Medicall genetics lab manual

Molecular Genetics Laboratory
Dr. Basim Ayesh
Medical Technology Department
Al Aqsa University
2014‐2015

AL Aqsa university
Medical Technology department
Safety Procedures
Chemicals
A number of chemicals used in any molecular biology laboratory are hazardous. All
manufacturers of hazardous materials are required by law to supply the user with pertinent
information on any hazards associated with their chemicals. This information is supplied in
the form of Material Safety Data Sheets or MSDS. This information contains the chemical
name, Chemical Abstracts Service (CAS)#, health hazard data, including first aid treatment,
physical data, fire and explosion hazard data, reactivity data, spill or leak procedures, and
any special precautions needed when handling this chemical. A file containing MSDS
information on the hazardous substances should be kept in the lab. In addition, MSDS
information can be accessed on World Wide Web. You are strongly urged to make use
of this information prior to using a new chemical and certainly in the case of any accidental
exposure or spill.
The instructor/lab manager must be notified immediately in the case of an accident
involving any potentially hazardous reagents.
The following chemicals are particularly noteworthy:
 always wear gloves when using potentially hazardous chemicals
 never mouth‐pipet them
 If you accidentally splash any of these chemicals on your skin, immediately rinse
Ultraviolet Light
Exposure to ultraviolet light can cause acute eye irritation. Since the retina cannot detect
UV light, you can have serious eye damage and not realize it until 30 min to 24 hours
after exposure. Therefore, always wear appropriate eye protection when using UV lamps.
Electricity
The voltages used for electrophoresis are sufficient to cause electrocution. Cover the buffer
reservoirs during electrophoresis. Always turn off the power supply and unplug the leads
before removing a gel.
General Housekeeping
 All common areas should be kept free of clutter and all dirty dishes,
 Since you have only a limited amount of space to call your own, it is to your
 Since you will use common facilities, all solutions and everything stored in an
incubator, refrigerator, etc. must be labeled. In order to limit confusion, each
person should use his initials or other unique designation for labeling tubes, etc.
2
1. General Laboratory Procedures, Equipment Use, and
Safety Considerations
 Phenol ‐ can cause severe burns
 Acrylamide ‐ potential neurotoxin
 Ethidium bromide ‐ carcinogen
These chemicals are not harmful if used properly:
the area thoroughly with water and inform the instructor.
 Discard the waste in appropriate
containers
electrophoresis equipment, etc. should be dealt with appropriately.
advantage to keep your own area clean.
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh

AL Aqsa university
Unlabeled material found in the refrigerators, incubators, or freezers may be
destroyed. Always mark your materials with your initials, the date, and relevant
experimental data.
1. A molar solution is one in which 1 liter of solution contains the number of grams
equal to its molecular weight.
Example: To make up 100 ml of a 5M NaCl solution = 58.456 (mw of NaCl)
g/mol x 5 moles/liter x 0.1 liter = 29.29 g in 100 ml of solution
2. Percent solutions.Percentage (w/v) = weight (g) in 100 ml of solution; Percentage
(v/v) = volume (ml) in 100 ml of solution.
Example: To make a 0.7% solution of agarose in TBE buffer, weight 0.7 of agarose
and bring up volume to 100 ml with TBE buffer.
3. "X" Solutions. Many enzyme buffers are prepared as concentrated solutions, e.g.
5X or 10X (five or ten times the concentration of the working solution) and are
then diluted such that the final concentration of the buffer in the reaction is 1X.
Example: To set up a restriction digestion in 25 μl, one would add 2.5 μl of a 10X
buffer, the other reaction components, and water to a final volume of 25 μ l.
Preparation of Working Solutions from Concentrated Stock Solutions .
Many buffers in molecular biology require the same components but often in varying
concentrations. To avoid having to make every buffer from scratch, it is useful to prepare
several concentrated stock solutions and dilute as needed.
Example: To make 100 ml of TE buffer (10 mM Tris, 1 mM EDTA), combine 1 ml of a 1
M Tris solution and 0.2 ml of 0.5 M EDTA and 98.8 ml sterile water.
The following is useful for calculating amounts of stock solution needed: C i x V i = C f x V f
, where C i = initial concentration, or conc. of stock solution; V i = initial vol, or amount
of stock solution needed C f = final concentration, or conc. of desired solution; V f = final
vol, or volume of desired solution
Glassware and Plastic Ware .
Glass and plastic ware used for molecular biology must be clean. Dirty test tubes and
traces of detergent can inhibit reactions or degrade nucleic acid.
 Glassware should be rinsed with distilled water and autoclaved or baked at 150
 For experiments with RNA, glassware and solutions are treated with diethyl‐pyrocarbonate
 Plastic ware such as pipets and culture tubes are often supplied sterile. Tubes made
of polypropylene are turbid and are resistant to many chemicals, like phenol and
chloroform; polycarbonate or polystyrene tubes are clear and not resistant to many
chemicals. Make sure that the tubes you are using are resistant to the chemicals
used in your experiment.
2. Any media that becomes contaminated should be promptly autoclaved before
3
Preparation of Solutions
Calculation of Molar, % and "X" Solutions.
degrees C for 1 hour.
(DEPC) to inhibit RNases which can be resistant to autoclaving.
 Micro pipet tips and microfuge tubes should be autoclaved before use.
Disposal of Buffers and Chemicals
1. Any uncontaminated, solidified agarose should be discarded in the trash, not in
the sink, and the bottles rinsed well.
discarding it.

AL Aqsa university
Petri dishes and other biological waste should be discarded in Biohazard containers
which will be autoclaved prior to disposal.
3. Organic reagents, e.g. phenol, should be used in a fume hood and all organic waste
4. Ethidium bromide is a mutagenic substance that should be treated before disposal
and should be handled only with gloves. Ethidium bromide should be disposed of in
a labeled container.
5. Dirty glassware should be rinsed, all traces of agar or other substance that will not
come clean in a dishwasher should be removed, all labels should be removed (if
possible), and the glassware should be placed in the dirty dish bin. Bottle caps, stir
bars and spatulas should be washed with hot soapy water, rinsed well with hot
water, and rinsed three times with distilled water.
Equipment
General Comments
It is to everyone's advantage to keep the equipment in good working condition. As a
rule of thumb, don't use anything unless you have been instructed in the proper use.
This is true not only for equipment in the lab but also departmental equipment. Report
any malfunction immediately. Rinse out all centrifuge rotors after use and in particular if
anything spills. Please do not waste supplies ‐ use only what you need. If the supply is
running low, please notify either the instructor/lab manager before the supply is completely
exhausted.
Micropipettors
Most of the experiments you will conduct in this laboratory will depend on your ability to
accurately measure volumes of solutions using micropipettors. The accuracy of your
pipetting can only be as accurate as your pipettor and several steps should be taken to
insure that your pipettes are accurate and are maintained in good working order. Since the
pipettors will use different pipet tips, make sure that the pipet tip you are using is designed
for your pipettor. DO NOT DROP IT ON THE FLOOR. If you suspect that something is wrong
with your pipettor, first check the calibration to see if your suspicions were correct, then
notify the instructor.
Storage of DNA .
The following properties of reagents and conditions are important considerations in
processing and storing DNA and RNA.
 Heavy metals promote phosphodiester breakage. EDTA is an excellent heavy metal
 UV light at 260 nm causes a variety of lesions, including thymine dimers and
 Biological activity is rapidly lost. 320 nm irradiation can also cause cross‐link,
 Ethidium bromide causes photo oxidation of DNA with visible light and molecular
 Oxidation products can cause phosphodiester breakage.
 If no heavy metal are present, ethanol does not damage DNA.
 Nucleases are found on human skin; therefore, avoid direct or indirect contact
between nucleic acids and fingers. Most DNases are not very stable; however,
many RNases are very stable and can adsorb to glass or plastic and remain active.
4
should be disposed of in a labeled container, not in the trash or the sink.
chelator.
 Free radicals are formed from chemical breakdown and radiation and they cause
phosphodiester breakage.
cross‐link.
but less efficiently.
oxygen.

AL Aqsa university
 For long‐term storage of DNA, it is best to store in high salt ( >1M) in the
1. A notebook should be kept for laboratory experiments only using a scientific
notebook book or other bound book. The notebook should be written in ink, and
each page signed and dated. Mistakes are not to be erased but should be marked
out with a single line. Try to keep your notebook with the idea that someone else
must be able to read and understand what you have done. The notebook should
always be up‐to‐date and can be collected at any time.
2. INDEX: An index containing the title of each experiment and the page number
3. WHAT SHOULD BE INCLUDED IN THE NOTEBOOK? Essentially everything you
4. laboratory should be in your notebook. The notebook should be organized by
experiment only and should not be organized as a daily log. Start each new
experiment on a new page. The top of the page should contain the title of the
experiment, the date, and the page number. The page number is important for
indexing, referring to previous experiments, and for labeling materials used in a
given experiment. If an experiment spans more than one page, note the page on
which the experiment continues if it's not on the next page. Each experiment
should include the following:
 Title/Purpose: Every experiment should have a title and it should be
descriptive. Many experiments should also describe the purpose of the
experiment and include any information that is pertinent to the execution of
the experiment or to the interpretation of the results.
 Background information: This section should include any information that is
pertinent to the execution of the experiment or to the interpretation of the
results. Include anything that will be helpful in carrying out the experiment
and deciphering the experiment at a later date. For the most part, notebooks
are not written for today but for the future.
 Materials: This section should include the key materials, i.e., solutions or
equipment, that will be needed. It is not necessary to include every piece of
lab equipment required, i.e. vortexer, pipetman, etc, but you should include
any specialized equipment and the manufacturer, i.e, real‐time PCR
instrument. Composition of all buffers should be included unless they are
standard or are referenced. Pre‐packaged kits should be identified as to the
name of the kit, the vendor, and the catalog number. Biological samples should
be identified by genus and species, strain number, tissue type, and/or
genotype with the source of the material identified. Enzymes should be
identified by name, vendor, and concentration. DNA samples should be
identified as to 1: type of DNA, i.e., chromosomal, plasmid, etc, 2: purity
(miniprep, gel purified, PCR product) 3: concentration, if known, and 4:
source, (include prior experiment number if the DNA was isolated in a previous
experiment). Include all calculations made in preparing solutions. The
5
 ‐20 deg C: this temperature causes extensive single and double strand breaks. ‐
70 E C is probable excellent for long‐term storage.
presence of high EDTA ( >10mM) at pH 8.5.
 There is about one phosphodiester break per 200 kb of DNA per year.
Instructions for Notebook Keeping
should be included at the beginning of the notebook.
do in the

AL Aqsa university
sequence of all oligonucleotides must be included or referenced. Agarose gels
should be identified by percentage and buffer used. If any of these materials
were used in previous experiments, include only the reference to that earlier
experiment, do not repeat the information again.
 Procedure: Write down exactly what you are going to do before you do it and
make sure you understand each step before you do it. In general, You should
include everything you do including all volumes and amounts. Writing a
procedure out helps you to remember and to understand what it is about. It
will also help you to identify steps that may be unclear or that need special
attention. Flow charts are sometimes helpful for experiments that have many
parts. Tables are also useful if an experiment includes a set of reactions with
multiple variables.
 Results: This section should include all raw data, including gel photographs,
printouts, etc. All lanes on gel photographs must be labeled and always identify
the source and the amount of any standards. This section should also include
your analyzed data, for example, calculations.
 Conclusions/Summary: This is one of the most important sections. You should
summarize all of your results, even if they were stated elsewhere and state
any conclusions you can make. If the experiment didn't work, what went
wrong and what will you do the next time to try to trouble shoot?
6
These guidelines were briefed from: MOLECULAR BIOLOGY LAB MANUAL The Beginning.
Compiled by: Hikmet Geckil, Department of Molecular Biology and Genetics, Inonu
University, Malatya, Turkey

AL Aqsa university
CULTURE AND METAPHASE HARVEST OF PERIPHERAL
BLOOD
When T lymphocytes in whole blood are stimulated with the mitogenic plant lectin
phytohemagglutinin (PHA), they “activate” to blast‐like cells within 12 to 24 hr and conƟnue
to proliferate for 2 to 4 days. Metaphase cells are obtained by treaƟng cultures with Colcemid,
a colchicine analog that disrupts the centriole/spindle‐fiber complex by interfering with
microtubule formation. This treatment results in mitotic arrest, which in turn leads to an
accumulation of cells in metaphase. Mitotic arrest is followed by treatment with a hypotonic
KCl solution (hypotonic “shock”) to increase cellular volume. The cells are then fixed with
methanol/acetic acid to remove water and disrupt cell membranes before being spread onto
slides.
Most clinical cytogeneƟc laboratories culture peripheral blood lymphocytes for a period of 48‐
72 hours in a complete culture medium which consists of a basal medium supplemented with
approximately 10‐40% fetal bovine serum, PHA in the range of approximately 1‐2% v/v
depending on source, L‐glutamine and antibiotics. The optimum concentration usually needs
to be determined prior to use or one can follow vendor dilution recommendations for the lot
in use.
Materials
 Heparinized whole blood obtained via Vacutainer or syringe with preservative‐free
 PB‐MAX™ culture medium (GIBCO): an opƟmized RPMI 1640 medium, supplemented
with Fetal Bovine Serum (FBS), L‐glutamine, and phytohemagglutinin (PHA).
optimized for the karyotype analysis of peripheral blood lymphocytes. Thawed
medium can be stored at 2–8°C for up to 14 days.
o Thaw PB‐MAX Karyotyping medium at 4 to 8°C. Warm the medium to room
o PB‐MAX Karyotyping medium can be thawed and aseptically transferred into
smaller aliquots for convenience. These aliquots can be frozen and thawed at
time of use, however multiple freeze‐thaw cycles should be avoided.
 10 μg/ml Colcemid (GIBCO)
 75 mM KCl (0.56 g in 100 ml H2O; store ≤2 weeks at room temperature)
 FixaƟve: 3:1 (v/v) absolute methanol/glacial aceƟc acid, (prepare fresh and keep on
7
2. Metaphase Chromosome Preparation from Cultured
Peripheral Blood Cells
The protocols in this section were adopted from (Current Protocols in Human Genetics)
sodium heparin (25 U/ml blood)
CAUTION: Human blood is hazardous.
temperature and gently swirl to mix prior to use.
o Avoid prolonged exposure to light when using this culture medium product.
ice)
 15‐ml sterile disposable conical polypropylene centrifuge tubes

AL Aqsa university
1. Collect peripheral blood by venipuncture into a sodium heparin Vacutainer or a
 Other anticoagulants, such as lithium heparin or EDTA are toxic to cells and
 Samples should be shipped at room temperature. Blood in sodium heparin can
be held for ≤4 days and sƟll be cultured successfully, but cultures are best
initiated as soon as possible. If necessary, the specimen can be stored at 4◦C.
2. Inoculate 0.25 ml of the whole blood obtained in step 1 (0.2 ml for newborns ≤3 weeks
 A single culture typically yields three to five full‐slide preparations, or more if
only part of the slide is used. Multiple cultures may be set up to meet clinical
or research needs.
 Three‐day incubaƟons are opƟmal, but 2‐ or 4‐day cultures can be used to
 Cultures from newborns will usually work well at 2 days but may also be
harvested either directly or following a 1‐day culture. Older patients’
leukocytes require 3‐ or 4‐day cultures because they do not seem to respond
as quickly to PHA stimulation.
4. Initiate harvest by adding 50 μl of 10 μg/ml Colcemid (0.1 μg/ml final). Incubate 30
 The harvest can be initiated at any Ɵme 3 to 4 days following the culture
5. Centrifuge 7 min at 500×g, room temperature. Discard supernatant.
6. Add 5 ml of 75 mM KCl pre‐wormed at 37◦C and gently resuspend cells. Let stand 15
 The amount of hypotonic solution to be added should be adjusted to the
volume of the pellet. Some laboratories vary the length of hypotonic
treatment. Increasing the time will increase chromosome spreading, but this
treatment is a hypotonic “shock,” so that increasing the amount of hypotonic
solution will have more impact than increasing the time of treatment.
7. Add 1ml of ice‐cold fixative drop by drop with a Pasteur pipet while mixing by vortex.
 This treatment serves to reduce the pH of the cells gradually to precondition
them for the following fixation steps. It also lyses remaining red blood cells
and begins the process of clearing resulting cellular debris.
8. Remove all but 0.5 ml of the supernatant and resuspend pellet in remaining
supernatant by drawing it gently up and down with a Pasteur pipet. Add 5 ml ice‐cold
fixative drop by drop while mixing by vortex. Leave on ice for 20 min. Centrifuge as in
step 5.
8
Collect sample and initiate cultures
syringe with 25 U preservaƟve‐free sodium heparin per milliliter of blood.
should never be used.
old) into a sterile 15‐ml centrifuge tube containing 5 ml PB‐MAX™ culture media.
3. Incubate 2 to 4 days with tubes Ɵlted at 45◦ in order to promote air exchange.
accommodate laboratory scheduling concerns.
Harvest culture
min in a humidified 37◦C, 5% CO2 incubator.
described in step 3.
min at 37◦C.
Centrifuge as in step 5.

AL Aqsa university
 The pellet after step 7 will be brown and clumpy because of erythrocyte debris.
Resuspend gently but thoroughly to avoid clumped lymphocytes which may
complicate slide‐making.
 Do not draw too much volume into the pipet while resuspending because the
 Do not press the pipet tip against the bottom of the tube when drawing and
delivering the suspension, as this will lyse cells. The pellet after step 8 will be
more homogeneous, and will usually have a light‐brown to white color. It may
be ≤0.1 ml in volume.
9. Aspirate supernatant, resuspend pellet and repeat step 8 (without incubaƟon) unƟl
10. Remove supernatant and resuspend pellet in a volume of fixative sufficient to produce
a light milky suspension (about 0.5ml). Allow to stand 30 min at room temperature or
store overnight at 4◦C.
 Longer fixation will often improve chromosome spreading in difficult harvests.
Keeping the suspension overnight at 4◦C can improve the quality of the
preparation or can be done for scheduling reasons. Suspensions should be kept
in polypropylene tubes containing plenty of fixaƟve (e.g., 5 ml). Polystyrene
tubes will react with fixative and should not be used.
CHROMOSOME SLIDE PREPARATION
Slide‐making is the least standardized and understood of cytogenetic protocols, about which
technologists have widely variable and sometimes contradictory ideas. In the end what really
matters is that slide preparations are consistent and appropriate for the desired analysis. The
protocol presented here is not the only approach to chromosome slide preparation but it
works under varied physical conditions (slide‐making is very climate‐dependent) and for a
wide range of cell cultures. It can be used for peripheral blood, bone marrow, ascites and
pleural effusions, amniotic fluid and tissue flask harvests, somatic cell or radiation hybrids,
lymphoblastoid cell lines, and nonhuman and hybridoma cultures—in short, any culture
harvest that results in a fixed suspension of mitotic cells. Harvested peripheral blood cultures
suspended in methanol/acetic acid fixative are applied to wet microscope slides, flooded with
fixative, and air‐dried. The drying process is adjusted according to ambient temperature and
humidity to optimize spreading and morphology of chromosomes for subsequent banding and
analysis. The protocol described here produces preparations that are particularly suitable for
analysis by G‐banding or in situ hybridization, although many other staining techniques or
procedures may be used.
Materials
 Fixed cultures prepared as previously described
 FixaƟve: 3:1 (v/v) methanol/aceƟc acid (use 100% methanol and glacial aceƟc acid)
 Microscope slides (one end frosted) stored in 100% methanol (absolute) in Coplin jars
 Lint‐free tissue (e.g., Kimwipe or gauze pad)
 Standard phase‐contrast microscope
9
cells will stick permanently to glass.
the pellet is clear.

AL Aqsa university
1. Remove slide from methanol and polish with lint‐free tissue, such as a folded Kimwipe
or gauze pad. Dip slide once in methanol and then several times in deionized water
until the methanol is gone and a thin, uniform film of water covers the slide.
 Good slides have few pits and imperfections and will hold a thin film of water
across the entire slide, which reduces the surface tension prior to addition of
the cell suspension. Cleaning each slide is essential, as few precleaned slides
are truly clean enough for chromosome preparations.
2. Holding the frosted end between the thumb and finger, position the slide with the
one long edge parallel to the bench top, and blot the lower long edge on a paper towel
to draw off excess water. Keeping the lower long edge in contact with the paper towel,
lower the opposite edge unƟl the slide forms a 30◦ angle with the bench top, with the
film of water facing up (Fig. 1).
3. From a Pasteur pipet held in a horizontal posiƟon 1 to 2 inches above the slide, place
3 drops of cell suspension, evenly spaced, onto the slide, moving successively toward
the frosted end. Drops should strike the tilted slide one‐third of its width from the
elevated long edge (Fig. 1.a). The drops should burst on the water film and spread out
evenly as they strike.
 Positioning and spacing of drops is critical. The goal is even dispersal of cells
across the entire surface of the slide. This contributes to consistent and
uniform slide‐drying, which will optimize chromosome spreading. If discrete
areas of cells are observed at the drop sites, surrounded by areas with few
cells, the slide should be held at a lower angle (i.e., <30◦) when the drops are
applied. Applying drops in sequence toward the frosted end allows excess
water and fixative to flood onto the frosted end without pooling. Placing drops
closer to the elevated edge of the angled slide helps to disperse the cells in
suspension uniformly across the width of the slide. If amount of cell pellet is
limited, slides should be made using one or two drops.
 Some in situ hybridization protocols call for an array of different hybridization
probes on the same slide. An array of metaphases can easily be prepared by
adding a small amount (e.g., 10 μl) to each area of the slide that is to be
hybridized. This is best done in succession before proceeding to step 4 below.
4. Position the slide with one long edge parallel to the bench top and blot the lower long
edge to draw off excess fixative. Tilt the slide at a 30◦ angle as in step 2 and flood with
fresh 3:1 methanol/aceƟc acid fixaƟve, dropwise, using a Pasteur pipet. Start at the
elevated corner of the nonfrosted end and move toward the frosted end, placing
drops on the upper edge of the slide (Fig. 1.b).
 This will uniformly displace any remaining water and allow the slide to dry
evenly. It is critical to flood the slide toward the frosted end so that excess
fixative does not pool on the slide surface. As fixative is placed across the top
of the slide, it will displace a front of water and leave a uniform surface of
fixative. This process also serves to remove debris that might otherwise collect
over cells and thus disturb any future procedures that are to be performed on
the preparations, such as banding or in situ hybridization.
10
Procedures

