. 1.1 Based on your understanding of the packaging of DNA, describe the structure displayed in Figure 1 (5) Figure 1 Two copies of four different kinds of proteins come together to form a structure with DNA 1.2 Identify and describe the secondary structural elements visible for the proteins and DNA in Figure 1. Indicate if the structures contain tertiary or quaternary structure and provide a reasoning for your answer (10) 1.3 Describe and illustrate how you could differentiate between these three DNA strands using DNA melting experiments: Strand 1: 5AGCGGGGCGGCAGCGCGGAT3 Strand 2: 5ATGCCGATATTTTTAGCGCA3 Strand 3: 5ATTTTAAATTAGCATTTAAT3.

1. , AIDS is a diagnostic term applied to HIV-infected persons who have
a. at least three well-defined, life-threatening clinical conditions that is clearly linked to HIV-
induced immunosuppression
b. at least one well-defined, life-threatening clinical condition that is clearly linked to HIV-induced
immunosuppression
c. at least five well-defined, life-threatening clinical conditions that is clearly linked to HIV-induced
immunosuppression
d. at least two well-defined, life-threatening clinical conditions that is clearly linked to
immunosuppression
2.
2.Which one of the following is a systemic effect of inflammation?
a.Decreases complement activation
b.Increases in acute phase proteins
c.Systemic increases in reactive proteins
d.Decreases in acute phase proteins
e.Decreases in CRP
3.The transmission of HIV may happen via body fluids which include:
a.Breastmilk and/or saliva
b.Semen and/or saliva
c.Blood and/or saliva
d.Breastmilk and/or semen
e.Semen and/or sputum
4.Which one of the following statements is false?
a.Albumin has a plasma half-life of 14-20 days.
b.Albumin levels are a direct reflection of nutritional status.
c.Albumin is the most abundant plasma protein.
d.Albumin levels only reflect changes in nutrition status after prolonged malnutrition.
e.Albumin levels rise slowly when malnutrition is treated.
5.Which tissue is a type of lymphoid tissue?
a.liver
b.brain
c.lungs
d.spleen
e.appendix
6.Which of the following is true about cytokines?
a.Bind to receptors on target cells.
b.Suppress the immune response.
c.Act as enzymes.
d.Produce and secrete antibodies.
e.Plays a role in building skeletal muscle.
7.Which vitamin must be given in conjunction with the TB drug isoniazid?
a.Iron

2. b.Vitamin B6
c.Vitamin A
d.Zinc
e.Vitamin B12
8.According to the World Health Organizations clinical staging of HIV unexplained severe weight
loss of more than 10% of the body weight is one of the clinical signs of:
a.Clinical stage 0 HIV disease
b.Clinical stage 1 HIV disease
c.Clinical stage 4 HIV disease
d.Clinical stage 3 HIV disease
e.Clinical stage 2 HIV disease
9._______ are large globular proteins produced by B cells that function as antibodies.
a.T-cells
b.Immunoglobulins
c.Lysozymes
d.Antigens
e.Antibodies
10.A substance that enters the human body and results in the forming of antibodies is called a
a.antibody.
b.immunoglobulin.
c.acute-phase protein.
d.antigen.
e.natural killer cell.
e. at least four well-defined, life-threatening clinical conditions that is clearly linked to HIV-induced
immunosuppression