1. 1
Investigation of the Tudor domain
specificity of the DNA damage
response mediators
By Shane Browne
Nov, 2011
Supervisors:
Prof. Noel Lowndes, Dr. Muriel Grenon
Genome Stability Laboratory
Centre for Chromosome Biology
National University of Ireland

2. 2
Acknowledgements
Firstly, I would like to thank Prof. Noel Lowndes for the prestigious opportunity of working
in his lab, and also for entrusting me with my own project. I want to thank Dr. Muriel Grenon
for her invaluable assistance, & ultimately for guiding me through every task. Finally, I
would like to thank both Ramesh Kumar and Carla Manuela Castro Abreu for their selfless
generosity in helping me with my project, when it was very clear that they were extremely
busy themselves.

3. 3
Abstract
Numerous external factors contribute to DNA damage, including ionising radiation, mutagens
and oxidative metabolism. In order to cope with these stresses, a surveillance mechanism has
been developed by eukaryotic cells over evolutionary time to detect and respond to genomic
integrity. This mechanism is known as the DNA damage checkpoint and attenuates genomic
instability by increasing DNA repair, arresting the cell cycle, and activating a transcriptional
program associated with DNA repair. In multicellular organisms, cells which have sustained
irreparable damage undergo apoptosis.
A crucial step in the DDR signalling cascade is the recruitment of a mediator onto
chromatin at the site of DSBs. In S. cerevisiae, Rad9 is the mediator which is recruited by
binding to H3K79me via its Tudor domain. Similarly, in S. Pombe, Crb2 is recruited by
binding to H4K20me via its Tudor domain. Each aforementioned histone binding site in yeast
is species specific due to the presence of distinct histone methyltransferases, meaning that
H3K79me is not present in S. pombe and vice versa. However, it is unknown whether the
mediator 53BP1 in humans is recruited by binding to H3K79me, or H4K20me.
This aim of this experiment is to isolate S. cerevisiae candidates expressing a Rad9
protein which has its Tudor domain substituted with either the Tudor domain of 53BP1 or
Crb2. Then we will analyse the G1 checkpoint proficiency of these strains, to investigate the
specificity of the two Tudor domains. Our results indicate that the rad953BP1Tu strain cannot
activate the G1 checkpoint in response to IR, and we therefore conclude that the 53BP1
Tudor domain cannot bind H3K79me in vivo.
(Grenon, unpublished)
Fig. 1 Overview of the DNA Damage Response in Human, S. cerevisiae, S. pombe

4. 4
Table of Contents
Abstract....................................................................................................................................3
Table of Figures.......................................................................................................................5
Abbreviations...........................................................................................................................6
1. Introduction
1.1 Yeast as a model organism.......................................................................................7
1.2 DNA Damage Checkpoint in S. cerevisiae .............................................................7
1.3 Rad9 Protein.............................................................................................................9
1.4 Role of Histone marks in the DNA Damage Checkpoint........................................9
1.5 Preliminary Work...................................................................................................11
1.6 Aim of this project..................................................................................................12
2. Materials and Methods
2.1 Media Preparation..................................................................................................16
2.2 PCR and Gel Electrophoresis.................................................................................16
2.3 Preparation of gDNA.............................................................................................17
2.4 DNA Sequencing....................................................................................................17
2.5 Droptest Analysis...................................................................................................18
2.6 Western Blot Analyis.............................................................................................19
2.7 G1 Arrest and Release Checkpoint Experiment.....................................................20
3. Results
3.1 Screening of Candidates by PCR...........................................................................18
3.2 Western Blot Analysis of Positive Clones.............................................................19
3.3 Droptest Analysis of Positive Clones.....................................................................20
3.4 Analysis of G1 checkpoint proficiency in the positive candidates........................21
4. Discussion and Conclusion................................................................................................22
5. References...........................................................................................................................23

5. 5
Table of Figures
1. Overview of the DDR in Humans, S. cerevisiae, S. pombe..................................................3
2. DDR in S. cerevisiae..............................................................................................................8
3. Rad9 protein structure............................................................................................................9
4. Summary of recruitment pathway for DDR mediators........................................................11
5. Chimeric rad9s, Rad9 locus following insertion of plasmid...............................................11
6. The two possible outcomes from 5-FOA pop out................................................................12
7. Screening of positive candidates by PCR............................................................................18
8. Western Blot Analysis of Rad9 expression in the positive candidates................................19
9. Droptest Analysis of Positive Clones...................................................................................20
10. Analysis of G1 checkpoint proficiency in the positive candidates....................................21

6. 6
Abbreviations
ATM Ataxia-Telangiectasia Mutated
ATR Ataxia-Telangiectasia Mutated and Rad3 related
Bp Base pair
Brca1 Breast cancer type 1 susceptibility protein
Cdc Cell division cycle
Cdk Cyclin dependent kinase
Chk1 Checkpoint Kinase 1
Chk2 Checkpoint Kinase 2
dNTP Deoxyribonucleotides
DDR DNA Damage Response
DSB Double Strand Break
FHA Forkhead-Association
gDNA Genomic Deoxyribonucleic Acid
IR Ionizing Radiation
Mdc1 Mediator of DNA damage checkpoint protein 1
Mdm2 Murine Double Minute Protein Z
MRN Mre11-Rad50-Nbs1
PCNA Proliferating Cell Nuclear Antigen
PIKK Phosphatidyl-inositol-3OH kinase-like kinases
Rfc Replication factor C
RNR Ribonucleotide Reductase
RPA Replication Protein A
UV Ultraviolet radiation

7. 7
1.Introduction
1.1 Yeast as a model organism
Yeast cells are eukaryotic and their genome is comprised of 12 million bp, containing about
6,000 genes. Many of the human genes associated with disease have homologues in yeast,
which enables the yeast cells to be exploited to look at functional relationships involving
these genes, and also to investigate the effect of novel drugs. Yeast cells are ideal for use in
cell cycle and DNA damage checkpoint studies, largely due to the fact that they grow rapidly;
having a doubling time of 80 minutes, and also have high efficiency of homologous
recombination.
1.2 DDR in S. cerevisiae
In S. cerevisiae, Weinert and Hartwell showed that the DNA damage dependent cell cycle
arrest is induced by X-irradiation and it is genetically controlled. They subsequently
identified Rad9 as a gene essential for DNA damage induced arrest before mitosis (Weinert
and Hartwell 1988).
The first checkpoint proteins interacting with DSBs are the MRX complex; Mre11,
Rad50, and Xrs2. MRX is responsible for DNA resection; 5’ to 3’ exonuclease activity,
which leaves a region of 3’ ended ssDNA that is rapidly surrounded by the RPA heterotrimer
(Ivanov, Sugawara et al. 1994; Tsubouchi and Ogawa 1998; Nakada, Hirano et al. 2004).
Sae2 regulates the MRX via stimulation of the nuclease activity and its removal (Cao, Alani
et al. 1990). The PIKK Tel1 is recruited by MRX (Nakada, Matsumoto et al. 2003; Falck,
Coates et al. 2005), which can then phosphorylate histone H2A at serine 129 to create a
region of γH2A flanking the damage site (Rogakou, Boon et al. 1999). The primary role of
γH2A is chromatin remodeler recruitment, such as Ino80 and Rub1 to DSB (Bird, Yu et al.
2002). Rad24 in complex with Rfc2-5 binds at the ssDNA/dsDNA interface(Bermudez,
Lindsey-Boltz et al. 2003; Ellison and Stillman 2003; Majka and Burgers 2005) and loads the
9-1-1 clamp comprised of Rad17, Mec3, Ddc1, which is essential for checkpoint activation
(Paciotti, Clerici et al. 2000; Venclovas and Thelen 2000).
RPA-coated ssDNA recruits the Mec1-Ddc2 heterodimer, which initiates the
checkpoint cascade (Paciotti, Clerici et al. 2000; Rouse and Jackson 2000; Wakayama,
Kondo et al. 2001; Carr 2002; Sogo, Lopes et al. 2002; Zou and Elledge 2003). The mediator
protein Rad9 is then localised to DNA via interaction between H3K79me and its Tudor
domain (Grenon, Costelloe et al. 2007). Mec1 then phosphorylates Rad9, and Rad53 is
recruited via its FHA domains interacting with phosphorylated Rad9. Mec1 then
phosphorylates Rad53 (Sun, Hsiao et al. 1998; Durocher, Taylor et al. 2000). The complex of
Rad9 and phosphorylated Rad53 then dissociates from Mec1, and multimerizes to enable
further transphosphorylation and complete activation of Rad53 (Pellicioli and Foiani 2005;
Harrison and Haber 2006).

8. 8
There are numerous effectors of checkpoint pathway including Rad55, RNR, Pds1,
Cdc5. During normal cell growth, the yeast securin protein Pds1 is degraded prior to mitosis
entry, following ubiquitination by the anaphase promoting complex and its specificity factor
Cdc20 (Harrison and Haber 2006). Ensuing DNA damage however, Pds1 is stabilised by its
Mec1 induced hyperphosphorylation, which blocks its ubiquitination and culminates in the
prevention of mitosis (Cohen-Fix and Koshland 1997; Sanchez, Bachant et al. 1999;
Agarwal, Tang et al. 2002). Pds1 is also regulated by Rad52 which blocks the interaction
between Pds1 and Cdc20 (Agarwal, Tang et al. 2002) .The inhibitory partner of RNR, Sml1
is phosphorylated by Mec1 which allows RNR to catalyse the production of dNTPs and so
contribute to efficient DNA repair (Georgieva, Zhao et al. 2000). Dun1 kinase is also
associated regulation of RNR (Elledge, Zhou et al. 1993; Zhao, Chabes et al. 2001; Zhao and
Rothstein 2002). Mec1 induced phosphorylation of Rad55 stimulates homologous
recombination repair of DSBs. Rad53 phosphorylates Cdc5, which inhibits its normal role in
exiting mitosis (Harrison and Haber 2006).
In instances of irreparable DSBs, the cell cycle arrest for 12 hours and upregulates
DNA repair genes, prior to re-entering the cell cycle in a process known as adaptation (Lee,
Moore et al. 1998).
.
(Harrison and Haber 2006)
Fig.2 DDR in S. cerevisiae

9. 9
1.3 Rad 9 Protein
There are 4 regions of Rad9 associated with checkpoint function. The carboxy-terminal
BRCT domain is responsible for the interactions with γH2A (Soulier and Lowndes 1999).
The Tudor domain interacts with methylated histone H3 allowing Rad9 to dock onto the
chromatin (Grenon, Costelloe et al. 2007). The serine/threonine cluster domain is essential
for activation of Rad53 by Mec1 (Schwartz, Duong et al. 2002). The CAD domain is needed
for Chk1 activation (Blankley and Lydall 2004).
Fig.3 Rad9 protein structure (Grenon, unpublished)
1.4 Role of Histone marks in the DNA Damage Checkpoint
A recruitment pathway for DDR mediators has been identified which is conserved in the
three species relevant to my project; S. cerevisiae, S. pombe , and human. It is based on the
interaction between the mediators and methylated histone residues. In S. cerevisiae, the Rad9
protein binds via its Tudor domain to H3K79me to be recruited onto chromatin at the site of
the DSB. Similarly, both Crb2 in S. pombe and 53BP1 in human, bind to H4K20me via their
Tudor domains to be recruited onto the chromatin.
4 publications have contributed knowledge on this direct interaction in the DDR,
Huyen et al. (2004), and Sanders et al. (2004), Botuyen et al. (Botuyan, Lee et al. 2006),
Grenon et al. (2007).
Huyen et al. prepared fusion proteins containing GFP and residues 1220-1771 of the
53BP1 protein. They showed that mutations located at the interface of the 2 Tudor folds, e.g.
Asp1521Arg, compromised the localization of 53BP1 to DSBs, and thus concluded that this
region is the pivotal structural element for 53BP1 targeting to DSBs in vivo. Subsequently,
using 293T human carcinoma cells, Huyen et al. showed that irradiation of these cells didn’t
result in further methylation of H3K79 in vivo. The hypothesis that pre-existing, rather than
DNA damaged induced methylation explains the recruitment of 53BP1 was proposed. To
investigate this, U2OS osteosarcoma cells expressing GFP-fused 53BP1 residues were
exposed to a chromatin remodeler; mild hypotonic media. By monitoring the photobleaching
by GFP-53BP1’s nuclear diffusion, they could conclude that alterations in the structure of
chromatin are sufficient to recruit 53BP1 to pre-existing H3K79me. In summary, Huyen et al.

10. 10
showed that the Tudor domain of 53BP1 is the crucial region required for binding to
H3K79me in vivo.
Sanders et al. used a set9Δ strain to show that methylation of H4K20 is Set9
dependent. Using the same strain and DNA microarray analysis, they observed no significant
change in gene expression. From this they concluded that role of H4K20 is not one of
transcriptional regulation. Furthermore, by exposing G2 synchronised cells to IR and
monitoring the mitotic progression, they observed a ‘cut- like’ mitotic phenotype indicating
aberrant G2-M checkpoint response in both set9Δ and h4.2K20R cells. Thus they inferred that
Set9 and H4K20 are both prerequisites to maintain DNA damage checkpoint dependent cell
cycle arrest in fission yeast. Subsequently, they discovered that Set9 controls the recruitment
of Crb2 to DSBs. This was based on an experiment involving live imaging of GFP-tagged
Crb2 strains harbouring either set9Δ or set9+ exposed to IR. The observation was Crb2 foci
formation following IR was compromised in set9Δ cells, in comparison with normally
functioning set9+ cells. Sanders et al. states that the human counterpart of Crb2; 53BP1 binds
methylated H4K20, which directly contradicts the work of Huyen et al. They conclude by
suggesting that 53BP1 may interact with other histone modifications also. To summarise,
Sanders et al. showed that both H4K20me and the histone methyltransferase Set9 are crucial
for checkpoint activation in fission yeast, and stated that the human counterpart 53BP1 also
binds H4K20me in vivo.
Botuyen et al. showed that 53BP1 binds H4K20me2 in vivo which substantiated the
earlier work published by Sanders et al. Their work involved first examining the interaction
of 53BP1 with methylated histones in vitro using isothermal titration calorimetry. They
observed that 53BP1 preferentially binds H4K20me2 with a dissociation constant of 19.7
μM, which was two orders of magnitiude higher than that observed between 53BP1 and
H3K79me. This clearly indicated that H4K20me2 was the primary target by 53BP1 during
DSB repair. Then using HeLA cells which had the Dot1 gene downregulated, they showed
that this downregulation had no effect on the recruitment of 53BP1 to IR-induced DNA
DSBs. This suggested that H3K79me did not play an important role in this process, which
contradicted the work published by Huyen et al. Botuyen et al. then showed that H4K20
methylation was crucial to 53BP1 foci formation. This was done using HeLa cells which had
H4K20 methylation downregulated by siRNA knockdown of PR-Set7/Set8. The result
observed was significant impairment of 53BP1 foci formation following IR. Finally, using X-
ray crystallography and nuclear magnetic resonance, they showed that the preferential
binding of 53BP1 with H4K20me2 was due to a conserved five residue binding pocket in its
first Tudor domain, which optimally fits dimethylammonum. In summary, Botuyen et al.
showed that 53BP1 binds to H4K20me in vivo, and not H3K79me.
Grenon et al. showed that a Y798Q mutation of the Rad9 Tudor domain results in
reduced binding of these mutants to H3 in U2OS cells. This was based on 1) G1-arrested
rad9-7Y98Q mutants were defective for Rad53 and Rad9 phosphorylation, and 2) rad9-
7Y98Q mutants showed compromised delay in cell-cycle progression. This proves that the
Rad9 Tudor domain is responsible for the recruitment of Rad9 into damage dependent foci in
vivo. Furthermore, by exposing h4-K20A mutant cells to IR, they were able to conclude that

11. 11
H4K20 is not involved in checkpoint activation in budding yeast, since wild type levels of
Rad9 and Rad53 phosphorylation were observed. In conclusion, Grenon et al. showed that
the Tudor domain of Rad9 is the crucial region which binds H3K79me in budding yeast.
Fig.4 Mediator proteins of the DDR and their respective histone binding sites.
1.5 Preliminary Work
This work was done by and Kate Corrigan, Jennifer Fitzgerald and Andrew Seeber.
This involved constructing 3 chimeric rad9 genes, each with a different Tudor domain
encoding sequence. These were rad953BP1Tu, rad953BP1Tu-Y798Q, and rad9crb2Tu which were
subsequently inserted into an integrative vector with a URA3 marker. The plasmids were
linearised and inserted into S. cerevisiae via homologous recombination. Fig.5 illustrates the
Rad9 locus following this event, which contains a chimeric rad9 and an endogenous Rad9
along with a URA3 marker. These candidates were then grown on media lacking uracil for
selectivity.
A
•
Bindin
g sites
are
specie
s-
specifi
c in
yeast,
and
crucial
to
check
point
activat
ion.

12. 12
B
Fig.5 A) Chimeric rad9s constructed, B) Rad9 locus following insertion ofplasmid via
homologous recombination
The candidates are then transferred to 5-FOA media, where candidates containing URA3
cannot survive. Here, some candidates undergo another homologous recombination event.
There are 2 outcomes of this result depending on whether the homologous sequences
upstream or downstream of the Tudor domain are swapped. The undesired result is that the
URA3 along with the chimeric rad9 pops out, leaving the endogenous Rad9 in the genome.
The other result is the URA3 along with the endogenous Rad9 pops out, leaving the chimeric
rad9 in the genome. This event is illustrated in Fig.6
Fig.6 The two possible outcomes from 5-FOA pop out

13. 13
1.6 Aim of this projecet
The main objective for this project is to resolve the controversy in the literature concerning
the histone binding site of 53BP1 in vivo. This will be achieved as follows.
Firstly, positive candidates present on the 5-FOA plates will be identified for the
presence of a chimeric rad9 in their genome. Secondly, these candidates will be characterised
to investigate whether they are behaving like wildtype cells. Finally, the G1 checkpoint
proficiency of the mutant S. cerevisiae strains will be determined. If a particular strain can
activate the G1 checkpoint, then we will conclude that the particular Tudor domain can bind
H3K79me in vivo. Because the activity of Dot1 produces the crucial binding site H3K79me, a
dot1Δ strain was constructed. This was used as a negative control, due to the fact that without
this binding site, Rad9 is not recruited to DSBs and the G1 checkpoint cannot be activated.
Since S. cerevisiae lacks the methyl transferase to produce the binding site necessary
for Crb2 recruitment in S. pombe (H4K20me), the rad9crb2Tu mutant is expected to not be able
to initiate the checkpoint response. It is difficult to predict the outcome of the rad953BP1Tu
mutant, due to conflicting experiments published; it has been stated by Huyen et. al that
53BP1 binds H3K79me, while Sanders et. al say that 53BP1 binds H4K20me in vivo. Since
the rad953BP1Tu-Y798Q strain has a mutation which renders the Tudor domain inefficient, this
mutant is expected to not be able to initiate the G1 checkpoint.

14. 14
2. Materials and Methods
2.1 Media Preparation
YPD media is used for growing yeast. 10 g of agar is added to the media in order to produce
agar plates
Table 1 Reagents for yeast media preparation
2.2 PCR and 0.8% Agarose Gel Electrophoresis
Table 2 Reagents used for PCR
Each PCR reaction was comprised of the reagents in Table 2.
The PCR conditions were 30 cycles of the reaction displayed in Table 3.
Table 3 PCR condition used
Media Bactopeptone (g) Yeast Extract (g) Volume H20 (mL) 20% Glucose (mL) Final Volume (mL)
YPD 20 10 450 50 500
Media Adenine (mL) Histidine (mL) Leucine (mL) Tryptophan (mL) Glucose (mL) Uracil (mL) YNB (mL) H20 (mL) FOA (g)
5FOA 5 5 5 5 50 13 20 397 0.5
-Uracil 5 5 5 5 50 - 20 430 -
Reagent Volume (µL)
KOD Buffer 5
DNTPs (2mM) 5
MgSO4 (25mM) 4
DMSO 2.5
Primer 1 (10µM) 2.5
Primer 2 (10µM) 2.5
dH20 26.5
Kod Enzyme (250U) 1
DNA Template (100ng/µL) 1
Step Temperature (° C) Time (s)
Denaturation 94 30
Annealing 58 60
Elongation 68 40

15. 15
Table 4 PCR primers used
Gel Preparation
0.4 g of agarose was added to 50 mL of TAE buffer and this 0.8% solution was heated in a
microwave for 90 seconds at 900W. On cooling, 4 µL of ethidium bromide was added, and
the solution was then poured in the gel box containing the combs. After 40 minutes, the
combs are removed and the gel box is immersed in TAE buffer. 5 µL of 1 kb+ DNA ladder
was used as a reference in lane 1, and all other lanes were filled with 5 µL of sample plus 2
µL of 6x DNA loading dye. The anode and cathode were inserted into their respective
places, and the gel was left for 30 minutes at 110 V to separate the DNA based on size.
2.3 Preparation of genomic DNA
The cells were grown overnight in 5mL of YPD media, in the 30 °C incubator shaker. The
samples were then centrifuged for 3 minutes at 2500 rpm in their falcon tubes, and the
supernatant was discarded. The samples were resuspended in 1.5 mL eppendorf tubes using
lysis buffer 1. 2.5 µL of 20 mg/mL zymolyase was then added and the samples were
incubated at 37 °C for 1 hour to permeate the cell wall. The samples were centrifuged for 1
minute at maximum speed (14,800 rpm) to pellet the cell and supernatant was discarded. The
samples were resuspended in lysis buffer 2, before 10% SDS solution was added and then
subsequently incubated at 65 °C for 30 minutes. 200 µL of 5M KAc was then added to the
samples, which were then incubated on ice for 1 hour. The samples were centrifuged for 5
minutes at maximum speed, before the supernatant was transferred to a new eppendorf tube.
700 µL of isopropanol was added and the samples were left at room temperature for 5mins.
After this the samples were centrifuged for 1 minute at maximum speed to pellet the DNA,
and the pellet was air dried. The pellet was resuspended in 300 µL of deionised distilled
water before 3 µL of RNase was added to the samples, which were subsequently incubated at
37 °C for 30 minutes. The gDNA was precipitated by adding 50 µL of 10 M ammonium
acetate and 95% ethanol. The gDNA was frozen at -20 °C for 1 hour. After this the samples
were centrifuged for 10 minutes, the supernatant was removed, and then the pellet was
washed with 500 µL of 70% ethanol. The samples were centrifuged for 5 minutes, prior to
the removal of the supernatant , and then the pellet was air dried. Finally the samples were
resuspended in100 µL of deionised water, before being centrifuged for 5 minutes at
maximum speed, and then the supernatant was transferred to a fresh, labelled eppendorf tube.
Primer 5' to 3' sequence
84 TTTGTAGGGCTCCGTGTTGTAC
86 TCTTTTAAAAACCGTGTACTCGC
91 AATCAATTGTAACGTGTACTCGC
Rad9_Tudor_Diag CATTCTACTGGCCAGACAGAAGA

16. 16
2.4 DNA sequencing
Prior to sending the PCR products to AGOWA for sequencing, the DNA was purified. This
was done by adding 5 volumes of buffer PB (binds DNA) to 1 volume of the PCR sample.
The sample was added to a QIA quick column and centrifuged for 1 minute at maximum
speed. The flow through was discarded and the QIA quick column was replaced back onto
the same tube. Then, 0.75 mL of buffer PE (washes the DNA) was added to the column and
this was centrifuged again for 1 minute at maximum speed. The flow through was again
discarded and the QIA quick column was replaced back onto the same tube, before a third
centrifugation step for 1 minute at maximum speed. The QIA quick column was then placed
in a clean 1.5 mL eppendorf tube, and 50 µL of deionised water was added to elute the DNA.
Finally, the sample was centrifuged for 1 minute at maximum speed, and the tubes were then
labelled.
Table 5. Primers used for DNA sequencing of Rad9
2.5 Droptest Analysis
The candidate cells were grown on fresh YPD plates and left overnight in a 30 °C incubator.
Then a colony was picked from each candidate, added to 5 mL of YPD in a falcon tube (over
a Bunsen burner to avoid contamination) and left overnight in a shaker incubator at 135 rpm.
This producesd saturated cultures i.e. at a concentration of 2.5 x 107 cells per mL. After 1
day the cells are cut back to a concentration of 1.25 x 106 cells per mL, and left to grow for 4
hours in a 30 °C incubator shaker to get cultures at a concentration of 5 x 106 cells per mL. A
Beckman Coulter counter was used to determine the volume of dilutant to cut the cells back.
To do this, 20 µL of cells were added to 10 mL of isoton, sonicated at 20 % intensity for 3
seconds before using the counter. Using a 96 well plate, a 5 fold series dilution using saline is
performed. That is, 160 µL of saline is added to the wells in columns 2-6, and 40 µL is taken
from each of the 200 µL of cells in the wells in column 1 to perform the dilution. The
droptest fork is pre treated with ethanol and flamed, before being used to apply drops from
each well to the various media plates. The plates are left for 48 hours in a 30 °C incubator,
and the images of these plates are scanned at 24 hours and 48 hours.
Primer Sequence (5' to 3')
Rad 9 Seq 6 TTTCCCAAGGCATATCTGC
Rad 9 Seq 8 CGAAAGCAAAGGAGAGGAGC
Rad 9 Seq 10 GGATTCTAGAGACGCATTAGC
Rad 9 Seq 12 GGTAAATCTCAGATGAAGC
Rad 9 F CATGCACATATGTCAGGCCAGTTAGTTCAATGGAAAAGC

17. 17
2.6 Rad9 Western Blot
Extraction
Centrifuged the protein extracts (2.5 x 107 cells in falcon tubes) for 2 mins at 3000 rpm.
Removed the supernatant and resuspended in 1 mL of ddH2O and transferred to a clean,
labeled eppendorf. Centrifuged the eppendorfs for 1 minute at maximum speed on a tabletop
centrifuge. Resuspended in 100 L of ddH2O and add 100 L of 0.2 M NaOH. Left for 3
minutes at RT before centrifuging for 30 seconds and removing the supernatant. Added 50
L of SDS Lysis buffer and heated for 3 minutes at 95 C. Centrifuged for 3 minutes at
maximum speed and extract the supernatant to a fresh, labeled tube on dry ice.
Acylamide Gel Electrophoresis
The acrylamide gel container was checked for leakage initially by adding ddH2O and leaving
for 5 minutes. 0.75mm slides were used and a level marker was made about 2 cm below
where the combs are inserted to indicate the level of the running gel. Added the running gel
up to the marker and add a layer of isopropanol. Waited for 25 minutes for polymerization,
before the stacking gel was added and the combs were inserted. After a further 25 minutes,
the gels were transferred to a container applied to a power pack and 14 L of each sample
was added to the individual wells. The container was immersed in running buffer and applied
with 70 V until the bands passed through the stacking gel, before increasing the voltage to
120 V until the bands ran-off the gel.
Table 6 Reagents used to prepare the running and stacking gels
Running Gel Stacking Gel
Reagent Volume (mL) Reagent Volume (mL)
ddH20 4.58 ddH20 4.51
40% Acrylamide 1.712 40% Acrylamide 0.853
2% Bisacrylamide 0.426 2% Bisacrylamide 0.467
1MTris 8.7 pH 4 1MTris 6.8pH 0.835
10% APS 0.054 10% SDS 0.033
TEMED 0.015 10% APS 0.033
TEMED 0.013

18. 18
Transfer
Transferred the gel to a nitrocellulose membrane which was immersed in transfer buffer. The
order in the container was 1)White port, 2) Sponge, 3) Whatman paper, 4) Nitrocellulose
membrane, 5) Gel, 6)Whatman paper, 7) Sponge, 8) Black port. Surrounded the box with the
container, with ice to avoid melting of the gel, and left in a cold room at 70 V for 1 hour. On
removal, I washed with ponso and scanned the image
Table 7 Reagents used to prepare the running and stacking gels
Addition of Antibodies
Place the membrane in an empty container and add 30 mL of 0.5% milk in PBS, Tween and
NL05 antibody at a 1:10,000 dilution, before leaving overnight. Next morning, performed
three 15 minute washes with 50 mL of PBS,Tween. Added PBS, Tween with 1:6,000 dilution
of conjugating enzyme and left for 50 minutes. After, I performed three 15 minute washes. 1
mL of both ECLs were added to the nitrocellulose membrane, prior to its exposure to
medicinal film in the dark room
2.7 G1 arrest and release checkpoint experiment
The cells were grown to a concentration of 5x106 cell/mL, before alpha factor at a
concentration of 5µg/mLwas added. The cultures were left to grow for 1 doubling time,
before being exposed to 400 Gy. The cultures were then washed with saline, YPD,
resuspended in YPD, before adding alpha factor again. Samples were taken at 3 stages;
Asynchronous cells, G1, and ’15 minutes (following IR). These consisted of 2.5x107 cells in
a falcon tube for western blot analysis.
Running Buffer Transfer Buffer
Reagent Volume (mL) Reagent Volume (mL)
10X TGC 200 10X TGC 200
10%SDS 20 10%SDS 10
ddH20 1,780 ddH20 1,390
Methanol 400

19. 19
3.Results
3.1 Screening of Candidates by PCR and Agarose gel Electrophoresis
Detection of the candidates containing a chimeric rad9 was done via PCR. Therefore 3 pairs
of primers were designed, with each being specific to a distinct Tudor domain.18 candidates
in both the wildtype and dot1Δ background were screened and we aimed to detect three
candidates expressing each chimeric Rad9 protein, in both backgrounds.
A
B
C
Fig.7 A) Reference table illustrating primer specificity, B) Screening results in wildtype
background, C) