to monthly coupon rates to
calculate its present discounted value?
c. To whom would the lender sell the security?
d. If your classmate buys the security at the price he calculates for its present discounted value,
how much does he gain or lose (in dollars today) relative to what he would have paid by using the
market prices in the three and six coupon markets above?
e. Since you can trade in today's markets for three-month and six-month coupons, you decide you
can make an arbitrage profit from your classmate's purchase by offering to trade each of the three-
month and six-month coupon payments composing the security he now owns. Assuming you and
he limit your trading to just one coupon of each maturity, determine (i) how much of a profit you
could make and (ii) whether you buy or sell the three-month coupon you trade with him and,
analogously, whether you buy or sell the six-month coupon you trade with him.
Please show Calculations..
This program reads a decimal array and outputs each numb.pdfajay1317
. In grading eggs into small, medium, and large, the Nancy Farms packs the eggs that weigh more
than 3.6 ounces in packages marked "large" and the eggs that weigh less than 2.4 ounces into
packages marked "small"; the remainder are packed in packages marked "medium." If a day's
packaging contained 10.2% large and 4.18% small eggs, determine the mean and the standard
deviation for the eggs' weights. Assume that the distribution of the weights is normal..
Two novice business students come to their professor and a.pdfajay1317
- irketiniz zor zamanlardan geiyor ve baz eylerin deimesi gerektiini biliyorsunuz! Bu deiime liderlik
etmek iin gerekli becerilere ve kapasiteye sahip olduunuza inanyorsunuz.
Bu durum nasl bir lider gerektiriyor? Bu liderlik tarznn bileenleri nelerdir ve kanan veya "izle ve
dzelt" tipi bir yneticiden nasl farkldr?.
0 Suppose that a subsidy plan is introduced for lowincome .pdfajay1317
- Rely as little as possible on automatic stabilizers 19. The paradox of thrift is an example of: - Too
much saving relative to exports - A fallacy of composition - Automatic stabilizers - Fractional
reserve banking 20. If the US dollar purchases more Mexican pesos: - The dollar has depreciated
- The peso has appreciated - Both the dollar and the peso have appreciated - The peso has
depreciated 21. True/False: It is possible for a country to invest more than it saves while running a
balanced fiscal budget and a trade surplus. - True - False.
+ 1D 1W1M3M1Y5Y Your position Shares Market value 15 145.pdfajay1317
- Part (a) State the null hypothesis. H0:m=e H0:me H0:m<e H0:me Part (b) Part (c) Part (d) State
the distribution to use for the test. (Enter your answer in the form z or tdf where df is the degrees
of freedom. Round your answer to two decimal places.) x Part (e) What is the test statistic? (If
using the z distribution round your answer to two decimal places, and if using the t distribution
round your answer to three decimal places.) -- Select-- V= Part(f) What is the p-value? (Round
your answer to four decimal places.) Explain what the p-value means for this problem. If H0 is
false, then there is a chance equal to the -value that the sample mean salary of mechanical
engineers is $300 more than the sample mean salary of electrical engineers. If H0 is true, then
there is a chance equal to the p-value that the sample mean salary of mechanical engineers is
$300 more than the sample mean salary of electrical engineers. If H0 is true, then there is a
chance equal to the p-value that the sample mean salary of mechanical engineers is at least $300
less than the sample mean salary of electrical engineers. If H0 is false, then there is a chance
equal to the p-value that the sample mean salary of mechanical engineers is at least $300 less
than the sample mean salary of electrical engineers..
proxyc CSAPP Web proxy NAME IMPORTANT Giv.pdfajay1317
/* # INPUT: a node z in the AVL Tree # OUTPUT: the new root node r of the subtree originally
rooted at z before the restructure/rebalancing at z # PRECONDITION: z is the only unbalanced
node in the subtree that it roots; the difference in height of its children is exactly 2 #
POSTCONDITION: the subtree originally rooted at z is a proper AVL subtree with node heights
properly set AVLTreeMap: : Node* AVLTreeMap::rebalance(AVLTreeMap::Node* z) {
AVLTreeMap::Node* r=z; // Your code here return r;.
AIDS is a diagnostic term applied to HIVinfected persons .pdfajay1317
. 1.1 Based on your understanding of the packaging of DNA, describe the structure displayed in
Figure 1 (5) Figure 1 Two copies of four different kinds of proteins come together to form a
structure with DNA 1.2 Identify and describe the secondary structural elements visible for the
proteins and DNA in Figure 1. Indicate if the structures contain tertiary or quaternary structure and
provide a reasoning for your answer (10) 1.3 Describe and illustrate how you could differentiate
between these three DNA strands using DNA melting experiments: Strand 1:
5AGCGGGGCGGCAGCGCGGAT3 Strand 2: 5ATGCCGATATTTTTAGCGCA3 Strand 3:
5ATTTTAAATTAGCATTTAAT3.
Three Theories of DNA Replication Who were the two scien.pdfajay1317
- In other words, we would take $992,596 today and convert it at today's rate into 99,378,882. -
Next, we would lend the 99,378,882 to the Japanese government at the 2.5% rate. - In 90 days
the Japanese Government would repay us 100MLet X== we need today. Then: X(1+0.025/4)={
100mX=799,378,882. - Hence the $ we would need today to convert into would be: 799,378,882
50.009988==$992,596..
