1. ROLE OF FUT7 DURING LEUKOCYTE ADHESION AND
EXTRAVASATION
by
Sogol Hekmatfar
1 September 2015
A thesis submitted to the
Faculty of the Graduate School of
the University at Buffalo, State University of New York
in partial fulfillment of the requirements for the
degree of
Master of Science
Department of Chemical and Biological Engineering
2. 2
ACKNOWLEDGMENT:
First of all, I would like to thank my advisor, Dr. Neelamegham for his continuous supports
during my M.Sc. degree. Besides my advisor, I would like to thank my thesis committee Dr.
Pfeifer for his helpful comments and cooperation.
I want to express my sincere gratitude to my dear family, especially my father, mother, sister
and brother for their supports during my whole life; my dear grandparents who always
encourage me to follow my dreams and be a better person.
Special thanks to my dear friends for their kindness.
4. 4
ABSTRACT:
Leukocyte adhesion and transmigration from blood flow on the endothelial cells is an important
cascade of processes during inflammation. The initial leukocyte capturing is mediated by
binding of P-selectin expressed on the endothelium and PSGL-1 on the neutrophil which leads
to decrease the leukocyte speed. E-selectin is another endothelial cell adhesion molecule that
regulates leukocyte capture and this must be transcriptionally activated by thrombotic or
inflammatory stimuli like IL-1β. In mouse, E-selectin binds to PSGL-1 and ESL-1 on the
neutrophil aids the transition to firm cell binding. The E-selectin ligands on human leukocytes
remain unknown. Once the cell is recruited, cell signaling events occur that lead to neutrophil
deformation and migration through the endothelial cells. This phenomenon is known as
leukocyte extravasation or diapedesis. Sialyl-Lewis x is a tetra-saccharide carbohydrate found in
both PSGL-1 and ESL-1 structures which has an impact in cell-cell adhesion. The synthesis of
sialyl-Lewis X is one of the responsibilities of the FUT7 gene. Selectins engagement is also
involved in leukocyte activation and thus the disruption of selectin-ligands can impact not only
the initial capture step but also steps in the cell adhesion cascade. To examine this aspect, in
this project, the impact of FUT7 gene, on promyeloid HL-60, cell capture, firm adhesion and
transmigration was examined using CRISPR-Cas9 to functionally ablate this specific gene.
Results were compared with wild type HL-60 cells. Microfluidic flow cell was used to study cell
adhesion to the selectins under shear flow. Transmigration assays were performed on activated
HUVEC monolayers under static conditions. The results show a dominant role for FUT7in
regulating P-selectin mediated cell adhesion with a much smaller role during E-selectin binding.
FUT7 did not affect human HL-60 myeloid cell transmigration across HUVEC monolayers.
6. 6
White blood cells or leukocytes are one kind of cells existing in the blood. They play an
important role in the immune system of the body. The different types of leukocytes are
responsible for a vast majority of tasks such as microbial infections, allergic reactions, bacterial
attacks, and other kinds of diseases. Leukocytes go through several steps after the recognition
of any invading pathogens; slow rolling, adhesion strengthening, intraluminal crawling and para-
cellular and trans-cellular migration[1].
Leukocytes roll on the thin monolayer of endothelial cells placed in the interior surface of blood
vessels called endothelium. In case of injury, the influenced tissue releases cytokines, such as
IL-1β, in order to activate the endothelial cells to express some cell adhesion proteins known as
CAMs (cell adhesion molecules) [2], [3]. At the site of damage, Leukocytes are captured from
the blood flow with the support of CAMs. One calcium-dependent member of the CAM proteins
is the selectins family. During inflammation, leukocyte attachment is mediated by the selectins
family through lowering the speed of leukocytes along endothelium [4]. P-selectin facilitates the
initial capture of the leukocyte and starts to function within minutes of injury, as it is stored in the
cell granules [5]; however, E-selectin adjusts slower rolling. E-selectin is not stored in the cell
and will be produced transcriptionally regulated and activated by cytokines on the surface of
endothelial cells two hours after chemically or cytokine-induced inflammation [6]. In Neutrophils,
one type of Leukocytes of our interest, the rolling movement is feasible through the interaction
of P-selectin glycoprotein ligand-1 (PSGL1) at the surface of neutrophils and P-selectin on the
endothelial cells [7]. Furthermore, E-selectin on the surface of endothelial cells will also attach to
PSGL1 and ESL1 (E-selectin ligand 1 in mouse) on the neutrophils [8]. It has been
demonstrated that the E-selectin function in leukocyte rolling strongly depends on P-Selectin.
The up-regulation of P-selectin on the inflamed endothelium reduces the rolling speed of
neutrophils, which leads to further signaling cascade that causes neutrophil adhesion to
endothelium surface [9]. PSGL-1, CD44, and ESL-1 are responsible for the rolling interaction in
7. 7
mouse and they mediate the transition to firm adhesion. Injured cells release cytokines IL-1β
during inflammation in order to transcriptionally regulate E-selectin on the endothelial cells [10].
Additionally, the secretion of IL-8 by wounded endothelium cells promotes linkage to leukocyte
chemokine receptors. The signaling events activate the integrin molecules and cause an
extension in integrin conformation, which enhances the binding to ICAMs (intercellular adhesion
molecule) on endothelium [11]. Chemokines released by the damaged cells activate the rolling
leukocytes, which has been attached to endothelial cells and start penetrating into the cells. The
integrin signaling ends up in an intense cell morphology change to cytoskeleton and additional
intraluminal crawling [12]. The leukocyte cell then crawls on the surface and enters the space
between two adjacent endothelial cells. Trans-endothelial migration (transmigration also known
as Extravasation) is the complete migration of the neutrophils into the space between two
neighboring endothelial cells [13].
FUT7 fucosyltransferase 7 (alpha (1, 3) fucosyltransferase) is a human gene involved in the
creation of sialyl-Lewis x (sLex) moiety. sLex is present on the surface of leukocytes, which
plays an important role in the cell-cell interaction [14]. The previous studies show that sialyl-
Lewis x mediates the initial selectin attachment step, as it can be found on both PSGL-1 and
ESL-1 structures [15]. Ultimately, FUT7 seems to have a huge impact in the synthesis of
selectin ligands, as well as cell rolling and to some extend cell adhesion during inflammation
[16]. Its role in leukocyte extravasation is yet undefined.
Cell rolling is a crucial step in healing, as it slows the contact time between leukocyte and
chemokines. The high on-rate of selectins mediates the initial capturing of leukocytes from the
blood, since force-dependent off-rate regulates the cell rolling [17]. It has been found that shear
forces affects E-selectin binding, causing the leukocyte rolling in the inner surface of blood
vessels and can break the interactions.
8. 8
Studying the role of FUT7 in mediating the cell-cell interaction and neutrophil adhesion to the
inflamed endothelial cells additionally enhancing the leukocyte extravasation is the main
objective of this research. To test this idea, first a precise model should be designed to perform
the leukocyte adhesion and extravasation in vitro. This model must be consistent and
reproducible in the lab environment during the whole experiment. HL-60 (Human promyelocytic
leukemia) cell line was selected as the primary cell, which is a laboratory used blood cell.