AL Aqsa university
5. Position the slide again so that one long edge is parallel to the bench top, blot the
lower long edge, and wipe off the back of the slide. Place so that the nonfrosted end
is elevated 30◦ with respect to the frosted end, with the cell side facing up. Air dry.
 Correct drying, as indicated by chromosome spreading and contrast under
phase microscopy, must be monitored on a slide‐by‐slide basis. It is a function
of surface tension, which in turn is related to relative humidity and ambient
temperature. Simply placing a slide on an angle to dry as suggested above
may work well if ambient conditions are conducive (20◦ to 22◦C with a relaƟve
humidity of ∼50%). More oŌen, addiƟonal manipulaƟons to control rate and
duration of drying will be necessary to optimize quality of preparations.
6. Examine slides for good chromosome spreading and morphology by phase‐contrast
Storage of a slide preparation will depend on its intended use. Slides to be used
for fluorescence in situ hybridization (FISH) should be used within several
weeks without baking or artificial aging. Because the chromosome
preparations on slides are biodegradable, they should be stored in a clean, dry
container in the dark at room temperature (short‐term storage), or frozen at
−70◦C (long‐term storage).
AGING SLIDES WITH HEAT
Time, heat, and drying cause an alteration in chromosomal material (probably protein
denaturation) that affects banding. Underaged slides result in fuzzy banding. Overaged slides
do not band. Techniques for manipulating the aging of chromosome slides vary widely.
Optimal aging conditions may vary with cell type or tissue source.
Incubate air‐dried slide of metaphase chromosomes 2 days at 55°C or 20 min at 90° to 95°C
(using dry oven or slide warmer). If it is necessary to reduce time of incubation, increase
temperature. If incubaƟon Ɵme will be longer than 2 days (e.g., over a weekend), decrease
temperature. Optimal times and temperatures must be established empirically in each
laboratory.
Aging of Slides with Hydrogen Peroxide
When immediate banding of slides is required, the effects of aging can be obtained with
hydrogen peroxide treatment.
Materials
 Air‐dried slides of metaphase chromosomes (prepare freshly)
 15% (v/v) H2O2 (dilute 30% H2O2 1:1 with water immediately before use)
 50°C hot plate or slide warmer
CAUTION: H2O2 is hazardous
1. Flood freshly prepared slide with 15% H2O2. Leave peroxide in contact with slide for
11
microscopy.
7 min.
 Slide can be aged immediately after preparation.
2. Place slide in Coplin jar filled with water and rinse under running tap water 2 min.

AL Aqsa university
3. Place slide on 50°C hot plate or slide warmer 1 hr to overnight. Cool to room
Figure 1 Chromosome slide preparation: (A) After blotting the long edge of the slide to obtain
a thin uniform layer of water, the slide is tilted to ∼30◦ and 3 separate drops of fixed cell
suspension are applied starting away from and proceeding toward the frosted end. This
sequence allows excess fixative and water to flood onto the frosted end without pooling on the
slide. Application of the drops 1/3 of the distance from the top of the slide (indicated by Xs)
counteracts the downhill dispersal tendency of cells on the slide and promotes even dispersal
across the slide width. (B) After application of the cell suspension, the slide is flooded with
fixative across the top edge, again proceeding toward the frosted end. This displaces a front
of remaining water across the slide and onto the frosted end. It is important to avoid pooling
of excess fluid on the surface of the slide, and to obtain a thin, even film of fixative to ensure
uniform drying.
12
temperature and proceed with banding.

AL Aqsa university
13

AL Aqsa university
CHROMOSOME BANDING TECHNIQUES
Chromosome banding techniques produce a series of consistent landmarks along the length
of metaphase chromosomes that allow for both recognition of individual chromosomes within
a genome and identification of specific segments of individual chromosomes. These
landmarks facilitate assessment of chromosome normalcy, identification of sites of
chromosome breaks and alterations, and location of specific genes. The basic banding
techniques (Q‐banding, G‐banding, and R‐banding) produce virtually identical patterns of
bands along the length of human chromosomes, although the bands and polymorphic regions
highlighted may differ with each technique. Utility of these banding patterns stems from the
fact that the pattern of bands obtained will be identical from cell to cell, from tissue to tissue,
and, except within polymorphic regions, from individual to individual within a species. The
fidelity of chromosome‐banding patterns most likely stems from the underlying organization
of DNA sequences and associated proteins in chromosomes. This organization is faithfully
preserved at each cell division, and no mechanisms are currently recognized that disrupt these
patterns. Even in rearrangements of a chromosome, such as those that occur in
translocations, the fidelity of the banding pattern in the rearranged segment is maintained,
allowing identification of the translocated segment. These basic banding techniques highlight
reproducible landmarks along the length of the chromosome and specialized staining
techniques can be used to highlight particular regions of chromosomes, such as
heterochromatic and repeated‐sequence segments. The technique presented can be applied
to both metaphase and prometaphase (extended, high‐resolution) chromosome preparations
from any tissue source. Choice of staining technique will vary with the application and
available equipment (bright‐field versus fluorescence microscopy).
GTG Technique for G‐Banding
G‐banding is the most frequently used technique in clinical cytogenetics laboratories because
of the permanence of the bands produced and the ease with which they can be photographed.
There are numerous G‐banding techniques, but all combine a pretreatment step that probably
alters chromosomal proteins, followed by a staining step with a Romanowsky‐type dye
mixture (a thiazine eosin‐azure dye mixture, usually Giemsa stain, hence G‐banding). The basic
protocol described below, known as GTG‐banding (G‐banding by trypsin with Giemsa), uses
the proteolytic enzyme trypsin for pretreatment followed by staining with Giemsa. G‐banding
patterns can be viewed and photographed with a bright‐field microscope.
Materials
14
 HBSS (Hanks balanced salt solution)
o 0.40 g KCl (5.4 mM)
o 0.09 g Na2HPO4⋅7H2O (0.3 mM)
o 0.06 g KH2PO4 (0.4 mM)
o 0.35 g NaHCO3 (4.2 mM)
o 0.14 g CaCl2 (1.3 mM)
o 0.10 g MgCl2⋅6H2O (0.5 mM)
o 0.10 g MgSO4⋅7H2O (0.6 mM)
o 8.0 g NaCl (137 mM)
o 1.0 g D‐glucose (5.6 mM)

AL Aqsa university
o 0.01 g phenol red (0.01%; opƟonal)
o Add H2O to l liter and adjust to pH 7.4
o Filter sterilize and store at 4°C
HBSS can also be purchased from a number of commercial suppliers.
HBSS may be made or purchased without CaCl2 and MgCl2. These components
are optional and usually have no effect on an experiment; in a few cases, however,
their presence may be detrimental. Consult individual protocols to see if the
presence or absence of these components is recommended.
o Stock solution: 0.5% Trypsin‐EDTA (10X), no Phenol Red (GIBCO). Divide into
o Working solution: Combine 2.5 ml 10X stock soluƟon with 47.5 ml disodium
o Add 1g Giemsa powder to 66 ml methanol and 66 ml glycerin and sƟr for 2
o The stain should be prepared at least 2 weeks before used and stored in a
 Aged slides of metaphase chromosomes (see support protocols)
 Xylene (CAUTION: Xylene is hazardous)
 NOTE: Because the stain is difficult to remove from skin, it is advisable to wear gloves
15
 Trypsin solution (see recipe)
2‐ml aliquots and store frozen at −20°C.
phosphate buffer (see recipe) in a Coplin jar. Prepare fresh.
 70% and 90% (v/v) ethanol
 Giemsa Stain:
days at room temperature.
darkened container in a refrigerator
 2% Giemsa (v/v) staining soluƟon
o 1 ml Giemsa stain
o 49 ml H2O
o Prepare fresh daily in Coplin jar
 Disodium phosphate buffer, pH 7.0
o 0.2 g KCl (2 mM final)
o 8.0 g NaCl (0.14 M final)
o 0.2 g monobasic potassium phosphate (KH2PO4; 1.4 mM final)
o 1.16 g dibasic sodium phosphate (Na2HPO4; 8 mM final)
o 1 liter H2O
o Adjust pH to 7.0 with monobasic or dibasic phosphate solution if needed
o Store ≤6 months at room temperature
when working with Giemsa.
Procedures
1. Prepare a series of Coplin jars containing the following at room temperature:
 jar 1—HBSS
 jar 2—trypsin solution
 jar 3—HBSS
 jar 4—70% ethanol
 jar 5—90% ethanol

AL Aqsa university
 Insufficient trypsinization results in evenly stained slides with no bands. Over‐trypsinization
results in pale “puffy” chromosomes with staining around the
outside of the chromosome. Optimal trypsinization times will vary with the
source of cells. Three to five identical slides should be available so that it is
possible to vary trypsinization time as needed to obtain optimal banding.
 Recommended initial trypsinization time is 60 sec for good‐quality, well‐aged
slides from lymphocytes or amniocytes, 90 sec for slides of other cells from
long‐term tissue culture (chorionic villus samples, solid tumors, skin
fibroblasts, etc.), and 30 sec for slides from bone marrow.
 It is possible to pause at this point for several hours before proceeding to step
 It is not necessary to mount slide with a coverslip; oil can be placed directly on
16
 jar 6—2% Giemsa staining soluƟon
 jar 7—H2O.
2. Place aged slide of metaphase chromosomes briefly (∼10 sec) in jar 1.
3. Transfer slide to jar 2. Incubate for opƟmal trypsinizaƟon Ɵme.
4. Place slide in jars 3 to 5, dipping slide 3 to 4 Ɵmes in each jar. Air dry.
5.
5. Place slide in jar 6 for 4 min.
 Optimal staining time may need to be determined empirically.
6. Place slide in jar 7 for ∼30 sec. Air dry.
 Once stained, slide can be stored for months or years.
7. View and photograph with bright‐field microscope (see Fig. 2).
the slide. For storage of slides, rinse off immersion oil using fresh xylene.
 Use a green interference filter for black and white photography.
Figure 2 G‐banded metaphase spread from a phenotypically normal 46,XY male. X and Y
chromosomes indicated by arrows. Chromosomes are stained with Giemsa.