The lemonade stands are perfectly competitive because A t.pdfajay1317
. If, in today's respective markets for one-month, three-month and six-month mortgage coupon
payments, trading determines a market price of ninety-nine and one-half ($99.50) dollars per one
hundred dollars of coupon payment receivable in one month, ninety-eight and one-fourth ($98.25)
dollars today per one hundred dollars ($100.00) of coupon payment receivable in three months,
and ninety-seven and one-fourth ($97.25) dollars per one hundred dollars ($100.00) of coupon
payment receivable in six months. A mortgage lender has just originated a twenty year, interest-
only Canadian mortgage with a balance of $500, 000.00 and an announced annual mortgage
coupon rate, r, of 6%. He offers to sell either you or your classmate, today, a security composed of
a single three-month coupon plus a single six-month coupon, each of which could alternatively be
traded on an individual basis in these markets.
a. What should you offer to pay for this security today?
b. What would your classmate offer to pay for this same security if he used the announced annual
coupon rate of 6% and the Canadian method of converting annual to monthly coupon rates to
calculate its present discounted value?
c. To whom would the lender sell the security?
d. If your classmate buys the security at the price he calculates for its present discounted value,
how much does he gain or lose (in dollars today) relative to what he would have paid by using the
market prices in the three and six coupon markets above?
e. Since you can trade in today's markets for three-month and six-month coupons, you decide you
can make an arbitrage profit from your classmate's purchase by offering to trade each of the three-
month and six-month coupon payments composing the security he now owns. Assuming you and
he limit your trading to just one coupon of each maturity, determine (i) how much of a profit you
could make and (ii) whether you buy or sell the three-month coupon you trade with him and,
analogously, whether you buy or sell the six-month coupon you trade with him.
Please show Calculations..
This program reads a decimal array and outputs each numb.pdfajay1317
. In grading eggs into small, medium, and large, the Nancy Farms packs the eggs that weigh more
than 3.6 ounces in packages marked "large" and the eggs that weigh less than 2.4 ounces into
packages marked "small"; the remainder are packed in packages marked "medium." If a day's
packaging contained 10.2% large and 4.18% small eggs, determine the mean and the standard
deviation for the eggs' weights. Assume that the distribution of the weights is normal..
Two novice business students come to their professor and a.pdfajay1317
- irketiniz zor zamanlardan geiyor ve baz eylerin deimesi gerektiini biliyorsunuz! Bu deiime liderlik
etmek iin gerekli becerilere ve kapasiteye sahip olduunuza inanyorsunuz.
Bu durum nasl bir lider gerektiriyor? Bu liderlik tarznn bileenleri nelerdir ve kanan veya "izle ve
dzelt" tipi bir yneticiden nasl farkldr?.
Un mtodo operativo para administrar el inventario es la i.pdfajay1317
. Jennifer Company has two products: A and B. The company uses activity-based costing. The
estimated total cost and expected activity for each of the three activity cost pools are as follows.
Estimated Expected Activity Activity Cost Pool Cost Product A Product B Total Activity 1 R23 500
400 100 500 Activity 2 R18 000 500 200 700 Activity 3 R34 600 600 300 900 5.1 Calculate the
activity rate under the activity-based costing system for Activity 3. (2) 5.2 Calculate the cost per
unit of Product A under activity-based costing..
- For each of the given standard normal distributions, find the -score (critical value) corresponding
to the indicated shaded area. Round to two decimal places.
a) 0.9591
b) 0.7157
-According to the National Center for Education Statistics, the mean SAT score for the math
portion in the United States in 2021 was = 528 with a standard deviation of = 120.
a) To join the Mathletes competition team, applicants must score in the 95th percentile on the SAT
math test. What is the minimum SAT math score required to join the Mathletes? Round to the
nearest whole number.
b) If a government program offers financial aid for those who score below the 30th percentile, does
a
score of 450 qualify for financial aid? Support your answer with mathematical reasoning.
(6 points) For each of the given standard normal distributions, find the z-score (critical value)
corresponding to the indicated shaded area. Round to two decimal places. a) b) (10 points)
According to the National Center for Education Statistics, the mean SAT score for the ma portion
in the United States in 2021 was =528 with a standard deviation of =120. a) To join the "Mathletes"
competition team, applicants must score in the 95th percentile on the S math test. What is the
minimum SAT math score required to join the Mathletes? Round to the nearest whole number. b)
If a government program offers financial aid for those who score below the 30th percentile, doe
score of 450 qualify for financial aid? Support your answer with mathematical reasoning..
Supongamos que la Tierra gir hacia atrs pero an orbita.pdfajay1317
farkl atma stilinin (kanmak, uzlamak ve rekabet etmek) iliki doyumu zerindeki etkilerini aratrmak
istediimizi hayal edin. liki doyumunun benlik saygs ile rttnn bilindiini kefediyoruz. Bir ANCOVA
yrtmek, hangi iki deiken arasndaki ilikiden kaynaklanan varyans ksmen ortadan kaldracaktr?
Tm deikenler arasndaki ilikiden kaynaklanan varyans ortadan kaldrr.
atma stili ve iliki doyumu
Benlik saygs ve iliki doyumu
Benlik saygs ve atma tarz
Bir aratrma, 50 yayann, dilenci yanlarnda sevimli ve a grnen bir kpek varsa, sokak dilencisine
yalnz olduklar duruma gre daha fazla para verdiini buldu. Yayalarn cinsiyetleri de karlatrld. Aadaki
cmlelerden hangisi bu veriler zerindeki basit etki analizini (ana etkiler) aklar?