Treating HL-60 cells with some reagent such as DMSO causes the cells to differentiate
terminally to neutrophils in vitro [18]. This property of the cell leads to obtaining the similar
experimental results from differentiated cells as from leukocyte. On the other hand, a new
method in gene editing known as bacterial CRISPR/Cas9 (Clustered Regularly Interspaced
Short Palindromic Repeats)/(CRISPR-associated protein-9 nuclease) is applied to knockout the
FUT7 gene from HL-60 cells [19]. The CRISPR method is based on the bacteria natural immune
system used to protect themselves from virus infection. Bacteria produce two types of short
RNA after identifying the presence of virus DNA [20]. Each RNA sequence is matched to the
DNA strands of infecting virus. A protein named Cas9 will make a structure with two RNAs.
Cas9 is a nucleus type enzyme which can cut DNAs. The matching sequence, called guide
RNA, will find the virus genome target, the complex attaches to the DNA, and Cas9 will disable
the genome by making the double strand breaks. All this can be done in the cultured cells. This
method grants a precise edition of the genomic DNA. The mutation can delete the specific
genes or replace the region with a new copy by adding another piece of DNA. Also, it can be
used to edit the genomic sequences at multiple locations at the same time. By inserting the
mutation to the gene sequence, the gene will lose its function, leading the researcher to study
the function of that specific gene. The same idea is used in this research in order to knockout
the FUT7 gene. Initially, the 20 bp of top and bottom guide complement were designed and
inserted into the plasmid. This plasmid DNA is transfected into HL-60 by using Neon
transfection system.
9. 9
The mutation of HL-60 cells can be checked in some ways. One of the earliest methods used
was screening the cells with some antibodies and lectins. In this manner, HECA-452, CSLEX
(CD15s), and CD15 antibodies were used to detect sialyl- Lewis X or Lewis X structures on the
surface of the cells [21]. It was expected to observe the sialyl-Lewis X expressed on HL-60 cells
and lower expression on mutated cells. CD11b was used to check the differentiation of the cell,
as it is a marker for neutrophils [22], which mediates the leukocyte bindings. Another method
was the surveyor assay. In this assay, surveyor nuclease detects any mismatches in the
sequence and generates a new product. By loading the products on the agarose gel and
comparing to the wild type HL-60 cells, an additional band must be observed, if any mutation
has been inserted. The final method used was checking the sequence of the isolated DNA from
the edited cell.
A PDMS microfluidic flow chamber was applied to mimic the blood vessel where the leukocyte
adhesion cascade proceeds under fluid shear. The flow chamber was placed on the 60 mm
dishes with P-selectin or E-selectin coatings or a confluent HUVEC monolayer. Cells crossed
the chamber while interacting with E-selectin or P-selectin on the dish surface. The cells
reaction can be monitored and recorded by microscope for a certain time. The number of
adherent cells and rolling cells can be calculated, as well as the instant and average rolling
speed, to compare FUT7 KO cells to HL-60, as a positive control.
Endothelial monolayer can be activated with cytokine by adding IL-1β to the confluent HUVEC
monolayer. After 3-5 hours, E-selectin was expressed on the endothelium. Differentiated Hl-60
and KO cells can be injected into the plate. The migration of cells across the endothelial cell
monolayer was measured under the microscope.
11. 11
As mentioned in the introduction section, the idea of this research is to test the importance of
Fucosyltransferase 7 (alpha (1, 3) Fucosyltransferase) gene in the leukocytes on tethering
adhesion and extravasation. The initial goal was to design the experiment to obtain two cell
lines, one normal HL-60 cells and the other one FUT7 knocked out HL-60 cells. By using the
same experimental conditions for HL-60 cells as a positive control and KO cells as testing
samples, a scientific comparison between these two groups was feasible.
Gene Editing: The first phase of this project aimed to find an effective method to silence
the specific gene of interest. CRISPR Cas9 is a new technique in genomic editing that is
used to delete or replace the sequence of a specific gene at the desired location. The
procedure of this technique is described in detail below.
Designing the DNA with CRISPR Method
1. The initial step was to find the exact sequence of target, which can be found
on UCSC genome browser. The gene was located in the search bar of the
genome browser FUT7 and the genomic sequence option on the website was
chosen. It is preferred to pick up the first 250 bp (base pairs) of exonic
sequence from the first exon.
2. The selected sequence was then placed in the http://crispr.mit.edu/ website,
which is designed to find different targets sorted by their ranking number. The
highest ranked targets (two or three targets) were selected. One G base pair
must be added to the 5’ end if it did not start with G, the PAM sequence
should be excluded. For the top strand, CACC was added to the sequence
and for the bottom strand AAAC. All the sequences should be designed from
12. 12
5’ to 3’. If the chosen target by the program was from 3’ to 5’, the complement
had to be reversed.
GUIDE #1 Guide Top found by CRISPR MIT browser:
CACC GCAGCGGGCGATGCCGTAGC (from 3’ to 5’)
Bottom COMPLEMENT:
AAAC GCTACGGCATCGCCCGCTGC from (5’ to 3)
3. After choosing the right guide sequence, 20 bp forward and reverse primers
were designed for the chosen target by applying the Clone Manager
software. In order to get the best result in the PCR (polymerase chain
reaction), the primers with the annealing temperature between 60-72 ˚C were
selected. The annealing temperature can be checked by inserting the primers
on the NEB (New England Biolabs Inc) website under the Tools & Resources/
Tm Calculator tab. Oligos (top and bottom strands, forward and reverse
primers) were ordered from Eurofins Genomics.
Length: 578 bp
Annealing Temperature: 65 ˚C
Forward Primer:
CCACGATCACCATCCTTGTC
Reverse Primer:
AATGTAGTCGCGGTGCTGAG
Reverse Complement of Reverse Primer:
CTCAGCACCGCGACTACATT
13. 13
Part of the FUT7 gene has been selected here and the chosen guide
complement and the forward and reverse primers have been marked.