AL Aqsa university
 CriƟcal region 1 (red): The 21q specific DNA probe is direct‐labeled with
 CriƟcal region 2 (green): The 13q14 specific DNA probe is direct‐labeled with
 CriƟcal region 3 (blue): The 18 SE DNA probe is direct‐labeled with
 CriƟcal region 4 (green): The X SE DNA probe is direct‐labeled with
 CriƟcal region 5 (red): The Y SE DNA probe is direct‐labeled with
Intended use:
The chromosome 21 specific region probe is opƟmized to detect copy numbers of
chromosome 21 at 21q22.1 on uncultured amnioƟc cells.
The chromosome 13 specific region probes is opƟmized to detect copy numbers of
Chromosome 13 at 13q14.2 on uncultured amnioƟc cells.
The chromosome 18 specific Satellite probe (D18Z1) is opƟmized to detect copy numbers of
Chromosome 18 at 18p11‐18q11 on uncultured amnioƟc cells.
The chromosome X specific Satellite probe (DXZ1) is opƟmized to detect copy numbers of
Chromosome X at Xp11‐Xq11 on uncultured amnioƟc cells.
The chromosome Y specific Satellite probe (DYZ3) is opƟmized to detect copy numbers of
Chromosome Y at Yp11‐Yq11 on uncultured amnioƟc cells.
The class will be divided into three groups. Each group will prepare 2 slides from uncultured
blood.
 One interphase slide‐preparation (labeled I‐1) and one metaphase slide preparaƟon
 One interphase slide‐preparation (labeled I‐2) and one metaphase slide preparaƟon
1. Add 10 ml of 75 mM KCl at room temperature to 0.25‐1 ml of blood or bone
17
3. Fluorescent In‐Situ Hybridization (FISH)
Procedure for FISH analysis of chromosomes
13/21/X/Y/18
Reagents:
Poseidon™ Repeat Free™ Chromosome 13/21, X/Y/18 specific DNA Probes
Vial 1
PlaƟnumBright550.
PlaƟnumBright495.
Vial 2
PlaƟnumBright415.
PlaƟnumBright495.
PlaƟnumBright550.
(labeled M‐1) will be selected for chromosomes 13/21 probe mix.
(labeled M‐2) will be selected for chromosomes X/Y/18 probe mix.
Specimen:
 Uncultured blood and bone marrow preparations for interphase FISH:
Sample preparation:
marrow and gently mix. Let stand 15 min at room temperature.

AL Aqsa university
2. Add 10 to 12 drops of fixative with a Pasteur pipet and mix well. Centrifuge
3. Remove all but 0.5 ml of the supernatant and resuspend pellet in remaining
supernatant by drawing it gently up and down with a Pasteur pipet. Add 1 ml
fixative and immediately mix gently. Adjust volume to 5 ml with fixaƟve and
mix thoroughly. Centrifuge as previously.
4. The pellet will be brown and clumpy because of erythrocyte debris.
Resuspend gently but thoroughly to avoid clumped lymphocytes which may
complicate slide‐making.
5. Aspirate supernatant, resuspend pellet in 5 ml fixaƟve, and centrifuge as
6. Remove supernatant and resuspend pellet in a volume of fixative sufficient to
produce a light milky suspension. Allow to stand 30 min at room temperature
or store overnight at 4◦C.
1. Clean microscope slides by dipping in methanol and drying by wiping with lint‐free
 Heparinized whole blood cultured in RPMI 1640 medium supplemented with fetal
bovine serum, penicillin, streptomycin and L‐glutamine and 2% PHA. The blood
cultures are harvested and fixed by methanol/acetic acid and the slides prepared
according to standard techniques (refer to materials from karyotyping training
session).
1. Fill a verƟcal Coplin jar with 50 ml pretreatment buffer (see preparations).
2. Incubate the jar at 37°C for enough time to worm the pretreatment buffer, before
During the incubaƟon period prepare 3 horizontal Coplin jars containing 100 ml of the
following ethanol concentraƟons at room temperature: (70%, 85% and 100%).
a. Dip the slides in 70% ethanol for 1 min
b. Dip the slides in 85% ethanol for 1 min
c. Dip the slides in 100% ethanol for 1 min
d. Air‐dry the slides.
1. Apply 10μl of 13/21 probe preparaƟon or (ready to use) onto each of slides # I‐2 and
18
for 8 min at 180×g, room temperature.
previously.
Slide making:
cloth to ensure the slides are grease‐free.
2. Add a drop of the fixed cells suspension onto a microscope slide.
3. Allow to air dry.
4. Check the cell density under phase contrast microscope.
Slides pretreatment:
proceeding with the procedure
3. Dip the prepared slides into the pre‐wormed buffer
4. Incubate at 37°C for 15 min.
Dehydration:
Co‐Denaturation/Hybridization:
M‐1. Avoid generaƟon of air bubbles.

AL Aqsa university
2. Apply 10μl of X/Y+18 probe preparaƟon or (ready to use) onto each of slides # I‐4
3. Gently cover each slide with (22 X 22 mm) cover slip, and make sure that the applied
4. Seal the cover slips to the slides with Fixogum.
5. Incubate the slides at 75°C for 5‐10 min on a hotplate with precise temperature
6. Incubate the slides in a sealed humidified box or slide thermo‐mixer at 37°C for
a. Fill the first with 100 ml of Post‐wash buffer I, and pre incubate in a water
bath adjusted at 72°C for enough Ɵme to raise the buffer temperature to the
desired temperature (72°C).
b. Fill the second jar with 100 ml of Post‐wash buffer II and keep at room
2. Remove the Fixogum seal.
3. If necessary incubate the slides in Post‐wash buffer II for 2 min at room temperature
4. Incubate the slides in a Coplin jar containing pre‐wormed (72°C) Post‐wash Buffer I
Interpretation:
Recommendat ions for fluore scence micro scopy:
For optimal visualization use a well maintained and regularly calibrated microscope
equipped with a 100 W mercury lamp and a 63x or 100x fluorescent objecƟve. Triple band‐pass
(DAPI/FITC/Texas Red or DAPI/FITC/Rhodamine) are used to view multiple colours, single
band‐pass filters are used for individual colour visualization.
Suitable excitation and emission range for REPEAT‐FREE POSEIDON fluorophores:
Fluorophore Excitation Emission
PlaƟnumBright415 415 ±20 nm 475 ±30 nm
PlaƟnumBright 495 495 ±20 nm 525 ±30 nm
PlaƟnumBright 550 546 ±12 nm 580 ±30 nm
The Chromosome 13/21 specific probe is designed as a dual‐color assay to detect gains of
chromosome 21 and 13. Trisomy 21 will be detected by three red signal at the 21q22 region
19
and M‐2. Avoid generaƟon of air bubbles.
probe preparation is uniformly spread beneath the cover slips.
control (Thermal cycler or a slide thermo‐mixer may be used).
overnight (12‐16 Hrs).
Post‐Hybridization stringency washing:
1. Prepare two Coplin jars:
temperature.
to slide off the cover slips.
for 2 min.
5. Wash slides in Post‐ wash Buffer II for 1 min at room temperature.
6. Dehydrate the slides for 1 min in each of: 70 %, 85 % and 100 % ethanol.
7. Air‐dry at room temperature.
Counter‐staining:
 Apply 15 μl of DAPI/anƟfade and apply a glass cover slip
 Visualize by a fluorescent microscope.
filters

AL Aqsa university
and two green signals for chromosome 13 (3R2G). Trisomy 13 will be detected by 3 green
signals at the 13q14 region and two red signals for chromosome 21 (2R3G).
Two single color red (R) and green (G) signals will idenƟfy the normal chromosomes 13 and 21
(2R2G).
The Chromosome X/Y/18 specific probe is designed as a triplecolour assay to detect gains or
losses of chromosome X, Y and or 18. Turner syndrome will be detected by one green signal
only at Xcen. Meta‐Females (or Triple‐X females) will be detected by three or more green
signals at Xcen. Klinefelter will be detected by 2 or more green and 1 red signal. XYY males will
be detected by one green and two red signals. Two single green (G) signals will identify the
normal X chromosome in females, one green and one red signal will identify the normal X and
Y chromosomes in male. Trisomy 18 will be detected by three blue signals at 18 cen.
Two single blue signals will idenƟfy the normal chromosome 18.
Interpretation Table:
Female Male Turner XO Meta‐female Klinefelter XYY
1G2R
1G2R2B
One of the most common chromosomal abnormalities in live born children and causes
Down syndrome, a particular combination of phenotypic features that includes mental
retardation and characteristic facies. Molecular analysis has revealed that the 21q22.1‐
q22.3 region appears to contain the gene(s) responsible for the congenital heart disease
observed in Down syndrome.
Also called Patau syndrome, is a chromosomal condition that is associated with severe
mental retardation and certain physical abnormalities. The critical region has been
reported to include 13q14‐13q32 with variable expression, gene interacƟons, or
interchromosomal effects.
Causing Edwards syndrome is the second most common autosomal trisomy after
trisomy 21. The disorder/condiƟon is characterized by severe psychomotor and growth
retardation, microcephaly, microphthalmia, malformed ears, micrognathia or
20
Normal Signal
Pattern Trisomy 21 Trisomy 13 Trisomy 18
Expected Signals
Using 13/21 2R2G 3R2G 2R3G
Expected Signals
2R2G2B
Using 13/21+18
3R2G2B 2R3G2B 2R2G3B
Female Male Female Male
Expected Signals
Using X/Y + 18 2G2B 1R1G2B 2G3B 1R1G3B
Expected Signals
Using X/Y 2G 1R1G 1G 3‐5G
2G1R
3‐4G1R
1R1G/1R2G in
mosaics
Expected Signals
Using X/Y + 18 2G2B 1R1G2B 1G2B 3‐5G2B
2G1R2B
3‐4G1R2B
1R1G2B/1R2G2B in
mosaics
Trisomy 21:
Trisomy 13:
Trisomy 18:

AL Aqsa university
retrognathia, microstomia, distinctively clenched fingers, and other congenital
malformations.
Chromosomal abnormalities involving the X and Y chromosome (sex chromosomes) are
slightly less common than autosomal abnormalities and are usually much less severe in
their effects. The high frequency of people with sex chromosome aberrations is partly due
to the fact that they are rarely lethal conditions.
Males inherit one or more extra X chromosomes; their genotype is XXY or more rarely
XXXY, XXXXY, or XY/XXY mosaic.
Probe mix Hybridization Buffer Probe Total
13/21 ready to use
X/Y + 18 8 μl 2 μl 10 μl
ON, PN, and MD REPEAT‐FREE POSEIDON probes are supplied Ready to Use (RtU). SE,
ST, and WC REPEAT‐FREE POSEIDON probes are provided at 5 x concentrated and
must be diluted
21
Turner syndrome:
Occurs when females inherit only one X chromosome; their genotype is X0.
Metafemales or triple‐X females:
Inherit three X chromosomes; their genotype is XXX or more rarely XXXX or XXXXX.
Klinefelter syndrome:
XYY syndrome:
Males inherit an extra Y chromosome; their genotype is XYY.
Buffers and preparations:
1. Fixative:
Component Amount Final conc.
Methanol (Absolute) 30 ml
Glacial acetic acid 10 ml
Total 40 ml
2. SSC (sodium chloride/sodium citrate), 20×
NaCl 175 g 3 M
trisodium citrate dihydrate
88 g 0.3 M
Na3C6H5O7⋅2H2O
H2O To 800 ml
Adjust pH to 7.0 with 1 M HCl
Add H2O to 1 liter
3. Pretreatment buffer: (2 x SSC / 0.5% igepal, pH 7.0)
20 X SSC buffer pH 7.0 5 ml 2 X
Igepal or Triton‐X‐100 250 μl 0.5 %
Distilled Water 45 ml
Total 50 l
4. Probe preparation: (in case not ready to use)

AL Aqsa university
To combine several 5 x conc. probes, replace FISH HybridizaƟon Buffer (FHB or WHB)
with 2 μl for each added probe.
22
51 Post‐Wash buffer I: (0.4 x SSC / 0.3% igepal)
20 X SSC buffer pH 7.0 1 ml 0.4 X
Total 50 ml
52 Post‐Wash buffer II: (2 x SSC / 0.1% igepal)
20 X SSC buffer pH 7.0 5 ml 2 X
Total 50 ml

AL Aqsa university
Leukocytes genomic DNA will be extracted from pereferal blood using the (Wizard® Genomic
DNA Purifi cation Kit) according to the manufacturer instructions attached to the end of this
manual.
23
4. Genomic DNA Extraction

AL Aqsa university
5. Detection of Common Familial Mediterranean Fever (FMF)
Familial Mediterranean fever (FMF) is a genetic disease of the inflammatory pathway. FMF is
the most frequent of the hereditary fevers and mainly affects populations of the
Mediterranean basin, such as Arabs, Armenians, Sephardic Jews and Turks. The disease
typically presents as recurrent episodes of fever accompanied by topical signs of
inflammation, mainly involving the peritoneal, pleural and articular cavities. In most patients
the first symptoms may appear by the age of 10 and in 90% of the paƟents by the age of 20.
The symptoms and severity vary among affected individuals, sometimes even among
members of the same family. Amyloidosis, which can lead to renal failure, is the most severe
complicaƟon. FMF type 2 is characterized by amyloidosis as the first clinical manifestaƟon of
FMF in an otherwise asymptomatic individual.
The gene responsible for FMF (designated MEFV) encodes a protein named marenostrin or
pyrin. The spectrum of MEFV mutations responsible for FMF has been regularly widening, and
more than fifteen mutations have now been discovered. There are five frequent mutations:
four regrouped in exon 10 (V726A, M694V, M694I, M680I) and one in exon 2 (E148Q). They
cover more than 85% of the mutaƟons present in the above‐mentioned populations.
These mutaƟons and parƟcularly M694V were shown to be related to the severity of the
disease. The relationship with amyloidosis has also been demonstrated. Moreover, it seems
that other genetic modifiers and environmental factors may play a role in the manner of FMF
expression and its complications in the various populations.
The diagnosis of FMF is clinical and is suspected in individuals with recurrent episodes of fever
associated with abdominal pain (peritonitis) and/or pleuritic pain and/or arthritis (ankle/knee)
usually lasting two to three days. A high erythrocyte sedimentation rate, leukocytosis, and a
high serum concentration of fibrinogen are characteristic.
FMF is inherited in an autosomal recessive manner. In general, both parents of a proband are
considered to be obligate carriers. However, in populations with a high carrier rate and/or a
high rate of consanguineous marriages, it is possible that affected children may be born to an
affected individual and a carrier, or even to two affected individuals. Thus, it is appropriate to
consider molecular genetic testing of the parents of the proband to establish their genetic
status. If both parents are heterozygotes, the risk to sibs of being affected is 25%. Prenatal
testing is possible if the MEFV mutations in an affected family member are known.
24
Mutations By PCR/RFLP
Mutation M680I
2040 G>C
2040 G>A
M694V
2080A>G
M694I
2082 G>A
V726A
2177 T>C
E148Q
442 G>C

AL Aqsa university
To detect mutaƟons M694V and V726A, the primers FMF7 and FMF8 are used. The M694V
variant creates a Hph‐I restriction site in the PCR product of the mutant allele but not of the
normal allele. The FMF7 primer was designed (mismatch) to abolish another constitutive Hph‐
I site proximal to the mutation. After Hph‐I restriction the mutant allele yields one 118‐base
pair (bp) and one 36‐bp fragment; the normal allele gives a 154‐bp uncut fragment.
The V726A variant creates an Alu‐I restriction site in the PCR product of the mutant allele. The
Alu‐I restriction site yields a 122‐bp and a 32‐bp fragment for the mutant allele, whereas the
normal allele gives a 154‐bp uncut fragment.
25
Procedures:
The primers used for amplificaƟon are listed in table 1.
ID Sequence (5' to 3')
FMF7 GAATGGCTACTGGGTGGAGAT
FMF8 GGCTGTCACATTGTAAAAGGAG
FMF9 GCTACTGGGTGGTGATAATCAT
p12.2 TATCATTGTTCTGGGCTC
met1 CTGGTACTCATTTTCCTTC
EQF GCCTGAAGACTCCAGACCACCCCG
EQR CAGAGAGAAGGCCTCGGAGGGCCT
M694V and V726A
Reaction Components:
Reagent Amount Final concentration
2X Master Mix 12.5 μl 1X
FMF7 (5 μM) 1.5 μ1 0.325 μM
FMF8 (5 μM) 1.5 μ1 0.325 μM
H2O 7.5 μl
DNA 2 μl
Total 25 μl
Cycling Conditions:
One Cycle:
95°C 5 min.
35 Cycles:
95°C 45 sec.
55°C 30 sec.
72°C 1 min.
One cycle: 72°C 10 min.

AL Aqsa university
To detect the M694I variant, a mismatch is introduced into a primer (FMF9) that anneals
adjacent to the mutation locus and thus creates a BspH‐I site in the normal allele restriction.
Primers FMF9 and FMF8 are used for PCR amplificaƟon. The BspH‐I restriction site yields a
130‐bp and a 19‐bp fragment for the normal allele whereas the mutant allele gives a 149‐bp
uncut fragment.
26
M694V
Hph‐I Restriction reaction
Reagents Amount Final
Enzyme Hph‐I (5 U/l) 0.5 μl 0.12U/l
Water 7.5 l
NEBuffer 4 (10X) 2.0 μl 1X
PCR product 10 l
TOTAL 20 l
Incubate at 37°C for 1 hour
mutant allele: 118‐bp + 36‐bp
normal allele: 154‐bp
V726A
Alu‐I Restriction reaction
Enzyme Alu‐I (10 U/l) 0.5 μl 0.25U/l
Water 7.5 l
PCR product 10 l
TOTAL 20 l
M694I
FMF9 (5 μM) 1.0 μ1 0.325 μM
FMF8 (5 μM) 1.0 μ1 0.325 μM
H2O 4.5 μl
DNA 1 μl
Total 15 μl

AL Aqsa university
The M680I variant abolishes a naƟve Hinf‐I restriction site. The mutation is distinguished by
primers p12.2 and met1. The Hinf‐I restriction site yields a 124‐bp and a 60‐bp fragment for
the normal allele whereas the mutant allele gives a 184‐bp uncut fragment.
27
Cycling Conditions:
One Cycle:
95°C 5 min.
35 Cycles:
95°C 45 sec.
55°C 30 sec.
72°C 1 min.
M694I
BspH‐I Restriction reaction
Enzyme BspH‐I (10 U/l) 0.5 μl 0.25U/l
Water 7.5 l
PCR product 10 l
TOTAL 20 l
mutant allele: 149‐bp
normal allele: 130‐bp + 19‐bp
M680I
p12.2 (5 μM) 1.0 μ1 0.325 μM
met1 (5 μM) 1.0 μ1 0.325 μM
H2O 4.5 μl
DNA 1 μl
Total 15 μl
Cycling Conditions:
One Cycle:
95°C 5 min.
35 Cycles:
95°C 1 min.
55°C 1.5 min.
72°C 1 min.

AL Aqsa university
The E148Q mutaƟon is detected by amplificaƟon of the region using the EQF and EQR primers.
The mutation creates a new MvaI (BstNI) restriction site in the amplified fragment. The
mutant allele will yield 92 bp and 65 bp restricƟon fragments while the uncut normal allele
will yield a 157 bp fragment.
28
M680I
Hinf‐I Restriction reaction
Enzyme Hinf‐I (10 U/l) 0.5 μl 0.25U/l
Water 7.5 l
PCR product 10 l
TOTAL 20 l
mutant allele: 184‐bp
normal allele: 124‐bp + 60‐bp
E148Q
Reagent Amount
Final
concentration
EQF (5 μM) 1.0 μ1 0.325 μM
EQR (5 μM) 1.0 μ1 0.325 μM
H2O 4.5 μl
DNA 1 μl
Total 15 μl
Cycling Conditions:
One Cycle:
95°C 5 min.
35 Cycles:
95°C 30 sec.
60°C 30 sec.
72°C 30 sec.

AL Aqsa university
The products are preferentially separated on 8% nondenaturaƟng polyacrylamide gel, or 3%
Agarose gels stained by ethidium bromide, and visualized under an ultraviolet lamp
1. Brik R., Shinawi M., Kepten I., Berant M., And Gershoni‐Baruch R. Familial
Mediterranean Fever: Clinical And Genetic Characterization In A Mixed Pediatric
Population Of Jewish And Arab Patients. (1999) Pediatrics, 103(5).
2. Iffet Sahin, F., Yilmaz, Z., Erkan Yurtcu, E., And Esra Baskin, E. Comparison Of The
Results Of PCR‐RFLP And Reverse Hybridization Methods Used In Molecular Diagnosis
Of FMF.(2008) Genetic Testing, 12(1).
29
E148Q
MvaI (BstNI) Restriction reaction
Enzyme MvaI (BstNI) (10 U/l)
0.5 μl 0.25U/l
Water 7.5 l
Buffer R (10X) 2.0 μl 1X
PCR product 10 l
TOTAL 20 l
References;

AL Aqsa university
Agarose gel electrophoresis is a simple and highly effective method for separating,
idenƟfying, and purifying 0.5‐ to 25‐kb DNA fragments.
The protocol can be divided into three stages: (1) a gel is prepared with an agarose
concentraƟon appropriate for the size of DNA fragments to be separated; (2) the DNA
samples are loaded into the sample wells and the gel is run at a voltage and for a time
period that will achieve opƟmal separaƟon; and (3) the gel is stained or, if ethidium bromide
has been incorporated into the gel and electrophoresis buffer, visualized directly upon
illumination with UV light.
RESOLUTION OF DNA FRAGMENTS ON STANDARD
AGAROSE GELS
Materials
108 g Tris base (890 mM)
55 g boric acid (890 mM)
40 ml 0.5 M EDTA, pH 8.0 (Dissolve 186.1 g Na2EDTA⋅2H2O in
700 ml H2O, Adjust pH to 8.0 with 10 M NaOH (∼50 ml), Add
H2O to 1 liter)
20% Ficoll 400
0.1 M disodium EDTA, pH 8 (APPENDIX 2)
1.0% sodium dodecyl sulfate
0.25% bromphenol blue
0.25% xylene cyanol (opƟonal; runs ¡«50% as fast as bromphenol blue
and can interfere with visualization of bands of moderate molecular
weight, but can be helpful for monitoring very long runs)
30
6. Agarose Gel Electrophoresis:
 Electrophoresis buffer (TAE or TBE)
TAE (Tris/acetate/EDTA) electrophoresis buffer
50× stock soluƟon:
242 g Tris base
57.1 ml glacial aceƟc acid
37.2 g Na2EDTA⋅2H2O
H2O to 1 liter
TBE (Tris/borate/EDTA) electrophoresis buffer
10× stock soluƟon, 1 liter:
 Ethidium bromide solution (10mg/ml)
Working soluƟon, 0.5 g/ml:
Dilute stock 5l for 100 ml gels or stain solution
Protect from light.
 Electrophoresis‐grade agarose
 10× loading buffer

AL Aqsa university
1. Prepare an adequate volume of electrophoresis buffer (TAE or TBE) to fill the
To facilitate visualization of DNA fragments during the run, ethidium bromide
solution can be added to the electrophoresis buffer to a final concentration of
0.5 mg/ml.
If buffer is prepared for the electrophoresis tank and the gel separately, be sure
to bring both to an identical concentration of ethidium bromide.
CAUTION: Ethidium bromide is a mutagen and potential carcinogen. Gloves
should be worn and care should be taken when handling ethidium bromide
solutions.
31
 DNA molecular weight markers
To prepare loading mixutres:
Distilled water ‐ 4 μl
6X Blue Loading Dye ‐ 1 μl
DNA Ladder ‐ 1 μl
Total volume ‐ 6 μl
Mix gently
Load onto the agarose gel
100 bp DNA Ladder visualized by
ethidium bromide staining on a 1.3%
TAE agarose gel. Mass values are for
0.5 μg/lane.
 55°C water bath
 Horizontal gel electrophoresis apparatus
 Gel casting platform
 Gel combs
 DC power supply
Preparing the gel
electrophoresis tank and prepare the gel.

AL Aqsa university
2. Add the desired amount of electrophoresis‐grade agarose to a volume of
electrophoresis buffer sufficient for construcƟng the gel (see Table 1). Melt the
agarose in a microwave oven or autoclave and swirl to ensure even mixing.
Gels typically contain 0.8 to 1.5% agarose.
3. Seal the gel casting platform if it is open at the ends. Pour in the melted agarose
and insert the gel comb, making sure that no bubbles are trapped underneath
the combs and all bubbles on the surface of the agarose are removed before
the gel sets.
32
Melted agarose should be cooled to 55°C in a water bath before pouring onto
the gel platform. This prevents warping of the gel apparatus.
Gels are typically poured between 0.5 and 1 cm thick. Remember to keep in
mind that the volume of the sample/wells will be determined by both the
thickness of the gel and the size of the gel comb
Table 1. Appropriate Agarose
Concentrations for Separating DNA
Fragmentsof Various Sizes
Agarose (%)
Effective range of
resolution of linear
DNA fragments (kb)
0.5 30 to 1
0.7 12 to 0.8
1.0 10 to 0.5
1.2 7 to 0.4
1.5 3 to 0.2
Most gel platforms are sealed by taping the open ends with adhesive tape. As
an added measure to prevent leakage, hot agarose can be applied with a
Pasteur pipet to the joints
and edges of the gel platform and allowed to harden.

AL Aqsa university
4. After the gel has hardened, remove the tape from the open ends of the gel
platform and withdraw the gel comb, taking care not to tear the sample wells.
Most gel plaƞorms are designed so that 0.5 to 1 mm of agarose remains
between the bottom of the comb and the base of the gel platform. This is
usually sufficient to ensure that the sample wells are completely sealed
and to prevent tearing of the agarose upon removal of the comb. Low
percentage gels and gels made from low gelling/melting temperature
agarose should be cooled at 4°C to gain extra rigidity and prevent
tearing.
5. Place the gel casting platform containing the set gel in the electrophoresis
tank. Add sufficient electrophoresis buffer to cover the gel to a depth of about
1 mm (or just unƟl the tops of the wells are submerged). Make sure no air
pockets are trapped within the wells.
6. DNA samples should be prepared in a volume that will not overflow the gel
wells by addiƟon of the appropriate amount of 6× loading buffer. Samples are
typically loaded into the wells with a micropipet. Care should be taken to
prevent mixing of the samples between wells.
7. Be sure that the leads are attached so that the DNA will migrate into the gel
toward the anode or positive lead. Set the voltage to the desired level, typically
1 to 10 V/cm of gel, to begin electrophoresis. The progress of the separation
can be monitored by the migration of the dyes in the loading buffer.
CAUTION: To prevent electrical shocks, the gel apparatus should always
be covered and kept away from heavily used work spaces.
33
Loading and running the gel
Be sure to include appropriate DNA molecular weight markers.

AL Aqsa university
8. Turn off the power supply when the bromphenol blue dye from the loading
buffer has migrated a distance judged sufficient for separation of the DNA
fragments. If ethidium bromide has been incorporated into the gel, the DNA
can be visualized by placing on a UV light source and can be photographed
directly.
Gels that have been run in the absence of ethidium bromide can be stained by
covering the gel in a dilute soluƟon of ethidium bromide (0.5 g/ml in water)
and gently agitaƟng for 10 to 30 min. If necessary, gels can be destained by
shaking in water for an addiƟonal 30 min. This serves to remove excess ethidium
bromide which causes background fluorescence and makes visualization of small
quantities of DNA difficult.
DNA can be photographed in agarose gels stained with ethidium bromide by
illumination with UV light (>2500 μW/cm2). A UV transilluminator is typically used
for this purpose, and commercial models are available designed specifically for DNA
visualization and photography.
CAUTION: UV light is damaging to eyes and exposed skin. Protective eyewear
should be worn at all times while using a UV light source.
34
PHOTOGRAPHY OF DNA IN AGAROSE GELS

T E C H N I C A L M A N U A L
Wizard® Genomic DNA
Purifi cation Kit
InstrucƟ ons for use of Product
A1120 , A1123, A1125 AND A1620
Revised 12/10
TM050

Wizard® Genomic DNA
Purification Kit
All technical literature is available on the Internet at: www.promega.com/tbs/
Please visit the web site to verify that you are using the most current version of this
Technical Manual. Please contact Promega Technical Services if you have questions on use
of this system. E-mail: techserv@promega.com.
1. Description..........................................................................................................1
2. Product Components and Storage Conditions ............................................2
3. Protocols for Genomic DNA Isolation ..........................................................5
A. Isolating Genomic DNA from Whole Blood
(300μl or 3ml Sample Volume)...........................................................................5
B. Isolating Genomic DNA from Whole Blood
(10ml Sample Volume) ........................................................................................7
C. Isolating Genomic DNA from Whole Blood
(96-Well Plate).......................................................................................................9
D. Isolating Genomic DNA from Tissue Culture Cells and
Animal Tissue .....................................................................................................11
E. Isolating Genomic DNA from Plant Tissue ...................................................13
F. Isolating Genomic DNA from Yeast................................................................14
G. Isolating Genomic DNA from Gram Positive and
Gram Negative Bacteria ....................................................................................16
4. Troubleshooting...............................................................................................17
5. References .........................................................................................................18
6. Appendix ...........................................................................................................19
A. Composition of Buffers and Solutions ............................................................19
B. Related Products.................................................................................................19
1. Description
The Wizard® Genomic DNA Purification Kit is designed for isolation of DNA
from white blood cells (Sections 3.A, B and C), tissue culture cells and animal
tissue (Section 3.D), plant tissue (Section 3.E), yeast (Section 3.F), and Gram
positive and Gram negative bacteria (Section 3.G). Table 1 lists the typical yield
for DNA purified from each of these sources.
The Wizard® Genomic DNA Purification Kit is based on a four-step process (1).
The first step in the purification procedure lyses the cells and the nuclei. For
isolation of DNA from white blood cells, this step involves lysis of the red
blood cells in the Cell Lysis Solution, followed by lysis of the white blood cells
and their nuclei in the Nuclei Lysis Solution. An RNase digestion step may be
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA
Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.com
Printed in USA. Part# TM050
Revised 12/10 Page 1

included at this time; it is optional for some applications. The cellular proteins
are then removed by a salt precipitation step, which precipitates the proteins
but leaves the high molecular weight genomic DNA in solution. Finally, the
genomic DNA is concentrated and desalted by isopropanol precipitation.
DNA purified with this system is suitable for a variety of applications,
including amplification, digestion with restriction endonucleases and membrane
hybridizations (e.g., Southern and dot/slot blots).
2. Product Components and Storage Conditions
Small-Scale Isolation (minipreps)
Product Size Cat.#
Wizard® Genomic DNA Purification Kit 100 isolations A1120
Each system contains sufficient reagents for 100 isolations of genomic DNA from 300μl
of whole blood samples. Includes:
• 100ml Cell Lysis Solution
• 50ml Nuclei Lysis Solution
• 25ml Protein Precipitation Solution
• 50ml DNA Rehydration Solution
• 250μl RNase Solution
Product Size Cat.#
Each system contains sufficient reagents for 500 isolations of genomic DNA from 300μl
• 500ml Cell Lysis Solution
• 250ml Nuclei Lysis Solution
• 1.25ml RNase Solution
Part# TM050 Printed in USA.
Page 2 Revised 12/10

Large-Scale Isolation (maxiprep)
Product Size Cat.#
Each system contains sufficient reagents for 100 isolations of genomic DNA from 10ml
• 3L Cell Lysis Solution
• 1L Nuclei Lysis Solution
Note: Cat.# A1620 does not include RNase Solution.
Items Available Separately
Product Size Cat.#
Cell Lysis Solution 1L A7933
Nuclei Lysis Solution 1L A7943
Protein Precipitation Solution 350ml A7953
DNA Rehydration Solution 50ml A7963
RNase A (4mg/ml) 1ml A7973
Storage Conditions: Store the Wizard® Genomic DNA Purification Kit at room
temperature (22–25°C). See product label for expiration date.

Table 1. DNA Yields from Various Starting Materials.
Species and Material
Amount of
Starting Material
Typical DNA
Yield
RNase
Treatment
Human Whole Blood
(Yield depends on the
quantity of white blood
cells present)
96-well plate
(Process as little as
20μl/well; see Table 2.)
300μl
1.0ml
10.0ml
50μl/well
5–15μg
25–50μg
250–500μg
0.2–0.7μg
Optional
Optional
Optional
Optional
Mouse Whole Blood
EDTA (4%) treated
Heparin (4%) treated
96-well plate
300μl
300μl
50μl/well
6μg
6–7μg
0.2–0.7μg
Optional
Optional
Optional
Cell Lines
K562 (human)
COS (African green
monkey)
NIH3T3 (mouse)
PC12 (rat pheo-chromocytoma)
CHO (hamster)
3 × 106 cells
1.5 × 106 cells
2.25 × 106 cells
8.25 × 106 cells
1–2 × 106 cells
15–30μg
10μg
9.5–12.5μg
6μg
6–7μg
Required
Required
Required
Required
Required
Animal Tissue
Mouse Liver
Mouse Tail
11mg
0.5–1.0cm of tail
15–20μg
10–30μg
Required
Optional
Insects
Sf9 cells 5 × 106 cells 16μg Required
Plant Tissue
Tomato Leaf 40mg 7–12μg Required
Gram Negative Bacteria
Escherichia coli JM109
1ml
20μg
overnight culture,
5ml
75–100μg
~2 × 109 cells/ml
Enterobacter cloacae
1ml
20μg
overnight culture,
5ml
75–100μg
~6 × 109 cells/ml
Required
Required
Required
Required
Gram Positive Bacteria
Staphylococcus epidermis
overnight culture,
~3.5 × 108 cells/ml
1ml 6–13μg Required
Yeast
Saccharomyces cerevisiae
overnight culture,
~1.9 × 108 cells/ml
1ml 4.5–6.5μg Required

3. Protocols for Genomic DNA Isolation
We tested the purification of genomic DNA from fresh whole blood collected in
EDTA, heparin and citrate anticoagulant tubes and detected no adverse effects
upon subsequent manipulations of the DNA, including PCR (2). Anticoagulant
blood samples may be stored at 2–8°C for up to two months, but DNA yield
will be reduced with increasing length of storage.
The protocol in Section 3.A has been designed and tested for blood samples up
to 3ml in volume. The protocol in Section 3.B has been designed and tested for
blood samples up to 10ml in volume. The yield of genomic DNA will vary
depending on the quantity of white blood cells present. Frozen blood may be
used in the following protocols, but yield may be lower than that obtained
using fresh blood, and additional Cell Lysis Solution may be required.
Caution: When handling blood samples (Sections 3.A, B and C), follow
recommended procedures at your institution for biohazardous materials or see
reference 3.
3.A. Isolating Genomic DNA from Whole Blood (300μl or 3ml Sample Volume)
Materials to Be Supplied by the User
• sterile 1.5ml microcentrifuge tubes (for 300μl blood samples)
• sterile 15ml centrifuge tubes (for 3ml blood samples)
• water bath, 37°C
• isopropanol, room temperature
• 70% ethanol, room temperature
• water bath, 65°C (optional, for rapid DNA rehydration)
1. For 300μl Sample Volume: Add 900μl of Cell Lysis Solution to a sterile
1.5ml microcentrifuge tube.
For 3ml Sample Volume: Add 9.0ml of Cell Lysis Solution to a sterile 15ml
centrifuge tube.
Important: Blood must be collected in EDTA, heparin or citrate
anticoagulant tubes to prevent clotting.
2. Gently rock the tube of blood until thoroughly mixed; then transfer blood to
the tube containing the Cell Lysis Solution. Invert the tube 5–6 times to mix.
3. Incubate the mixture for 10 minutes at room temperature (invert 2–3 times
once during the incubation) to lyse the red blood cells. Centrifuge at
13,000–16,000 × g for 20 seconds at room temperature for 300μl sample.
Centrifuge at 2,000 × g for 10 minutes at room temperature for 3ml sample.
4. Remove and discard as much supernatant as possible without disturbing
the visible white pellet. Approximately 10–20μl of residual liquid will
remain in the 1.5ml tube (300μl sample). Approximately 50–100μl of
residual liquid will remain in the 15ml tube (3ml sample).
!

If blood sample has been frozen, repeat Steps 1–4 until pellet is white. There
may be some loss of DNA from frozen samples.
Note: Some red blood cells or cell debris may be visible along with the
white blood cells. If the pellet appears to contain only red blood cells, add
an additional aliquot of Cell Lysis Solution after removing the supernatant
above the cell pellet, and then repeat Steps 3–4.
5. Vortex the tube vigorously until the white blood cells are resuspended
(10–15 seconds).
Completely resuspend the white blood cells to obtain efficient cell lysis.
6. Add Nuclei Lysis Solution (300μl for 300μl sample volume; 3.0ml for 3ml
sample volume) to the tube containing the resuspended cells. Pipet the
solution 5–6 times to lyse the white blood cells. The solution should become
very viscous. If clumps of cells are visible after mixing, incubate the
solution at 37°C until the clumps are disrupted. If the clumps are still visible
after 1 hour, add additional Nuclei Lysis Solution (100μl for 300μl sample
volume; 1.0ml for 3ml sample volume) and repeat the incubation.
7. Optional: Add RNase Solution (1.5μl for 300μl sample volume; 15μl for 3ml
sample volume) to the nuclear lysate, and mix the sample by inverting the
tube 2–5 times. Incubate the mixture at 37°C for 15 minutes, and then cool
to room temperature.
8. Add Protein Precipitation Solution (100μl for 300μl sample volume; 1.0ml
for 3ml sample volume) to the nuclear lysate, and vortex vigorously for
10–20 seconds. Small protein clumps may be visible after vortexing.
Note: If additional Nuclei Lysis Solution was added in Step 6, add a total of
130μl Protein Precipitation Solution for 300μl sample volume and 1.3ml
Protein Precipitation Solution for 3ml sample volume.
9. Centrifuge at 13,000–16,000 × g for 3 minutes at room temperature for 300μl
sample volume. Centrifuge at 2,000 × g for 10 minutes at room temperature
for 3ml sample volume.
A dark brown protein pellet should be visible. If no pellet is observed, refer
to Section 4.
10. For 300μl sample volume, transfer the supernatant to a clean 1.5ml
microcentrifuge tube containing 300μl of room-temperature isopropanol.
For 3ml sample volume, transfer the supernatant to a 15ml centrifuge tube
containing 3ml room-temperature isopropanol.
Note: Some supernatant may remain in the original tube containing the
protein pellet. Leave this residual liquid in the tube to avoid contaminating
the DNA solution with the precipitated protein.
11. Gently mix the solution by inversion until the white thread-like strands of
DNA form a visible mass.
!

12. Centrifuge at 13,000–16,000 × g for 1 minute at room temperature for 300μl
sample. Centrifuge at 2,000 × g for 1 minute at room temperature for 3ml
sample. The DNA will be visible as a small white pellet.
13. Decant the supernatant, and add one sample volume of room temperature
70% ethanol to the DNA. Gently invert the tube several times to wash the
DNA pellet and the sides of the microcentrifuge tube. Centrifuge as in Step 12.
14. Carefully aspirate the ethanol using either a drawn Pasteur pipette or a
sequencing pipette tip. The DNA pellet is very loose at this point and care
must be used to avoid aspirating the pellet into the pipette. Invert the tube
on clean absorbent paper and air-dry the pellet for 10–15 minutes.
15. Add DNA Rehydration Solution (100μl for 300μl sample volume; 250μl for
3ml sample volume) to the tube and rehydrate the DNA by incubating at
65°C for 1 hour. Periodically mix the solution by gently tapping the tube.
Alternatively, rehydrate the DNA by incubating the solution overnight at
room temperature or at 4°C.
16. Store the DNA at 2–8°C.
3.B. Isolating Genomic DNA from Whole Blood (10ml Sample Volume)
A large-scale kit is available for processing up to 1 liter of whole blood (Cat.#
A1620). This kit does not include RNase Solution since the RNase digestion
step is optional. RNase A solution (4mg/ml) is available as a separate item
(Cat.# A7973). If it is needed, a total of 5ml of RNase A solution is required to
process 1 liter of blood.
• sterile 50ml centrifuge tubes
• water bath, 65°C (optional; for rapid DNA rehydration)
1. For 10ml whole blood samples: Add 30ml of Cell Lysis Solution to a sterile
50ml centrifuge tube.
anticoagulant tubes to prevent clotting.
2. Gently rock the tube of blood until thoroughly mixed; then transfer 10ml of
blood to the tube containing the Cell Lysis Solution. Invert the tube 5–6
times to mix.
3. Incubate the mixture for 10 minutes at room temperature (invert 2–3 times
once during the incubation) to lyse the red blood cells. Centrifuge at
2,000 × g for 10 minutes at room temperature.
!

4. Remove and discard as much supernatant as possible without disturbing
the visible white pellet. Approximately 1.4ml of residual liquid will remain.
If blood sample has been frozen, add an additional 30ml of Cell Lysis
Solution, invert 5–6 times to mix, and repeat Steps 3–4 until pellet is nearly
white. There may be some loss of DNA in frozen samples.
Note: Some red blood cells or cell debris may be visible along with the
white blood cells. If the pellet appears to contain only red blood cells, add
an additional aliquot of Cell Lysis Solution after removing the supernatant
above the cell pellet, and then repeat Steps 3–4.
5. Vortex the tube vigorously until the white blood cells are resuspended
(10–15 seconds).
Completely resuspend the white blood cells to obtain efficient cell lysis.
6. Add 10ml of Nuclei Lysis Solution to the tube containing the resuspended
cells. Pipet the solution 5–6 times to lyse the white blood cells. The solution
should become very viscous. If clumps of cells are visible after mixing,
incubate the solution at 37°C until the clumps are disrupted. If the clumps
are still visible after 1 hour, add 3ml of additional Nuclei Lysis Solution and
repeat the incubation.
7. Optional: Add RNase A, to a final concentration of 20μg/ml, to the nuclear
lysate and mix the sample by inverting the tube 2–5 times. Incubate the
mixture at 37°C for 15 minutes, and then cool to room temperature.
8. Add 3.3ml of Protein Precipitation Solution to the nuclear lysate, and vortex
vigorously for 10–20 seconds. Small protein clumps may be visible after
vortexing.
Note: If additional Nuclei Lysis Solution was added in Step 6, add 4ml of
Protein Precipitation Solution (instead of 3.3ml).
9. Centrifuge at 2,000 × g for 10 minutes at room temperature.
A dark brown protein pellet should be visible. If no pellet is observed, refer
to Section 4.
10. Transfer the supernatant to a 50ml centrifuge tube containing 10ml of room
temperature isopropanol.
protein pellet. Leave the residual liquid in the tube to avoid contaminating
12. Centrifuge at 2,000 × g for 1 minute at room temperature. The DNA will be
visible as a small white pellet.
!

13. Decant the supernatant and add 10ml of room temperature 70% ethanol to
the DNA. Gently invert the tube several times to wash the DNA pellet and
the sides of the centrifuge tube. Centrifuge as in Step 12.
14. Carefully aspirate the ethanol. The DNA pellet is very loose at this point
and care must be used to avoid aspirating the pellet into the pipette. Air-dry
the pellet for 10–15 minutes.
15. Add 800μl of DNA Rehydration Solution to the tube, and rehydrate the
DNA by incubating at 65°C for 1 hour. Periodically mix the solution by
gently tapping the tube. Alternatively, rehydrate the DNA by incubating
the solution overnight at room temperature or at 4°C.
3.C. Isolating Genomic DNA from Whole Blood (96-well plate)
This protocol can be scaled to 20μl, 30μl or 40μl of blood. Table 2 outlines the
various solution volumes used in each step. Fifty-microliter preps generally
yield genomic DNA in the range of 0.2–0.7μg, depending upon the number of
leukocytes in the blood sample.
Table 2. Volumes of Reagents Required for Various Starting Amounts of Blood.
Sample
Cell Lysis
Solution
(RBC Lysis)
Nuclei Lysis
Solution
Protein
Precipitation
Solution Isopropanol
DNA
Rehydration
Solution
20μl 60μl 20μl 6.7μl 20μl 10μl
30μl 90μl 30μl 10μl 30μl 15μl
40μl 120μl 40μl 13.3μl 40μl 20μl
50μl 150μl 50μl 16.5μl 50μl 25μl
• V-bottom 96-well plate(s) able to hold 300μl volume/well (Costar® Cat.# 3896)
• 96-well plate sealers (Costar® Cat.# 3095) (optional; for use with human
blood)
1. Add 150μl Cell Lysis Solution to each well.
anticoagulant tubes.
2. Add 50μl of fresh blood to each well and pipet 2–3 times to mix.
3. Leave the plate at room temperature for 10 minutes, pipetting the solution
twice during the incubation to help lyse the red blood cells.
4. Centrifuge at 800 × g for 5 minutes in a tabletop centrifuge to concentrate
the cells.
!

5. Carefully remove and discard as much of the supernatant as possible with a
micropipette tip, leaving a small pellet of white cells and some red blood
cells. The use of an extended pipette tip, such as a gel loading tip, is
recommended. Tilting the 96-well plate 50–80° (depending on the amount
of liquid present per well) allows more thorough removal of liquid from the
well.
6. Add 50μl of Nuclei Lysis Solution to each well and pipet 5–6 times to
resuspend the pellet and lyse the white blood cells. The solution should
become more viscous. As an aid in DNA pellet visualization, 2μl per well of
a carrier (e.g., Polyacryl Carrier [Molecular Research Center, Inc., Cat.#
PC152]) can be added at this step. DNA yields are generally equivalent with
or without carrier use.
7. Add 16.5μl of Protein Precipitation Solution per well and pipet 5–6 times
to mix.
8. Centrifuge at 1,400 × g for 10 minutes at room temperature. A brown
protein pellet should be visible. If no pellet is visible, refer to Section 4.
9. DNA Precipitation/Rehydration in 96-Well Plate
a. Carefully transfer the supernatants to clean wells containing 50μl per well
of room temperature isopropanol and mix by pipetting.
Note: Some of supernatant may remain in the original well containing the
protein pellet. Leave this residual liquid in the well to avoid contaminating
the DNA solution with the precipitated protein. As in Step 5, tilting the
plate will facilitate removal of liquid from the well. Using an extended
pipette tip in this step does not allow easy sample mixing with isopropanol.
b. Centrifuge at 1,400 × g for 10 minutes. Carefully remove the
isopropanol with a micropipette tip.
c. Add 100μl of room temperature 70% ethanol per well.
d. Centrifuge at 1,400 × g for 10 minutes at room temperature.
e. Carefully aspirate the ethanol using either a drawn Pasteur pipette or a
sequencing pipette tip. Care must be taken to avoid aspirating the DNA
pellet. Place the tray at a 30–45° angle and air-dry for 10–15 minutes.
f. Add 25μl of DNA Rehydration Solution to each well. Allow the DNA to
rehydrate overnight at room temperature or at 4°C.
g. Store the DNA at 2–8°C.
Note: Small volumes of DNA can be easily collected at the bottom of a
V-well by briefly centrifuging the 96-well plate before use.

3.D. Isolating Genomic DNA from Tissue Culture Cells and Animal Tissue
• 1.5ml microcentrifuge tubes
• 15ml centrifuge tubes
• small homogenizer (Fisher Tissue Tearor, Cat.# 15-338-55, or equivalent)
(for animal tissue)
• trypsin (for adherent tissue culture cells only)
• PBS
• liquid nitrogen (for mouse tail) (optional; for freeze-thaw, Step 1.d, and for
tissue grinding, Step 2.b, in place of small homogenizer)
• mortar and pestle (optional; for tissue grinding, Step 2.b, in place of small
homogenizer)
• 95°C water bath (optional; for freeze-thaw, Step 1.d)
• 0.5M EDTA (pH 8.0) (for mouse tail)
• Proteinase K (20mg/ml in water; Cat.# V3021) (for mouse tail)
1. Tissue Culture Cells
a. Harvest the cells, and transfer them to a 1.5ml microcentrifuge tube. For
adherent cells, trypsinize the cells before harvesting.
b. Centrifuge at 13,000–16,000 × g for 10 seconds to pellet the cells.
c. Remove the supernatant, leaving behind the cell pellet plus 10–50μl of
residual liquid.
d. Add 200μl PBS to wash the cells. Centrifuge as in Step 1.b, and remove
the PBS. Vortex vigorously to resuspend cells.
Note: For cells that do not lyse well in Nuclei Lysis Solution alone (e.g.,
PC12 cells), perform an additional freeze-thaw step as follows before
proceeding to Step 1.e: Wash the cells as in Step 1.d; then freeze in liquid
nitrogen. Thaw the cells by heating at 95°C. Repeat this procedure for a
total of 4 cycles.
e. Add 600μl of Nuclei Lysis Solution, and pipet to lyse the cells. Pipet until
no visible cell clumps remain.
f. Proceed to Section 3.D, Step 4.
2. Animal Tissue (Mouse Liver and Brain)
a. Add 600μl of Nuclei Lysis Solution to a 15ml centrifuge tube, and chill
on ice.

b. Add 10–20mg of fresh or thawed tissue to the chilled Nuclei Lysis Solution
and homogenize for 10 seconds using a small homogenizer. Transfer the
lysate to a 1.5ml microcentrifuge tube. Alternatively, grind tissue in liquid
nitrogen using a mortar and pestle that has been prechilled in liquid
nitrogen. After grinding, allow the liquid nitrogen to evaporate and transfer
approximately 10–20mg of the ground tissue to 600μl of Nuclei Lysis
Solution in a 1.5ml microcentrifuge tube.
c. Incubate the lysate at 65°C for 15–30 minutes.
d. Proceed to Section 3.D, Step 4.
3. Animal Tissue (Mouse Tail)
a. For each sample to be processed, add 120μl of a 0.5M EDTA solution (pH
8.0) to 500μl of Nuclei Lysis Solution in a centrifuge tube. Chill on ice.
Note: The solution will turn cloudy when chilled.
b. Add 0.5–1cm of fresh or thawed mouse tail to a 1.5ml microcentrifuge tube.
Note: The tissue may be ground to a fine powder in liquid
nitrogen using a mortar and pestle that has been prechilled in liquid
nitrogen. Then transfer the powder to a 1.5ml microcentrifuge tube.
c. Add 600μl of EDTA/Nuclei Lysis Solution from Step 3.a to the tube.
d. Add 17.5μl of 20mg/ml Proteinase K.
e. Incubate overnight at 55°C with gentle shaking. Alternatively, perform a
3-hour 55°C incubation (with shaking); vortex the sample once per hour if
performing a 3-hour incubation. Make sure the tail is completely
digested.
4. Optional for mouse tail: Add 3μl of RNase Solution to the nuclear lysate
and mix the sample by inverting the tube 2–5 times. Incubate the mixture
for 15–30 minutes at 37°C. Allow the sample to cool to room temperature
for 5 minutes before proceeding.
5. To the room temperature sample, add 200μl of Protein Precipitation
Solution and vortex vigorously at high speed for 20 seconds. Chill sample
on ice for 5 minutes.
6. Centrifuge for 4 minutes at 13,000–16,000 × g. The precipitated protein will
form a tight white pellet.
7. Carefully remove the supernatant containing the DNA (leaving the protein
pellet behind) and transfer it to a clean 1.5ml microcentrifuge tube
containing 600μl of room temperature isopropanol.

9. Centrifuge for 1 minute at 13,000–16,000 × g at room temperature. The
DNA will be visible as a small white pellet. Carefully decant the
supernatant.
10. Add 600μl of room temperature 70% ethanol, and gently invert the tube
several times to wash the DNA. Centrifuge for 1 minute at 13,000–16,000 × g
at room temperature.
sequencing pipette tip. The DNA pellet is very loose at this point, and care
must be used to avoid aspirating the pellet into the pipette.
12. Invert the tube on clean absorbent paper, and air-dry the pellet for 10–15
minutes.
13. Add 100μl of DNA Rehydration Solution, and rehydrate the DNA by
incubating at 65°C for 1 hour. Periodically mix the solution by gently
tapping the tube. Alternatively, rehydrate the DNA by incubating the
solution overnight at room temperature or at 4°C.
3.E. Isolating Genomic DNA from Plant Tissue
• microcentrifuge tube pestle or mortar and pestle
1. Leaf tissue can be processed by freezing with liquid nitrogen and grinding
into a fine powder using a microcentrifuge tube pestle or a mortar and
pestle. Add 40mg of this leaf powder to a 1.5ml microcentrifuge tube.
2. Add 600μl of Nuclei Lysis Solution, and vortex 1–3 seconds to wet the
tissue.
3. Incubate at 65°C for 15 minutes.
4. Add 3μl of RNase Solution to the cell lysate, and mix the sample by inverting
the tube 2–5 times. Incubate the mixture at 37°C for 15 minutes. Allow the
sample to cool to room temperature for 5 minutes before proceeding.
5. Add 200μl of Protein Precipitation Solution, and vortex vigorously at high
speed for 20 seconds.
6. Centrifuge for 3 minutes at 13,000–16,000 × g. The precipitated proteins will
form a tight pellet.

7. Carefully remove the supernatant containing the DNA (leaving the protein
pellet behind) and transfer it to a clean 1.5ml microcentrifuge tube
containing 600μl of room temperature isopropanol.
8. Gently mix the solution by inversion until thread-like strands of DNA form
a visible mass.
9. Centrifuge at 13,000–16,000 × g for 1 minute at room temperature.
10. Carefully decant the supernatant. Add 600μl of room temperature 70%
ethanol and gently invert the tube several times to wash the DNA.
Centrifuge at 13,000–16,000 × g for 1 minute at room temperature.
sequencing pipette tip. The DNA pellet is very loose at this point and care
must be used to avoid aspirating the pellet into the pipette.
12. Invert the tube onto clean absorbent paper and air-dry the pellet for 15
minutes.
13. Add 100μl of DNA Rehydration Solution and rehydrate the DNA by
incubating at 65°C for 1 hour. Periodically mix the solution by gently
tapping the tube. Alternatively, rehydrate the DNA by incubating the
solution overnight at room temperature or at 4°C.
3.F. Isolating Genomic DNA from Yeast
• YPD broth
• 50mM EDTA (pH 8.0)
• 20mg/ml lyticase (Sigma Cat.# L2524)
1. Add 1ml of a culture grown for 20 hours in YPD broth to a 1.5ml
microcentrifuge tube.
2. Centrifuge at 13,000–16,000 × g for 2 minutes to pellet the cells. Remove the
supernatant.
3. Resuspend the cells thoroughly in 293μl of 50mM EDTA.
4. Add 7.5μl of 20mg/ml lyticase and gently pipet 4 times to mix.

Medicall genetics lab manual

Recommended

Recommended

More Related Content

What's hot

What's hot (16)

Similar to Medicall genetics lab manual

Similar to Medicall genetics lab manual (20)

More from في رحاب الله

More from في رحاب الله (19)

Recently uploaded

Recently uploaded (20)

Medicall genetics lab manual