Kpek sahibi olmann (evet ya da hayr) balara etkisi ve yaya cinsiyetinin (kadn ya da erkek) balara
etkisi
Dilencinin kpei olduunda balardaki fark (evet veya hayr)
Erkek balar ile kadn balar arasndaki greceli fark
Bir kpee sahip olmann etkisinin (evet veya hayr) ve yaya cinsiyetinin (erkek veya dii) etkisinin balar
zerindeki birleik etkisi
Tm deikenler arasndaki ilikiden
kaynaklanan varyans ortadan
kaldrr.
atma stili ve iliki doyumu
Benlik saygs ve iliki doyumu
Benlik saygs ve atma tarz.
Synthesizes the new DNA strands in the 5 3 direction .pdfajay1317
# Follow the instructions in the code def times_table(num 1) : counter =1 while counter <13 :
print(counter * num 1 ) userinput = int(input("Enter a number")) Do this: # Add code to increment
the counter variable #Add code to call the times_table function with userinput as the argument
here.
returns a new copy of the LinkedList It creates a copy .pdfajay1317
. Elvira es una pintora abstracta con un talento increble pero poca fama. Una de sus pinturas,
titulada Blue Lady 13, es una obra de intenso poder y sensualidad. En 1990, lo vendi a Mega
Company para exhibirlo en la entrada pblica principal del nuevo edificio de la sede de la empresa.
Varios crticos de arte que asistieron a la inauguracin del edificio confundieron la pintura con una
obra perdida de Pablo Picasso. Escribieron sobre ello en las columnas de sus peridicos como si
hubieran hecho un gran descubrimiento. Cuando la gente comenz a inundar el Mega Building
para ver Blue Lady 13, los directores de Mega estaban encantados. Incluso llegaron a colocar un
cartel que deca: Este cuadro, titulado La Dama Azul, probablemente fue pintado por Pablo
Picasso durante su poca azul, ca. 1913. Hay algo que Elvira pueda hacer? Explicar.
el tema es derecho internacional.
Sony Ericsson is a global company that was established in .pdfajay1317
? EXERCISE 40.2 (A joint project) Two people are engaged in a joint project. If each person i puts
in the effort xi, a nonnegative number equal to at most 1 , which costs her c(xi), the outcome of the
project is worth f(x1,x2). The worth of the project is split equally between the two people,
regardless of their effort levels. Formulate this situation as a strategic game. Find the Nash
equilibria of the game when (a)f(x1,x2)=3x1x2 and c(xi)=xi2 for i=1,2, and (b)f(x1,x2)=4x1x2 and c(
xi)=xi for i=1,2. In each case, is there a pair of effort levels that yields both players higher payoffs
than the Nash equilibrium effort levels?.
11 ST segment depression may indicate Ischemia Normal fin.pdfajay1317
) The following table represents total production of goods and services and their prices in a small
country of Macrobia: (Hint: What kinds of goods and services are and are not included in the
GDP?)
Year
2014
2015
Quantity
Price
Quantity
Price
Steel (tons)
50
$220.00
40
$210.00
Bread (loaves)
200
$2.00
210
$3.00
Apples (lbs)
100
$2.00
110
$2.00
Haircuts
40
$10.00
40
$12.50
Calculate Macrobia's real GDP in 2015, using 2014 as a base year. [Hint: use the price index from
part (a) and the nominal GDP from part (b)]. Please include the appropriate calculations to explain
your answer.
($1038 is the correc tanswer but I have no idea why) PLEASE SHOW WORK!
Year 2014 2015
Quantity Price Quantity Price
Steel (tons) 50 $220.00 40 $210.00
Bread (loaves) 200 $2.00 210 $3.00
Apples (lbs) 100 $2.00 110 $2.00
Haircuts 40 $10.00 40 $12.50.
Realice una investigacin adicional para obtener ms infor.pdfajay1317
Discuss the National Patient Safety Goals and their relationship to the national safety standards
Examine safety considerations in the provision of client care. Discuss personal and environmental
factors that create a potential for injury. Describe strategies that can assist in reducing risk of
client injury What are the primary functions of OSHA? When must reporting occur? What is the
mission of NIOSH? What types of injuries are nurses at risk for in the work setting? What are
standard precautions in healthcare? How can needle stick injuries be prevented? What
precautions can the nurse take to avoid latex exposure for both healthcare workers and clients?
What legislation is in place to protect nurses against workplace violence?.
Elvira es una pintora abstracta con un talento increble p.pdfajay1317
* $3 per unit variable; $250,000 fixed each year. The company's $32 unit product cost is computed
as follows: Production and cost data for the first two years of operations are:Required: 1. Using
variable costing, what is the unit product cost for both years? 2. What is the variable costing net
operating income in Year 1 and in Year 2? 3. Reconcile the absorption costing and the variable
costing net operating income figures for each year. Complete this question by entering your
answers in the tabs below. Using variable costing, what is the unit product cost for both
years?What is the variable costing net operating income in Year 1 and in Year 2? (Loss amounts
should be indicated with a minus sign.)Reconcile the absorption costing and the variable costing
net operating income figures for each year..