Part of FUT7 sequence from UCSC genome browser:
CAGTACATCTTCAATGTGTAAGATTCTCCTGGGAGACCAGGGCCCAGCTG
GTGGTGAGCTGGGGGAAGTGGGTGATACTGCCGTGGGAGGAGCCACCTGG
CCCTCTGGGGAAGTGCACTCGCTGTCTGCAGCGCCCAGGCCTGGGTAGCT
GGGTGGGGGCTGGGGGGCCATCTGTGCTCAGGGTGCCTGCACCTGGGCCT
TCTCTGCCCTGGGCCAAGCCTGCCCGAGCCTCTCTGTCCTCTGCCTGCCC
AGCTGGACATCTCTGGGCCTCTCTGGAGACCAGTGGGGTGGGCTGTGGGG
GCGTCATATTGCCCTGGCTTGGCATCCCTCTTGTGGCTGTACCCCTCCCA
GCAGCCCCAGGACTAGCAAGTCCCCGAGATGGGGGTGGGGACAGTGGTTG
ATGCCAAAGGTTGTGGGGGCAGGGGCGGGGCAGGAGCAGGAAGGTCCCCT
GAGTTCCCTCACCTTGGGCAGAGATAAAAGGAGCACAGTTCCAGGCGGGG
CTGAGCTAGGGCGTAGCTGTGATTTCAGGGGCACCTCTGGCGGCTGCCGT
GATTTGAGAATCTCGGGTCTCTTGGCTGACTGATCCTGGGAGACTGTGGA
TGAATAATGCTGgtgagtgtctggccctcggggaggcccaagctggggac
agctaggcaacctgggaggggaggacgggggtggcgctgagtggggcatg
tcggtgtccctgagcccatgggaggggaggacgggggtggcgctgagtgg
ggcatgtgggtgtccctgagcccatgggaggggaggacggggttggcgct
gagtggggcgtgtggatgtccctgagcccaagtgacagagcctcccctcc
ctcgtgctgctgcagGGCACGGCCCCACCCGGAGGCTGCGAGGCTTGGGG
GTCCTGGCCGGGGTGGCTCTGCTCGCTGCCCTCTGGCTCCTGTGGCTGCT
GGGGTCAGCCCCTCGGGGTACCCCGGCACCCCAGCCCACGATCACCATCC
TTGTCTGGCACTGGCCCTTCACTGACCAGCCCCCAGAGCTGCCCAGCGAC
ACCTGCACCCGCTACGGCATCGCCCGCTGCCACCTGAGTGCCAACCGAAG
CCTGCTGGCCAGCGCCGACGCCGTGGTCTTCCACCACCGCGAGCTGCAGA
CCCGGCGGTCCCACCTGCCCCTGGCCCAGCGGCCGCGAGGGCAGCCCTGG
GTGTGGGCCTCCATGGAGTCTCCTAGCCACACCCACGGCCTCAGCCACCT
CCGAGGCATCTTCAACTGGGTGCTGAGCTACCGGCGCGACTCGGACATCT
TTGTGCCCTATGGCCGCCTGGAGCCCCACTGGGGGCCCTCGCCACCGCTG
CCAGCCAAGAGCAGGGTGGCCGCCTGGGTGGTCAGCAACTTCCAGGAGCG
GCAGCTGCGTGCCAGGCTGTACCGGCAGCTGGCGCCTCATCTGCGGGTGG
ATGTCTTTGGCCGTGCCAATGGACGGCCACTGTGCGCCAGCTGCCTGGTG
CCCACCGTGGCCCAGTACCGCTTCTACCTGTCCTTTGAGAACTCTCAGCA
CCGCGACTACATTACGGAGAAATTCTGGCGCAACGCACTGGTGGCTGGCA
CTGTGCCAGTGGTGCTGGGGCCCCCACGGGCCACCTATGAGGCCTTCGT
Preparing the DNA plasmid
1. The oligos must be cloned into the bacterial competent cells. For the cloning
procedure, LentiCRISPR-Cerulean vector was used which had already been
cut by BsmBI restriction enzyme; the gel purified backbone dropped by 2 kb
fragments. The PCR sample was made as:
14. 14
1 µl 100µM Top Oligos
1 µl 100µM bottom Oligos
1 µl T4 Ligase buffer
7 µl H2O
and annealed in the thermal cycler with these settings:
2. The mixture was ligated at RT (Room Temperature) for two hours with the
mixture of
1 µL LentiCRISPR-Cerulean Vector
1 µL Annealed Target
1 µL T4 Ligase buffer
7 µL H2O
1 µL T4 Ligase
To transform the DNA to bacterial cells, 2 µL of the solution was added to
100 µL of Stbl3 competent cells in the microcentrifuge tubes and incubated
30 min on ice. The tubes were placed in the water bath, given a heat shock
at 42 ˚C for 45 s, and then incubated again on ice for another 5 min. 1 mL of
LB (Lysogeny Broth) with no antibiotic was added to each tube, which were
then incubated for 30 min at 37 ˚C on a shaker. The tubes were centrifuged
with the highest speed for 30 s and supernatants were taken out, then
resuspeneded in 100-200 µL of LB. The solutions were transferred to the LB
+ 0.1% Carbenicillin antibiotic agar plates and covered the cells evenly on the
surface. The plates were inverted and incubated overnight at 37 ˚C.
Temperature 95 ˚C 72 ˚C 42 ˚C 25 ˚C 4 ˚C
Time 2 min 2 min 2 min 2 min Cool down
15. 15
3. On the next day, some colonies were taken with sterile tips and added to
separate tubes containing 3-4 mL of LB + antibiotics; bacteria were incubated
overnight at 37 ˚C on the shaker.
4. The tubes were spun down the next day. “Wizard® Plus SV Minipreps DNA
Purification System” was used to isolate the plasmid DNA from E-coli
following the protocol below:
Reuspend (the pellet with 250 µL of Cell Resuspension Solution.
Add 250 µL of cell lysis Solution to each sample, invert 4 times to mix.
Add 10 µL of Alkaline Protease Solution; invert four times to mix, incubate
for 5 min at RT.
Add 350 µL of Neutralization Solution; invert 4 times to mix.
Centrifuge at top speed for 10 min at RT.
Insert spin column into collection tube.
Decant cleared lysate into spin column.
Centrifuge at top speed for one min at RT. Discard flow-through, and
reinsert column into Collection Tube.
Add 750 µL of Wash Solution (ethanol added). Centrifuge at top speed for
min. Discard flow-through and reinsert column into Collection Tube.
Repeat the washing step with 250 µL of Wash Solution.
Centrifuge at top speed for two min at RT.
Discard the solution from the collection tube and centrifuge for one min.
Transfer spin column to sterile 1.5 mL microcentrifuge tube.
Add 100 µL of Nuclease-Free Water to the spin column. Centrifuge at top
speed for one min at RT.
16. 16
Discard column, and store the DNA at -20 ˚C.
5. 1% agarose gel can be made as below
Preparation of 10x TAE Buffer
48.4 g Tris Base
2.92 g EDTA (Ethylenediaminetetraacetic acid)
11.42 mL Glacial Acetic acid
1000 mL distilled water
200 mg agarose powder was weighed and mixed with 20 mL of 1X TAE
buffer. The solution was brought to boil in the microwave for less than a
minute, and then cooled down to 45 ˚C at RT; after which, 0.2 µL Ethidium
Bromide was added to it. It was finally poured on the gel cast and kept at RT
for 20-30 minutes to solidify.
6. DNA was loaded on the agarose gel and ran for 20 min at 100 V. The right
size band (1070 bp) was screened on the UV screen and cut with a blade.
QIAquick Gel Extraction Kit from QIAGEN was applied to purify the DNA by
the following protocol:
Weigh the gel slice in a colorless tube. Add three volumes Buffer QG to
one volume of gel.
Incubate at 50 ˚C for 10 min (or until the gel slice has completely
dissolved). Vortex the tube 2-3 times to help dissolve the gel.
Add one volume isopropanol to the sample and mix.
17. 17
Place a QIAquick spin column in a provided 2 mL collection tube and
centrifuge for one min. Discard flow-through and place the QIAquick
column back into the same tube.
Centrifuge for one min, discard the flow-through, and place the QIAquick
column back into the same tube.
To wash, add 750 µL Buffer PE to QIAquick column and centrifuge for
one min. Discard flow-through and place the QIAquick column back into
the same tube.
Centrifuge the QIAquick column in the provided 2 mL collection tube for
one min to remove residual wash buffer.
Place QIAquick column into a clean 1.5 mL microcentrifuge tube.
To elute DNA, add 50 µL Buffer EB or water to the center of the QIAquick
membrane and let the column stand for 1-4 min, centrifuge the column
for one min.
Discard the column and store the DNA in -20 ˚C.
7. To screen the DNA, the mixture was made:
10 µL DNA plasmid
1 µL 10X cut smart buffer
0.5 µL NdeI enzyme
0.5 µL EcoRI enzyme
7 µL distilled water
8. The tubes were incubated at RT for 30 min, the samples were run on the
agarose gel. There should be two bands after digesting with the enzymes.
9. DNA was sent to Roswell Park for sequencing using LK01 as primer.
18. 18
10. After having the right sequence, the right DNA was used to culture more
bacteria in 20 mL flasks and used the midi-prep kit to isolate more DNA.