Programming Assignment 4 Calculate the first 16 Fib.pdfajay1317
- Design a simple Python program with 1 function by drawing a structure diagram with 2 modules:
1 main and 1 function - The example in Topic-8 uses the Hotel background. Your design should be
close to your business topic. You may think about different calculation formulas, if-statement, for-
loop for your assignment to receive good grade. - Follow the structure diagram for Listing 6, and
use computerized drawing tool (Word) to draw your diagram - Please do not start coding before
this assignment received positive feedback - Remember: if the design is wrong, the program is
confusing if not wrong -Submit a Word document that contains the structure diagram.Structure
Diagram (cont'd) - Structure diagram for the Python program in Listing 6. begin{tabular}{|c|} hline
twonumbersmain - Generate - SeaonRoomPrice - Off SeasonRoomPrice - Call function
CalculateAvg - Print the result of two prices hline end{tabular} begin{tabular}{l} CalculateAvg
(Calculate the average of two numbers) - Use two numbers (passed from main) - Calculate the
average of two numbers - Return the result (to main) hline end{tabular} - Use it as the model for
your Assignment-6..
El sndrome X frgil es un trastorno dominante ligado al s.pdfajay1317
* 22 . Name this rhythm atrial fibrillation atrial flutter atrial tachycardia sinus tachycardia* 23. Name
this rhythm 1st degree AV block Sinus Arrhythmia Junctional Rhythm Idioventricular Rhythm*24.
Name this rhythm 1st degree AV block 2nd degree AV block Type 1 (Wenkebach) 2nd degree AV
block Type 2 3rd degree AV block.
In grading eggs into small medium and large the Nancy F.pdfajay1317
[ begin{array}{l} text { scale_x_log} 10()_{text {for } x}^{log operatorname{xIs}}+text { scale_x_log
}() text { scale_y_log } 10()_{text {for } y}^{log text { axis }}+text { scale_y_log }() end{array} ] 8.3
Exercises Problem 8.1: Consider each of the tasks below: - Construct a graphics frame. - Add a
layer of glyphs. - Set an axis label. - Divide the frame into facets. - Change the scale for the frame.
Match each of the following functions from the ggplot2 graphics package with the task it performs.
1. geom_point() 2. geom_histogram() 3. ggplot () 4. scale_y_log 10() 5. ylab() 6. facet_wrap () 7.
geom_segment () 8. xlim() 9. facet_grid() Problem 8.2: Here are several graphics based on the
mosaicData: : CPS85 data table. Write ggplot2 statements that will construct each graphic..
**** Computer Architecture ****
5 Subtract - 12 from 27 by using 8-bit signed magnitude, one's complement, two's complement
arithmetic, respectively. ( 2 pts 3=6 pts) 6 Add 12 to -27 by using 8-bit signed magnitude, one's
complement, two's complement arithmetic, respectively. ( 2 pts 3=6 pts) 7 Perform the following
multiplications by using Booth's algorithm, assuming 8-bit two's complement integers: (4 pts) 1) 12
x27 8 Multiply the value 64 (expressed by 8-bit signed two's complement representation) by 2. (2
pts) 9 Divide the value -64 (expressed by 8-bit signed two's complement representation) by 4 . ( 2
pts) 10 Express the following binary fraction in normalized floating-point form using the simple
model with excess-15 bias: (2 pts) 1) 34.0625.
for initializer_list include ltinitializer_listgt .pdfajay1317
- Accounts(memberID, fName, 1Name, email, creditCardNo, password) - CreatesProfiles
(memberID, name, gender, dob ) - pGenres (memberID, name, genre) - Movies ( movieID, title,
yearOfRelease, lengthInMinutes, avgRating) - MGenres ( movieID, genre ) - Streams ( movieID,
memberID, name, rating, dateTimeWatched) - Directors ( dID, fName, 1Name, dob) - Directs
(movieID, dID) - Actors (aID, fName, 1Name, gender) - Casts ( movieID, aID, role) The primary
keys are underlined. The referential integrity constraints are as follows: - the column memberID of
relation CreatesProfiles that references table Accounts, - the columns memberID and name of
relation pG Genres that references table CreatesProfiles, - the column movieID of relation
MGenres that references table Movies, - the column movieID of relation Streams that references
table Movies, - the columns memberID and name of relation Streams that references table
CreatesProfiles, - the column movieID of relation Directs that references table Movies, - the
column dID of relation Directs that references table Directors, - the column movieID of relation
Casts that references table Movies, and - the column alD of relation Casts that references table
Actors. The following query is intended to list the ID of directors for Action films. However, this
query does not work properly. Briefly explain why: and show the corrected SQL query SELECT
DISTINCT dID FROM MGenres M, Directs D ON (M.movieID = D.movieID) WHERE genre =
'Action';.
[][][][]
[][][][]
[][][][]
public class Pattern
{
public static void main(String[] args)
{
for (/* Your code goes here */)
{
for (/* Your code goes here */)
{
System.out.print("[]");
}
/* Your code goes here */
}
}
}
///please write in java thank you
begin{tabular}{l|l} CHALLENGE ACTIVITY & 4.11.1: Print rectangular pattern. end{tabular} Write
nested loops that make the following pattern of brackets: [][][][] [][][][] [][][][].
Inside your VM not the individual containers Develop .pdfajay1317
- Button: Go to Count Down, when clicked - Send the number displayed to the Second Activity -
Hint: use a. Intent to send the last number in the count up (4 is the last number in this example) to
the second activity b. the method startActivityForResult() go to the second activity (since the main
activity will expect a result back) 2. Second Activity a. Change its name to Count Down Activity b.
It's a count down activity- Hint: use a. Intent to send the number to the MainActivity b. the method
setResult() to send the A to MainActivity c. call finish() method How to submit: 1. On the top of the
m MainActivity add a java comment that lists the group members. 2. Compress (Zip) your
application then attached to the assignment in the blackboard. Every member in the group needs
to submit the same version. 3. For the colors you can use the colors of your own choice..
# ################################################## # Problem: # In python, sort the
values of first list using # second list as indices # (without using any prebuilt functions) # # Input
list1 =[zz,s,b,d,a,e,c] list2 =[0,2,1,0,1,3,2] # Expected Output (alphabet not sorted.) #[z ', ' d ', ' b ', '
a ', ' s ', ' c ', ' e].
Follow the instructions in the code def times_tablenum 1.pdfajay1317
. According to a report the percentage of U.S. residents living in poverty in a particular year was
12.5% for men and 15.8% for women. These percentages were estimates based on data from
large representative samples of men and women. Suppose that the sample sizes were 1,400 for
men and 1,200 for women. You would like to use the survey data to estimate the difference in the
proportion living in poverty in 2023 for men and women. a. Find a 90% confidence interval. b.
Interpret the interval..
EXERCISE 311 Contributing to a public good Each of n pe.pdfajay1317
( 6 points) The following table contains data on the average number of hours spent studying per
week, total number of absences and final grade (in percent) for a random sample of students in a
statistics class. Note: Please pay attention that the data may differ from the previous problem. Part
A Determine the regrestion equation that predicts final grade of a student from his(her) total
number of absences. Round the answers to 5 decimal places if possible. Part B Predict the final
grade of a student if this student missed (a) 0 classes (b) 3 classes (C) 6 classes Round the
answers to 5 decimal places if possible.(b) 3 classes (c) 6 classes Round the answers to 5
decimal places if possible. Part C Construct a 90% interval estimate of the mean final grade for the
population of all students who missed (a) 0 classes (a) 3 classes (a) 6 classes Round the answers
to 5 decimal places if possible. Part D Interpret the slope of the regression equation by complete
the following: We expect that the final grade by percent for every 1 additional class students miss.
Round the answers to 5 decimal places if possible.(8 points) The following table contains data on
the average number of hours spent studying per week, fotal number of absences and final grade
(n percent) for a randorn sample of students in a statistics class. Note: Please pay attention that
the data may differ from the previous problem. Part A Determine the regression equation that
predicts final grade of a student from hisher) awermge number of hours spent studing per woek.
Round the answers to 5 decimal places if possible. Part B Predict the final grade of a student if
this student spends hours to study on average per week. (a) 0 hours (b) 2 hours. (c) 4 hours.Part
B Predict the final grade of a student if this student spends hours to study on average por week.
(a) 0 hours. (b) 2 hours. (c) 4 hours. Round the antwers to 5 decimal places if postible. Part C
Construct a 95% interval estimate of the true final grade for a student who spends hours to otudy
on averege per weok: (ia) ohours. (b) 2 hours. ( (c) 4 hours: ( Round the answers to 5 decimal
places if possible. Part 0 Intepret the slope of the regression equation by complote the follow. For
evey 1 additional hour a student spends to study in every week, we expect that the finat grade
Flound the answers to 5 decimal places if possible.Note: Please pay attention that the data may
differ from the previous problem. Part A Determine the regression equation that predicts final
grade of a student from his(her) average number of hours spent studing per week: is student
spends hours to study on average per week. Round the answers to 5 decimal places if possible.
Part c Construct a 95% interval entimate of the true final grade for a atudent who apends hous to
study on awarage per week. (i4) onours..
At what level of investment ownership is significant influen.pdfajay1317
At what level of investment ownership is significant influence often presumed? Select one: A.
Between 20% and 50% of the voting stock of the investee B. Greater than 20% of the voting stock
or of the fair value of the investee C. Greater than 20% of the voting stock of the investee D.
Greater than 50% of the voting stock of the investee.
Acetabularia Information For Class 9 .docxvaibhavrinwa19
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Un mtodo operativo para administrar el inventario es la i.pdfajay1317
. Jennifer Company has two products: A and B. The company uses activity-based costing. The
estimated total cost and expected activity for each of the three activity cost pools are as follows.
Estimated Expected Activity Activity Cost Pool Cost Product A Product B Total Activity 1 R23 500
400 100 500 Activity 2 R18 000 500 200 700 Activity 3 R34 600 600 300 900 5.1 Calculate the
activity rate under the activity-based costing system for Activity 3. (2) 5.2 Calculate the cost per
unit of Product A under activity-based costing..
- For each of the given standard normal distributions, find the -score (critical value) corresponding
to the indicated shaded area. Round to two decimal places.
a) 0.9591
b) 0.7157
-According to the National Center for Education Statistics, the mean SAT score for the math
portion in the United States in 2021 was = 528 with a standard deviation of = 120.
a) To join the Mathletes competition team, applicants must score in the 95th percentile on the SAT
math test. What is the minimum SAT math score required to join the Mathletes? Round to the
nearest whole number.
b) If a government program offers financial aid for those who score below the 30th percentile, does
a
score of 450 qualify for financial aid? Support your answer with mathematical reasoning.
(6 points) For each of the given standard normal distributions, find the z-score (critical value)
corresponding to the indicated shaded area. Round to two decimal places. a) b) (10 points)
According to the National Center for Education Statistics, the mean SAT score for the ma portion
in the United States in 2021 was =528 with a standard deviation of =120. a) To join the "Mathletes"
competition team, applicants must score in the 95th percentile on the S math test. What is the
minimum SAT math score required to join the Mathletes? Round to the nearest whole number. b)
If a government program offers financial aid for those who score below the 30th percentile, doe
score of 450 qualify for financial aid? Support your answer with mathematical reasoning..
Supongamos que la Tierra gir hacia atrs pero an orbita.pdfajay1317
farkl atma stilinin (kanmak, uzlamak ve rekabet etmek) iliki doyumu zerindeki etkilerini aratrmak
istediimizi hayal edin. liki doyumunun benlik saygs ile rttnn bilindiini kefediyoruz. Bir ANCOVA
yrtmek, hangi iki deiken arasndaki ilikiden kaynaklanan varyans ksmen ortadan kaldracaktr?
Tm deikenler arasndaki ilikiden kaynaklanan varyans ortadan kaldrr.
atma stili ve iliki doyumu
Benlik saygs ve iliki doyumu
Benlik saygs ve atma tarz
Bir aratrma, 50 yayann, dilenci yanlarnda sevimli ve a grnen bir kpek varsa, sokak dilencisine
yalnz olduklar duruma gre daha fazla para verdiini buldu. Yayalarn cinsiyetleri de karlatrld. Aadaki
cmlelerden hangisi bu veriler zerindeki basit etki analizini (ana etkiler) aklar?
Kpek sahibi olmann (evet ya da hayr) balara etkisi ve yaya cinsiyetinin (kadn ya da erkek) balara
etkisi
Dilencinin kpei olduunda balardaki fark (evet veya hayr)
Erkek balar ile kadn balar arasndaki greceli fark
Bir kpee sahip olmann etkisinin (evet veya hayr) ve yaya cinsiyetinin (erkek veya dii) etkisinin balar
zerindeki birleik etkisi
Tm deikenler arasndaki ilikiden
kaynaklanan varyans ortadan
kaldrr.
atma stili ve iliki doyumu
Benlik saygs ve iliki doyumu
Benlik saygs ve atma tarz.
Synthesizes the new DNA strands in the 5 3 direction .pdfajay1317
# Follow the instructions in the code def times_table(num 1) : counter =1 while counter <13 :
print(counter * num 1 ) userinput = int(input("Enter a number")) Do this: # Add code to increment
the counter variable #Add code to call the times_table function with userinput as the argument
here.
returns a new copy of the LinkedList It creates a copy .pdfajay1317
. Elvira es una pintora abstracta con un talento increble pero poca fama. Una de sus pinturas,
titulada Blue Lady 13, es una obra de intenso poder y sensualidad. En 1990, lo vendi a Mega
Company para exhibirlo en la entrada pblica principal del nuevo edificio de la sede de la empresa.
Varios crticos de arte que asistieron a la inauguracin del edificio confundieron la pintura con una
obra perdida de Pablo Picasso. Escribieron sobre ello en las columnas de sus peridicos como si
hubieran hecho un gran descubrimiento. Cuando la gente comenz a inundar el Mega Building
para ver Blue Lady 13, los directores de Mega estaban encantados. Incluso llegaron a colocar un
cartel que deca: Este cuadro, titulado La Dama Azul, probablemente fue pintado por Pablo
Picasso durante su poca azul, ca. 1913. Hay algo que Elvira pueda hacer? Explicar.
el tema es derecho internacional.
Sony Ericsson is a global company that was established in .pdfajay1317
? EXERCISE 40.2 (A joint project) Two people are engaged in a joint project. If each person i puts
in the effort xi, a nonnegative number equal to at most 1 , which costs her c(xi), the outcome of the
project is worth f(x1,x2). The worth of the project is split equally between the two people,
regardless of their effort levels. Formulate this situation as a strategic game. Find the Nash
equilibria of the game when (a)f(x1,x2)=3x1x2 and c(xi)=xi2 for i=1,2, and (b)f(x1,x2)=4x1x2 and c(
xi)=xi for i=1,2. In each case, is there a pair of effort levels that yields both players higher payoffs
than the Nash equilibrium effort levels?.
11 ST segment depression may indicate Ischemia Normal fin.pdfajay1317
) The following table represents total production of goods and services and their prices in a small
country of Macrobia: (Hint: What kinds of goods and services are and are not included in the
GDP?)
Year
2014
2015
Quantity
Price
Quantity
Price
Steel (tons)
50
$220.00
40
$210.00
Bread (loaves)
200
$2.00
210
$3.00
Apples (lbs)
100
$2.00
110
$2.00
Haircuts
40
$10.00
40
$12.50
Calculate Macrobia's real GDP in 2015, using 2014 as a base year. [Hint: use the price index from
part (a) and the nominal GDP from part (b)]. Please include the appropriate calculations to explain
your answer.
($1038 is the correc tanswer but I have no idea why) PLEASE SHOW WORK!
Year 2014 2015
Quantity Price Quantity Price
Steel (tons) 50 $220.00 40 $210.00
Bread (loaves) 200 $2.00 210 $3.00
Apples (lbs) 100 $2.00 110 $2.00
Haircuts 40 $10.00 40 $12.50.
Realice una investigacin adicional para obtener ms infor.pdfajay1317
Discuss the National Patient Safety Goals and their relationship to the national safety standards
Examine safety considerations in the provision of client care. Discuss personal and environmental
factors that create a potential for injury. Describe strategies that can assist in reducing risk of
client injury What are the primary functions of OSHA? When must reporting occur? What is the
mission of NIOSH? What types of injuries are nurses at risk for in the work setting? What are
standard precautions in healthcare? How can needle stick injuries be prevented? What
precautions can the nurse take to avoid latex exposure for both healthcare workers and clients?
What legislation is in place to protect nurses against workplace violence?.
Elvira es una pintora abstracta con un talento increble p.pdfajay1317
* $3 per unit variable; $250,000 fixed each year. The company's $32 unit product cost is computed
as follows: Production and cost data for the first two years of operations are:Required: 1. Using
variable costing, what is the unit product cost for both years? 2. What is the variable costing net
operating income in Year 1 and in Year 2? 3. Reconcile the absorption costing and the variable
costing net operating income figures for each year. Complete this question by entering your
answers in the tabs below. Using variable costing, what is the unit product cost for both
years?What is the variable costing net operating income in Year 1 and in Year 2? (Loss amounts
should be indicated with a minus sign.)Reconcile the absorption costing and the variable costing
net operating income figures for each year..
Programming Assignment 4 Calculate the first 16 Fib.pdfajay1317
- Design a simple Python program with 1 function by drawing a structure diagram with 2 modules:
1 main and 1 function - The example in Topic-8 uses the Hotel background. Your design should be
close to your business topic. You may think about different calculation formulas, if-statement, for-
loop for your assignment to receive good grade. - Follow the structure diagram for Listing 6, and
use computerized drawing tool (Word) to draw your diagram - Please do not start coding before
this assignment received positive feedback - Remember: if the design is wrong, the program is
confusing if not wrong -Submit a Word document that contains the structure diagram.Structure
Diagram (cont'd) - Structure diagram for the Python program in Listing 6. begin{tabular}{|c|} hline
twonumbersmain - Generate - SeaonRoomPrice - Off SeasonRoomPrice - Call function
CalculateAvg - Print the result of two prices hline end{tabular} begin{tabular}{l} CalculateAvg
(Calculate the average of two numbers) - Use two numbers (passed from main) - Calculate the
average of two numbers - Return the result (to main) hline end{tabular} - Use it as the model for
your Assignment-6..
El sndrome X frgil es un trastorno dominante ligado al s.pdfajay1317
* 22 . Name this rhythm atrial fibrillation atrial flutter atrial tachycardia sinus tachycardia* 23. Name
this rhythm 1st degree AV block Sinus Arrhythmia Junctional Rhythm Idioventricular Rhythm*24.
Name this rhythm 1st degree AV block 2nd degree AV block Type 1 (Wenkebach) 2nd degree AV
block Type 2 3rd degree AV block.
In grading eggs into small medium and large the Nancy F.pdfajay1317
[ begin{array}{l} text { scale_x_log} 10()_{text {for } x}^{log operatorname{xIs}}+text { scale_x_log
}() text { scale_y_log } 10()_{text {for } y}^{log text { axis }}+text { scale_y_log }() end{array} ] 8.3
Exercises Problem 8.1: Consider each of the tasks below: - Construct a graphics frame. - Add a
layer of glyphs. - Set an axis label. - Divide the frame into facets. - Change the scale for the frame.
Match each of the following functions from the ggplot2 graphics package with the task it performs.
1. geom_point() 2. geom_histogram() 3. ggplot () 4. scale_y_log 10() 5. ylab() 6. facet_wrap () 7.
geom_segment () 8. xlim() 9. facet_grid() Problem 8.2: Here are several graphics based on the
mosaicData: : CPS85 data table. Write ggplot2 statements that will construct each graphic..
**** Computer Architecture ****
5 Subtract - 12 from 27 by using 8-bit signed magnitude, one's complement, two's complement
arithmetic, respectively. ( 2 pts 3=6 pts) 6 Add 12 to -27 by using 8-bit signed magnitude, one's
complement, two's complement arithmetic, respectively. ( 2 pts 3=6 pts) 7 Perform the following
multiplications by using Booth's algorithm, assuming 8-bit two's complement integers: (4 pts) 1) 12
x27 8 Multiply the value 64 (expressed by 8-bit signed two's complement representation) by 2. (2
pts) 9 Divide the value -64 (expressed by 8-bit signed two's complement representation) by 4 . ( 2
pts) 10 Express the following binary fraction in normalized floating-point form using the simple
model with excess-15 bias: (2 pts) 1) 34.0625.
for initializer_list include ltinitializer_listgt .pdfajay1317
- Accounts(memberID, fName, 1Name, email, creditCardNo, password) - CreatesProfiles
(memberID, name, gender, dob ) - pGenres (memberID, name, genre) - Movies ( movieID, title,
yearOfRelease, lengthInMinutes, avgRating) - MGenres ( movieID, genre ) - Streams ( movieID,
memberID, name, rating, dateTimeWatched) - Directors ( dID, fName, 1Name, dob) - Directs
(movieID, dID) - Actors (aID, fName, 1Name, gender) - Casts ( movieID, aID, role) The primary
keys are underlined. The referential integrity constraints are as follows: - the column memberID of
relation CreatesProfiles that references table Accounts, - the columns memberID and name of
relation pG Genres that references table CreatesProfiles, - the column movieID of relation
MGenres that references table Movies, - the column movieID of relation Streams that references
table Movies, - the columns memberID and name of relation Streams that references table
CreatesProfiles, - the column movieID of relation Directs that references table Movies, - the
column dID of relation Directs that references table Directors, - the column movieID of relation
Casts that references table Movies, and - the column alD of relation Casts that references table
Actors. The following query is intended to list the ID of directors for Action films. However, this
query does not work properly. Briefly explain why: and show the corrected SQL query SELECT
DISTINCT dID FROM MGenres M, Directs D ON (M.movieID = D.movieID) WHERE genre =
'Action';.
[][][][]
[][][][]
[][][][]
public class Pattern
{
public static void main(String[] args)
{
for (/* Your code goes here */)
{
for (/* Your code goes here */)
{
System.out.print("[]");
}
/* Your code goes here */
}
}
}
///please write in java thank you
begin{tabular}{l|l} CHALLENGE ACTIVITY & 4.11.1: Print rectangular pattern. end{tabular} Write
nested loops that make the following pattern of brackets: [][][][] [][][][] [][][][].
Inside your VM not the individual containers Develop .pdfajay1317
- Button: Go to Count Down, when clicked - Send the number displayed to the Second Activity -
Hint: use a. Intent to send the last number in the count up (4 is the last number in this example) to
the second activity b. the method startActivityForResult() go to the second activity (since the main
activity will expect a result back) 2. Second Activity a. Change its name to Count Down Activity b.
It's a count down activity- Hint: use a. Intent to send the number to the MainActivity b. the method
setResult() to send the A to MainActivity c. call finish() method How to submit: 1. On the top of the
m MainActivity add a java comment that lists the group members. 2. Compress (Zip) your
application then attached to the assignment in the blackboard. Every member in the group needs
to submit the same version. 3. For the colors you can use the colors of your own choice..
# ################################################## # Problem: # In python, sort the
values of first list using # second list as indices # (without using any prebuilt functions) # # Input
list1 =[zz,s,b,d,a,e,c] list2 =[0,2,1,0,1,3,2] # Expected Output (alphabet not sorted.) #[z ', ' d ', ' b ', '
a ', ' s ', ' c ', ' e].
Follow the instructions in the code def times_tablenum 1.pdfajay1317
. According to a report the percentage of U.S. residents living in poverty in a particular year was
12.5% for men and 15.8% for women. These percentages were estimates based on data from
large representative samples of men and women. Suppose that the sample sizes were 1,400 for
men and 1,200 for women. You would like to use the survey data to estimate the difference in the
proportion living in poverty in 2023 for men and women. a. Find a 90% confidence interval. b.
Interpret the interval..
EXERCISE 311 Contributing to a public good Each of n pe.pdfajay1317
( 6 points) The following table contains data on the average number of hours spent studying per
week, total number of absences and final grade (in percent) for a random sample of students in a
statistics class. Note: Please pay attention that the data may differ from the previous problem. Part
A Determine the regrestion equation that predicts final grade of a student from his(her) total
number of absences. Round the answers to 5 decimal places if possible. Part B Predict the final
grade of a student if this student missed (a) 0 classes (b) 3 classes (C) 6 classes Round the
answers to 5 decimal places if possible.(b) 3 classes (c) 6 classes Round the answers to 5
decimal places if possible. Part C Construct a 90% interval estimate of the mean final grade for the
population of all students who missed (a) 0 classes (a) 3 classes (a) 6 classes Round the answers
to 5 decimal places if possible. Part D Interpret the slope of the regression equation by complete
the following: We expect that the final grade by percent for every 1 additional class students miss.
Round the answers to 5 decimal places if possible.(8 points) The following table contains data on
the average number of hours spent studying per week, fotal number of absences and final grade
(n percent) for a randorn sample of students in a statistics class. Note: Please pay attention that
the data may differ from the previous problem. Part A Determine the regression equation that
predicts final grade of a student from hisher) awermge number of hours spent studing per woek.
Round the answers to 5 decimal places if possible. Part B Predict the final grade of a student if
this student spends hours to study on average per week. (a) 0 hours (b) 2 hours. (c) 4 hours.Part
B Predict the final grade of a student if this student spends hours to study on average por week.
(a) 0 hours. (b) 2 hours. (c) 4 hours. Round the antwers to 5 decimal places if postible. Part C
Construct a 95% interval estimate of the true final grade for a student who spends hours to otudy
on averege per weok: (ia) ohours. (b) 2 hours. ( (c) 4 hours: ( Round the answers to 5 decimal
places if possible. Part 0 Intepret the slope of the regression equation by complote the follow. For
evey 1 additional hour a student spends to study in every week, we expect that the finat grade
Flound the answers to 5 decimal places if possible.Note: Please pay attention that the data may
differ from the previous problem. Part A Determine the regression equation that predicts final
grade of a student from his(her) average number of hours spent studing per week: is student
spends hours to study on average per week. Round the answers to 5 decimal places if possible.
Part c Construct a 95% interval entimate of the true final grade for a atudent who apends hous to
study on awarage per week. (i4) onours..
At what level of investment ownership is significant influen.pdfajay1317
At what level of investment ownership is significant influence often presumed? Select one: A.
Between 20% and 50% of the voting stock of the investee B. Greater than 20% of the voting stock
or of the fair value of the investee C. Greater than 20% of the voting stock of the investee D.
Greater than 50% of the voting stock of the investee.
Acetabularia Information For Class 9 .docxvaibhavrinwa19
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
Embracing GenAI - A Strategic ImperativePeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Read| The latest issue of The Challenger is here! We are thrilled to announce that our school paper has qualified for the NATIONAL SCHOOLS PRESS CONFERENCE (NSPC) 2024. Thank you for your unwavering support and trust. Dive into the stories that made us stand out!
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.