Using the Neon® Transfection System and Electroporation
This apparatus performs a more efficient cell transfection by generating a uniform
electric field. Many types of cell lines can be transfected with this system by
using specific settings on the machine. The goal was the transfection of HL-60
cells; the efficiency of HL-60 transfection was described to be 55% by invitrogen.
1. HL-60 cells were cultured for 1-2 days in RPMI-1640 medium (Roswell Park
Memorial Institute) + 10% FBS (Fetal Bovine Serum) +1% Glutamax +1% AA
(Antibiotic-Antimycotic).
2. 2.5×105
cells per tube were counted and centrifuged at 140×g for 5 min and
washed twice with sterile PBS buffer (Phosphate buffered saline).
Resuspended in 50 µL of resuspension buffer R (from Neon® Transfection
System from Invitrogen) at 5×106
cells/mL.
3. At the apparatus settings, the voltage was set as 1350 V with 35 ms pulse
width and one pulse.
4. A tube was placed on the machine and filled with 3 mL of Electrolytic buffer
E.
5. 3 µg of the DNA plasmid was added to the cells and mixed.
6. 10 µL of the sample was taken with the Neon tip, checked for any bubbles in
the tip (bubbles can make a spark in the tube which causes more dead cells).
The tip was placed into the station on the machine.
19. 19
7. The reaction was started and observed for any sparks (If there were any, the
cells were discarded and refilled from the tube).
8. The treated cells were inserted to a 24 well plates filled with pre-warmed
RPMI +10 % FBS +1% Glutamax with no antibiotics and incubated at 37 ˚C.
9. Each tip can be used almost 8 times; however, the efficiency of the
transfection decreases by using the same tip for a couple of times. For each
different sample the tip should be changed.
10. The following day conditioned RPMI media (filtered RPMI medium taken from
confluent HL-60 cells that has natural growth factor) was added to the cells.
Checking for any edition:
After getting the sufficient number of cells (which may take up to a month), the
transfected cells were checked for any edition and compared to WT (wild type)
HL-60 cells. Some methods were used to confirm the final result.
1. Flow Cytometry: WT and FUT7 KO cells (knocked out) can be observed on
Flow Cytometry by adding the proper antibodies and lectins to them. Both the
edited cells (FUT7 KO) and the mixed culture of cells (WT + FUT7 KO) can be
screened on flow cytometry, which helps to test if there is any edition in the early
stages. In these studies, HECA, CD11b, CD15, CSLEX (CD15s) antibodies and
VVA and PHA-L and MAL-II lectins were used. More details about them can be
found in the tables below. Two distinct populations on the flow cytometry should
be observed for the mixed culture.
20. 20
Antibody Clone Host/ isotype
Anti-Human/Mouse Cutaneous
Lymphocyte Antigen (CLA) eFluor® 660
HECA-
452
Rat IgM
Purified Mouse Anti-Human CD15s CSLEX1 Mouse IgM,
PE Mouse Anti-Human CD11b D12
Mouse BALB/c
IgG2a, κ
FITC Mouse Anti-Human CD15 HI98 Mouse IgM, κ
Lectin Preferred Sugar Specificity
VVA (Vicia villosa) GalNAc
PHA-L (Phaseolu svulgaris Leucoagglutinin) Galβ4GlcNAcβ6(GlcNAcβ2Manα3)Manα3
MaL-II (Maackia amurensis II) Neu5Acα3Galβ4GalNAc
For each cell line, 12 tubes were prepared with 105
cells in each, spun down for
20 s at max speed, and resuspended in HEPES + 0.1% HSA + 1.5 mM Ca2+
. The
tubes were kept on ice. Primary antibodies were added to the cells and gently
mixed with pipette. The tubes were incubated on ice for 20 min. The cells were
washed with 500 µL HEPES and again resuspended in 20 µL of HEPES + 0.1%
HSA + 1.5 mM Ca2
buffer. The secondary antibodies and lectins were inserted to
the cells and mixed. On ice, there were incubated for another 20 min. 100 µL
HEPES buffer was added to each tube and vortexed before inserting the tube on
the Flow Cytometry machine. The samples are
21. 21
Sample number First 20 min Second 20 min
1. - -
2. - HECA
3. - isotype IgM
4. - CD11b
5. - Isotype PE IgG
6. - CD15
7. CSLEX (CD15s) Rabbit α Mouse IgG
8. - Rabbit α Mouse IgG
9. - VVA
10. - PHA-L
11. MaL II α Biotin FITC
12. - α Biotin FITC
2. Surveyor Assay: 106
edited cells and 106
WT cells were counted and
centrifuged for 5 min at 300×g, then washed once with PBS and resuspended in
250 µl PBS. Followed the protocol to isolate the genomic DNA from the cells by
using the PureLink® Genomic DNA Mini Kit from Invitrogen.
Preheat the water bath at 55 ˚C.
Add 20 µL proteinase K.
Add 20 µL RNaseA (mix well and incubate at RT for two min).
Add 200 µL PureLink genomic lysis/binding Buffer.
Incubate 10 min at 55 ˚C.
Add 200 µL of 96-100% ethanol and wait for 5 min.
Add the lysate to the spin column.
22. 22
Centrifuge at 10,000×g for one min .
Discard the column and put new collection column.
Add 500 µL of Wash Buffer 1.
Centrifuge at max speed for one min and discard the column, add new
ones.
Add 500 µL of Wash Buffer 2.
Centrifuge at max speed for 3 min.
Place micro-centrifuge tube and add 100 µL of PureLink Genomic Elution.
Buffer and wait for one min.
Centrifuge for one min at max speed.
Take the column out and store the DNA.
DNA from Minipreps was loaded on the 1% agarose gel, cut at the right size
band and got the desired DNA using purification kit.
These conditions were used as mentioned below to PCR amplify the gene of
interest for the WT and edited cells.
1 µL desired DNA
0.25 µL forward primer
0.25 µL reverse primer
25 µL Phusion® High-Fidelity PCR Master Mix with HF Buffer
1.5 µL master mix buffer
22 µL Water
23. 23
Temperature 98 ˚C 98 ˚C Primers Annealing T (65 ˚C) 72 ˚C 72 ˚C 12 ˚C
Time 3 min 10 s 30 s 35 s 5 min
Cool
Down
× 30
The product was loaded on agarose gel to check for the nice clean band with the
expected right size and cut and gel purified.
For the mixed culture, 16 µL of DNA was used, then added 2 µL of ThermoPol
PCR Buffer and run the PCR with these settings,
Temperature 95 ˚C 72 ˚C 42 ˚C 25 ˚C 4 ˚C
Time 2 min 2 min 2 min 2 min Cool down
The surveyor mixture was made as
16 µL of Annealed PCR product
2 µL MgCl2
1 µL Surveyor Enhancer
1 µL Surveyor Nuclease
The same mixture was prepared using the WT annealed product as a control.
Incubated the samples for one hour in thermal cycler at 42 ˚C. The surveyor
products were inserted on 1% agarose gel. Screened the band using ImageJ if
necessary to check for any mutation. Two bands were expected to be screened
for mixed culture sample (if there is any edition) and one clear band for WT.
3. Sequencing. The most accurate method to account for any deletion or edition in
the DNA is sequencing the DNA. The genomic DNA was isolated from the pellet
of edited cells (around 5×106
cells) using the PureLink® Genomic DNA Mini Kit
24. 24
from Invitrogen, amplified the required region with the designed forward and
reversed primers with these settings on the thermal cycler:
1 µL desired DNA
0.25 µL forward primer
0.25 µL reverse primer
25 µL Phusion® High-Fidelity PCR Master Mix with HF Buffer
1.5 µL master mix buffer
22 µL Water
Temperature 98 ˚C 98 ˚C Primers Annealing T (65 ˚C) 72 ˚C 72 ˚C 12 ˚C
Time 3 min 10 s 30 s 35 s 5 min
Cool
Down
× 30
The products were inserted on the 1% agarose gel and cut at the right size band
on UV screen, purified with the QIAquick Gel Extraction Kit from QIAGEN.
Set up the ligation reaction as:
1 µL of DNA
1 µL pLKO.1 Hinc II
1 µL 10X ligase buffer
1 µL ligase
6 µL water
The ligation solution was incubated at RT overnight. The following day, on ice, 3
µL of the ligation reaction was inserted to 100 µL Stbl3 competent cells and
incubated 20-30 min on ice. In water bath, a heat shock at 42 ˚C was applied to
the cells for 45 s and incubated on ice for 5 more min. 1 mL of LB (no antibiotic)
was added to the tube and incubated on shaker at 37˚C for one hour. The tube
25. 25
was centrifuged for 20 s at the max speed. The supernatant was discarded and
the pellet was resuspended in 100 µL of LB. The cells were cultured evenly on
carbenicillin agar plates overnight at 37 ˚C. The next day, 8-16 colonies were
selected and grown in separate tubes containing 3-5 mL LB + carbenicillin and at
37 ˚C overnight. The following day, the tubes were spun down at 4000×g to get
the bacteria pellet. The Wizard® Plus SV Minipreps DNA Purification System
was used in order to isolate the plasmid DNA from E-coli.
The plasmid was digested using the condition below overnight at 37 ˚C:
10 µL DNA
0.5 µL SpeI restriction enzyme
0.5 µL BamHI restriction enzyme
2.5 µL CutSmart® Buffer
11.5 µL water
10 µL of the digestion product was loaded on 1% agarose gel and checked for
the two bands at the right sizes. The vector was dropped down 200 bp and insert
was around 1200 bp. 10 µL of the DNA (concentration of 200 µg/ml) was sent to
Roswell Park for sequencing with 20 µL of pKL0.1 primer. The sequence result
was analyzed with the original DNA sequence from UCSC genomic browser to
check for any mutation by using the BLAST browser.
All the results indicated that the desired edition had been placed on the right
location, which was a mixed culture. The next step was to separate KO cells from
WT. To obtain this goal, an apparatus at the Roswell Park was used, which
separates the cells based on the screening level using the flow cytometry data.
One single cell was selected based on the setting provided (based on the HECA
level as FUT7KO cells show lower HECA level). The singlet was grown in
26. 26
conditioned RPMI medium. By having the enough number of cells, all the steps
for checking for the sequencing (Flow Cytometry, Surveyor Assay, and
Sequencing) were done again to check the final results. The same procedures
with the same conditions were used; the only difference was for the surveyor
experiment. 8 µL DNA of the edited cell and 8 µL of the WT and PCR amplified
were mixed together and used instead of 16 µL of DNA from mixed culture. All
the results confirmed that the edition has been inserted at the required region.
Flow Chamber Experiment: As mentioned before, one of the critical steps in
leukocytes adhesion is binding the neutrophils from blood flow and rolling of the cells on
the surface of endothelial cells mediated by three members of selectins family. In this
experiment, the same model was constructed in vitro to characterize the natural action in
vivo and quantified the number of rolling and binding cells under the same conditions of
shear flow. This technique also made possible a scientific comparison between the WT
and FUT7 KO cells using the same experimental conditions. The designed PDMS
(polydimethylsiloxane) microfluidic flow cell (600 μm width х 100 μm height х 1 cm
length) was used to make a laminar flow on the surface of a 60 mm dish. At one end of
the chip cells were inserted through the chamber and the other end was connected to
the glass syringe. A pump was connected to the piston of the syringe to make a steady
flow in the chamber with constant speed. The speed was adjustable by the pump. Two
ports of the vacuum were fastening the chamber on the surface of the dish without any
leakage. The apparatus was mounted on a Zeiss AxioObserver microscope. On the
bottom surface of each 60 mm dish, a 1 cm × 1 cm square was drawn to mark the
coating area. The dishes were coated with P-Selectin, human E-Selectin, mouse E-
Selectin, or HUVEC (Human umbilical vein endothelial cells) monolayer. Four repeats
were done for each set of conditions. For each experiment, the concentration was 4×106
27. 27
cells/mL with the flow rate of 5.2 µL/min, 600 images have been taken every 0.5 s up to
5 min. Cells were counted by Coulter Counter using these settings:
Cell type Settings to be put in the upper/lower size (µm) Gain Current
HL-60 6/18 16 0.25
The shear rate was calculated as below
𝜏 𝑤𝑎𝑙𝑙 =
6𝜇𝑄
𝑤ℎ2
wall (Shear Stress): ? (Dyn/cm2)
μ (Dynamic Viscosity): 9×10-4 Pa or 9×10-3 dyn. s/cm2 (approx. @25C)
Q (flow rate): 5.2 µL/min =0.087×10-3 cm3/s
w (width): 600 µm =0.06 cm
h (height): 100 µm = 0.01 cm
1N = 1 kg.m/s2
=105
dyn
wall =
(6)×(9×10−3)×(0.087×10−3)
(0.06)×(0.01)2
≅ 0.8 dyn/cm2
𝛾̇ 𝑥=
𝜏 𝑤𝑎𝑙𝑙
𝜇
γ̇x: Shear Rate (/s)
𝛾̇ 𝑥=
0.08
9×10−3
≅ 8.89 /s
1. P-Selectin: The experiments were designed to study the roll of P-selectin
concentration in number of rolling and adherent cells on WT and FUT7
KO cells. The box was coated by recombinant human (NS0-derived) P-
Selectin/Fc Chimera. On different dishes, 5 µl of P-selectin with three
different concentrations of 12.5, 25, and 50 µg/mL P-selectin were
28. 28
inserted. A wet twisted Precision Wipe was placed near the wall of dish to
avoid the P-selectin from drying out, incubated overnight at 4 ˚C. The next
day, the plates were blocked for one hour with PBS + 3% BSA (Bovine
serum albumin) before starting the experiment. The main path of flow
chamber was placed on the middle drawn box coated so that the cells
could flow on the P-selectin surface. The microscope captured images
with focus inside the square (20X magnification was used). Four runs
were done for each case.
As a control, cells were run on flow chamber with no coating on the surface
of 60 mm dish.
2. Human E-Selectin: On the surface of the drawn box, 30 µL of AffiniPure
f (ab’)2 fragment Goat Anti-Human IgG (H+L) (minimal cross-reaction to
Bovine, Horse, and Mouse Serum Proteins) was added with the
concentration of 1.3 µg/ mL and incubated overnight at 4 ˚C. The
following day, the base coating layer was dried with air. A wet kimwipe
was wrapped around the wall, then 5 µL of 5 µg/mL of rhE-selectin/ Fc
Chimera (recombinant Human NS0-derived) was applied on the marked
area and incubated at RT for four hours. The dish was blocked by adding
4-5 mL of PBS + 3% BSA for one hour at RT. The same set up was used
as discussed for P-selectin experiment.
For control experiment, an experiment was run on the surface of 60 mm
dish with Goat Anti-Human IgG coating and no E-Selectin.
29. 29
3. Mouse E-Selectin: The same steps were followed as Human E-selectin;
just 5 µL of 5 µg/mL of recombinant mouse E-selectin was added instead
of human E-Selectin.
The same negative control as Human E-selectin was applied.
4. HUVEC Monolayer: HUVEC endothelial cells were cultured on a 60 mm
dishes using EBM-2 (Endothelial Cell Growth Medium). When the plates
reached to a confluent monolayer, the endothelial cells were activated by
using 10 units/mL of human IL1-β and placed in 37 ˚C incubator for 3-5
hours. The chamber was placed on the monolayer without pressing and
steady flow was passed along the chamber and images were captured as
mentioned before.
The same experiment on the surface with no cells can also be used as
negative control experiment.
Transmigration Experiment: This test was designed to study the number of cells
migrating through the endothelial cells monolayer. The endothelial cells were cultured on
60 mm dishes with appropriate medium (for HUVEC, EBM-2 and for b-END3 cell DMEM
(Dulbecco's Modified Eagle Medium) + 10% FBS + 1% AA + 1% Glutamax were used).
Low passages of HUVEC (up to passage 5) showed better results than high passages.
The experiment should be done on the confluent but not over confluent monolayer. For
this experiment, differentiated HL-60 and differentiated FUT7 KO cells were used. To
differentiate, the cells were cultured in 1.3 % sterile DMSO in IMDM for 5 days. The
concentrations of the cells were kept between 1-5×106
cells/mL for the 5-day period. On
30. 30
the fifth day, the fresh medium was replaced and 10-20 units/mL of IL1-β was injected to
the medium and incubated in 37 ˚C. The plates can be used between 3-5 hours after
activation. The differentiated WT and FUT7 KO cells were centrifuged and resuspended
in sterile HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) + 0.1 % HSA
(Human serum albumin) buffer. The cells were counted using Coulter Counter with these
settings on the machine:
Cell type Settings to be put in the upper/lower size (µm) Gain Current
HL-60 6/18 16 0.25
Right before starting the experiment, the medium in the dish was aspirated and replaced
by 4 mL of HEPES + 0.1 % HSA + 1.5 mM Ca+2
. 1×106
cells were inserted into the dish.
As for microscope settings, 40X magnification was used and the images were captured
every 5 s for 30 minutes after adding the cells to the plate.
As a control for the cells, I isolated human neutrophils taken from blood
using the protocol below and added the neutrophils to activate endothelial
cells using the same condition.
1. In two15 mL, 4 mL of sterile Monopoly with 5% Endotoxin Free water
(200 µL) tubes was added and mixed.
2. A syringe with 20 units/mL heparin (for 10 mL of blood 200 units
required) was prepared and 10 mL blood from a donator was taken.
3. 5 mL of the blood with heparin was inserted slowly on each of 15 mL
tubes (Should avoid any mixing).
4. The tubes were centrifuged at 2000×rpm for 25 min at 25 ˚C with
acceleration on 8 and deceleration on 2. There should be a white clear
31. 31
band (third band from top and third from bottom). If the band was not
clear, centrifuge for 10 more minutes.
5. 30 mL of HEPES + 0.1 % HSA in 50 mL tube was prepared at RT and
by using 3 mL syringe, the PMN band was taken in the syringe and
transferred to buffer.
6. The tube was centrifuged for 10 min at 200×g, the supernatant was
taken out. The pellet was resuspended in HEPES + 0.1 % HSA buffer.
7. The neutrophils were counted using Coulter Counter with these settings
Cell type Settings to be put in the upper/lower size (µm) Gain Current
PMN 3/7 128 0.5
33. 33
Gene Editing:
As mentioned before, the designed cell line was tested with some methods to ensure the
edition at the right sequence is inserted
I. Flow Cytometry: The early experiment was to screen the cells on the flow
cytometry with the selected antibodies and lectins. On Figure 1, the changes in
the antibodies are shown for HL-60 cells and FUT7 KO cells. To have more
accurate results, some samples were prepared for isotype controls, the
secondary antibodies or FITC conjugates binding to the cells to quantify the non-
specific bindings. These amounts were deducted from the original samples and
the data is reported in Table1. Accordingly, for differentiated cells, Figure2. and
Table2. illustrate the antibodies level from flow cytometry for dWT and dKO cells.
Figure3. and Table3. are related to Lectins for WT and KO cells.
34. 34
Figure1.
Table1.
0
50
100
150
200
250
300
MeanFluorescence
Intensity(MFI)
Antibodies Level Flow Cytometry Experiment on HL-60 and FUT7 KO Cells
WT FUT7 KO
*
*
WT KO no Antibody
HECA, IgM isotype deducted 37.85 3.97333 2.0533
CD15 30.29 20.8566 3.86
CSLEX, secondary antibody (Rabbit α Mouse)
deducted
189.11 31.6533 3.86
CD11b, IgG isotype deducted 123.74 131.14 2.6133
Number of repeats: 4
35. 35
Figure2.
Table2.
HECA antibody is a marker of sialyl-Lewis X (SLex). In this experiment, IgM
was used as an isotype control for HECA as the negative control to identify
the non-specific binding. As can be concluded from Table1. (the antibodies
0
200
400
600
800
1000
1200
1400
MeanFluorescence
Intensity(MFI)
Antibodies Level Flow Cytometry Experiment on differentiated HL-60 and
FUT7 KO Cells
WT ave FUT7 KO ave
*
*
dWT dKO No Antibody
HECA, IgM isotype deducted 95.45 3.76 1.81
CD15 6.82 7.355 2.24
CSLEX, secondary antibody (Rabbit α Mouse) deducted 160.335 7.3 2.24
CD11b, IgG isotype deducted 896.56 802.35 1.66
Number of repeats: 3
36. 36
level from flow cytometry without the background for undifferentiated cells),
the HECA level in the FUT7 KO cells is more than nine times lower than HL-
60 cells, showing the significant change in the antibody binding regarding the
edition to the cells and the level is close to the WT cells with no HECA, which
indicated no sLex or Lex on the surface of mutated cells. Also differentiated
HL-60 and FUT7 KO cells were tested on day 5 (treated with IMDM+ 1.3%
DMSO for 5 days) with the same amount of antibodies. In Table2. (Antibodies
level from flow cytometry without the background for differentiated cells) and
also Figure 2. the same trend can be observed. Differentiated mutated cells
showed a dramatic decrease in the slex camping to the differentiated HL-60.
This number is too close to the background cells (no HECA binds to the WT
cells), which brings us to the conclusion that the slex is completely deleted
from the cell surface of the both differentiated and non-differentiated KO cells.
Also the t-test was performed to show the significant change in the HECA
level.
CD15 was another antibody applied to identify Lewis X on the neutrophils,
which plays an important role in cell adhesion and cell migration. Data from
Figure1. and Table1. showed that for both cell lines, the level of this antibody
did not change dramatically and stayed constant. On the other side, these
numbers were quite similar for the both differentiated cell lines. The results
presented the same quantity of Lewis X on the WT and KO cells; in other
words, the edition did not affect Lewis X level on the surface of the cells.
CSLEX or CD15s was used to recognize the sLex structure on the cells like
HECA. The numerical data from the flow cytometry illustrated the extensive
37. 37
reduction in slex by the deletion of FUT7 gene from the cells. The same
conclusion can be made for the differentiated cells from Figure2. and Table 2.
Also the close comparison between KO cells and the background suggested
that there were almost no CSLEX bindings to KO cells. T-test also conformed
the significant change in the CSLEX level.
The differentiation of the cells with DMSO develops new cells that have the
same properties as neutrophils. CD11b is a marker for the leukocytes and is
expressed on the surface of these cells, which can be used to test their
differentiation. From Table 1. and Table 2., it is seen that the level of CD11b
in the differentiated cells both for WT and KO cells (after 5 days in 1.3 %
DMSO) is much higher - more than six times - than the undifferentiated ones,
which indicated that the differentiated cells have a higher expression of
CD11b. This resulted in the same behavior of differentiated cells with
neutrophils, which can lead to using the differentiated cells instead of
neutrophils for further experiments. Also the T-test for both showed the same
results.
38. 38
Figure3.
Table3.
0
500
1000
1500
2000
2500
VVA PHA-L MALII/ anti
Biotin FITC
Anti Biotin
FITC
MeanFluorescence
Intensity(MFI)
Lectins Level Flow Cytometry Experiment on HL-60 and FUT7
KO Cells
WT FUT7 KO
Lectins WT KO No Lectin
VVA 23.88667 20.40333 3.86
PHA-L 873.1467 924.8633 3.86
MALII, Anti Biotin FITC deducted 1254.4 1466.153 3.86
39. 39
II. Surveyor Assay: The kit is designed to detect any mutation in the cells. The
Surveyor Nuclease recognizes and detects any single nucleotide polymorphisms
(SNPs) or small insertions or deletions and cleaves to make a new product. The
number of mismatches can be determined by the number of cleavage products.
DNA with 200-4000 bp size can be observed by agarose gels. In Figure4., the
Surveyor PCR products on the agarose gel demonstrates a mutation in the KO
cells comparing to HL-60 cells.
Figure4.
40. 40
III. Sequencing: All the samples which showed mutation in both flow cytometry
and surveyor assay were sent to Roswell Park for the sequencing to be checked.
The outcomes demonstrated the deletion in the gene sequence at the desired
region.
HL-60 FUT7 KO Clone 1
Target Sequence PAM (Antisense)
GCAGCGGGCGATGCCGTAGC GGG
Sequences Sent: 2 Sequences Returned
WT 1290 5' – GCCCAGCGACACCTGCACCCGCTACGGCATCGCCCGCTGCCACCTGAGT - 3' 1340
KO 1300 5' – GCCCAGCGA-------------------------------CACCTGAGT - 3' 1340 2
41. 41
Flow Chamber:
Many research studies on cells can be done by microfluidic chips such as shear stress
and shear rate. In this project, the goal was to make a steady state flow among the
chamber and shear stress of 0.8 dyne/cm2
and examine the influence of FUT7 gene on
the cell adhesion and rolling.
I. P- Selectin: As mentioned in the materials and methods chapter, three
different concentrations of human P-selectin were used to optimize the
number of cell adhesion and cell rolling. In Figure5. , solid fill bars (black for
WT and white for KO cells) show the number of rolling cells, and diagonal
dash line fill bars present the adherent cells.
Figure5.
In Figure6., the number of rolling cells can be analyzed due to concentration of
P-Selectin. For both WT and mutated cells, the highest number of rolling cells are
12.5 ng/ml 25 ng/ml 50 ng/ml
0
10
20
30
40
50
60
70
80
90
100
Concentration of P-selectin
#ofCells
P-Selectin Flow Chamber Experiment
Adherent FUT7 KO
Rollling FUT7 KO
Adherent WT
Rolling WT
No P-selectin
Number of repeats: 4
42. 42
counted at 25 µg/ mL. This concentration is the optimized concentration for using
the P-selectin rolling assay.
Figure6.
Figure7.
0
5
10
15
20
25
12.5 ng/ml 25 ng/ml 50 ng/ml
#ofcells
Concentration
Effect of P-Selectin Concentration on Number of Rolling
Cells Rolling WT
Rollling FUT7
KO
0
10
20
30
40
50
60
12.5 ng/ml 25 ng/ml 50 ng/ml
#ofcells
Concentration
Effect of P-Selectin Concentration on Number of Adherent
Cells
Adherent WT
Adherent FUT7 KO
43. 43
Also for all the concentrations, FUT7KO cells showed almost equal or more
cell rolling than the normal HL-60 cells. The diagonal dash line bars in
Figure5. are marked for the adherent cells. The analysis in Figure7.
demonstrates almost no cell binding for FUT7 KO cells. On the other hand,
the cells tend to bind on the surface more by increasing the P-selectin
concentration.
For the negative control, the cells were run on the 60 mm dishes with no
coating. Neither of the cell types rolls or binds to the surface.
The rolling speed of the cells was calculated by measuring the displacement
of each cell over time. All the speeds were put into histogram plots for all
three concentrations and two cell lines in Figure8. The flow velocity was 5.2
µL/min which is equal to 312 µL/s.
44. 44
Figure8.
The average rolling speed of KO cells on P-selectin is much higher than HL-
60 cells, regardless of the concentration shown in Figure9. Moreover, the
45. 45
average rolling speed decreases slightly with higher concentration of P-
Selectin, which is a common result of more cell interaction with P-Selectin.
Figure9.
In a few words, all the analysis showed that a equal number of HL-60 cells
interact with P-selectin surface and captured from dynamic flow comparing to
the mutated cells. The wild type HL-60 cells, however bound more firmly and
had slower rolling speeds; however, KO cells did not attach hard to P-selectin
and crossed the chamber faster.
II. Human and Mouse E-Selectin: The number of rolling and adherent
cells for both cell lines were quantified and compared in human and mouse
0
10
20
30
40
50
60
70
80
12.5 25 50
Averagespeed
Concentration µg/mL
Effect of P-Selectin Concentration on Average Rolling
Speed
WT FUT7
46. 46
E- Selectin. The concentration of 5 µg/ mL was used for the sets. In
Figure10.,the rolling and adherent cells on human E-selectin are shown.
Figure10.
A larger number of rolling cells were observed in KO cells than WT cells;
however, no FUT7 KO cells stuck to the E-selectin coating. Additionally, the
rolling speed histogram in Figure11. demonstrated the difference in the rolling
speeds of these two cell types.
0
5
10
15
20
25
30
35
40
WT FUT7KO
#ofCells
E-Selectin Flow Chamber Experiment
No E-selectin
Adherent
Rolling
Number of repeats : 4
47. 47
Figure11.
The average rolling speed of FUT7 KO cells were about four times more than
the WT one. (Average speed is 2.2 µm/sec for WT, and 9.6 µm/sec for KO).
Overall, the mutated cells interacted less with the E-selectin in terms of the
amounts of adherent cells at a certain period the time. However residual cell
adhesion was observed, consistent with the observations of Buffone et al.
who suggest a role of FUT9 in mediating E-selectin dependent leukocyte
adhesion[16].
Another experiment was designed with mouse E-selectin to study the
different effects of E-selectin produced by human and mouse on the same
cell types. The majority of the cells bound firmly to the mouse E-selectin
surface and less rolling cells were detected, as can be seen in Figure12.
48. 48
Figure11.
After all, FUT7 KO cells rolled more than WT cells, despite the fact that the
number of HL-60 adherent cells was almost twice the number of KO cells.
From Figue10. and Figure11. it can be simply concluded that mouse E-
selectin can bind human E-selectin ligands on HL-60s. There was more cell
adhesion in these studies perhaps due to the higher density of E-selectin on
these substrates; however, all the experiments on either of E-selectins again
confirm that the FUT7 KO cells have lower capability to communicate with E-
selectin.
0
5
10
15
20
25
30
35
40
45
50
WT FUT7 KO
#ofCells
Flow Chamber Experiment with Mouse E-Selectin Adherent
Rolling
Number of repeats: 3
49. 49
III. HUVEC Monolayer: Activated HUVEC secretes E-Selectin, which
mediates cells rolling on the endothelial monolayer. The rolling and adherent
cells were counted on the HUVEC monolayer and the results are presented
in Figure12
Figure12.
The same trend for adherent cells like E-selectin was obtained for HUVEC
monolayer. A larger number of cells adhered to monolayer in WT cells than
KO cells. The only difference from the E-selectin experiment was that no KO
rolling cells were presented on the HUVEC monolayer in the test.
0
5
10
15
20
25
WT FUT7 KO
# of Cells
Flow Chamber Experiment on HUVEC Monolayer
No HUVEC Adherent Rolling
Number of repeats:
50. 50
Transmigration:
The HL-60 and FUT7 KO cells were differentiated with 1.3 % DMSO for 5 days.
On the fifth day, the cells were screened on the flow cytometry. The results were
shown in Figure2. and Table2., which illustrate low HECA and CSLEX level in the
mutated cells and also the CD11b is higher in the differentiated cells comparing
to non-differentiated cells. As mentioned previously, CD11b is a marker for
neutrophils cells, which ensures that the cells have been differentiated. By
adding IL1-β to HUVEC, the endothelial expresses E-selectin protein after 3-4
hours. Differentiated cells attached to endothelium by E-selectin interaction and
changed their structure. All the reaction led a number of cells to migrate between
two or more neighboring cells. In the static experiment, the number of
transmigrated cells were counted and reported as the percentage of
transmigrated cell per all the cells observed near monolayer in Figure13. . The
results showed a decrease in the number of transmigrated cells in the edited
cells and the normal HL-60 cells, which again demonstrates the importance of
FUT7 in Leukocyte rolling and extravasation.
53. 53
Sialyl - Lewis X has a key role in leukocyte rolling and adhesion, as the structure can be found
in PSGL-1 and ESL-1 in Leukocytes. PSGL-1 binds to P-selectin and PSGL-1 and ESL-1 bind
to E-selectin during inflammation. FUT7 gene is involved in the production of sialyl-Lewis X. By
deleting this gene, low expression of sialyl-Lewis X was expected on the surface of the cells,
which leads to less cell adhesion and cell rolling. Edited cells were obtained by using
CRISPR/Cas9 technique to knockout the FUT7 gene in HL-60 cells. Low level of HECA-452 and
CSLEX, mutation band from surveyor method and finally the sequencing results all confirmed
the deletion of gene at the right location, which allowed further experiments to study the role of
this gene in slow rolling, firm adhesion and transmigration. The microfluidic experiments on
human P-selectin showed higher rolling velocity and fewer amounts of adherent cells for FUT7
KO, which illustrated less interaction of the cells with P-selectin and weak cell binding
comparing to WT cells. On the other side, the higher rolling speed of KO cells corresponds to
less tight binding. The same results were gained for both human or mouse E-selectin tests.
Additionally, a lower percentage of cells were transmigrated into the activated endothelial
monolayer comparing to HL-60 cells. In conclusion, FUT7 gene seems to have a critical role in
the leukocyte adhesion and extravasation.
For future studies, cells adhesion and rolling can be tested with different amounts of shear rate.
Also the effect of FUT7 gene can be tested in mouse neutrophils and compare the importance
of this gene in humans to mice. For this manner, the experiments can be performed using
mouse selectins and mouse endothelial cells such as bEND3 cells.
54. 54
REFERENCES:
1. Ley, K., et al., Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nat
Rev Immunol, 2007. 7(9): p. 678-89.
2. Zhang, J.M. and J. An, Cytokines, inflammation, and pain. Int Anesthesiol Clin, 2007. 45(2): p. 27-
37.
3. Lodish H, B.A., Zipursky SL, et al, in Molecular Cell Biology. 2000: New York.
4. Kunkel, E.J. and K. Ley, Distinct phenotype of E-selectin-deficient mice. E-selectin is required for
slow leukocyte rolling in vivo. Circ Res, 1996. 79(6): p. 1196-204.
5. Takano, M., et al., Rapid upregulation of endothelial P-selectin expression via reactive oxygen
species generation. Am J Physiol Heart Circ Physiol, 2002. 283(5): p. H2054-61.
6. Panes, J., M. Perry, and D.N. Granger, Leukocyte-endothelial cell adhesion: avenues for
therapeutic intervention. Br J Pharmacol, 1999. 126(3): p. 537-50.
7. Moore, K.L., Structure and function of P-selectin glycoprotein ligand-1. Leuk Lymphoma, 1998.
29(1-2): p. 1-15.
8. Hidalgo, A., et al., Complete identification of E-selectin ligands on neutrophils reveals distinct
functions of PSGL-1, ESL-1, and CD44. Immunity, 2007. 26(4): p. 477-89.
9. Granger DN, S.E., eukocyte–Endothelial Cell Adhesion, in Inflammation and the Microcirculation.
2010, an Rafael (CA): Morgan & Claypool Life Sciences;.
10. Leeuwenberg, J.F., et al., E-selectin and intercellular adhesion molecule-1 are released by
activated human endothelial cells in vitro. Immunology, 1992. 77(4): p. 543-9.
11. Fundamentals of Inflammation, ed. P.A.W. Charles N. Serhan, Derek W. Gilroy.
12. Phillipson, M., et al., Intraluminal crawling of neutrophils to emigration sites: a molecularly
distinct process from adhesion in the recruitment cascade. J Exp Med, 2006. 203(12): p. 2569-75.
55. 55
13. Muller, W.A., Mechanisms of leukocyte transendothelial migration. Annu Rev Pathol, 2011. 6: p.
323-44.
14. Munro, J.M., et al., Expression of sialyl-Lewis X, an E-selectin ligand, in inflammation, immune
processes, and lymphoid tissues. Am J Pathol, 1992. 141(6): p. 1397-408.
15. Kannagi, R., et al., Carbohydrate-mediated cell adhesion in cancer metastasis and angiogenesis.
Cancer Sci, 2004. 95(5): p. 377-84.
16. Buffone, A., Jr., et al., Silencing alpha1,3-fucosyltransferases in human leukocytes reveals a role
for FUT9 enzyme during E-selectin-mediated cell adhesion. J Biol Chem, 2013. 288(3): p. 1620-33.
17. Mondal, N., A. Buffone, Jr., and S. Neelamegham, Distinct glycosyltransferases synthesize E-
selectin ligands in human vs. mouse leukocytes. Cell Adh Migr, 2013. 7(3): p. 288-92.
18. Birnie, G.D., The HL60 cell line: a model system for studying human myeloid cell differentiation.
Br J Cancer Suppl, 1988. 9: p. 41-5.
19. Shalem, O., et al., Genome-scale CRISPR-Cas9 knockout screening in human cells. Science, 2014.
343(6166): p. 84-7.
20. Wang, T., et al., Genetic screens in human cells using the CRISPR-Cas9 system. Science, 2014.
343(6166): p. 80-4.
21. Kummitha, C.M., et al., HECA-452 is a non-function blocking antibody for isolated sialyl Lewis x
adhesion to endothelial expressed E-selectin under flow conditions. J Immunol Methods, 2012.
384(1-2): p. 43-50.
22. Weirich, E., et al., Neutrophil CD11b expression as a diagnostic marker for early-onset neonatal
infection. J Pediatr, 1998. 132(3 Pt 1): p. 445-51.
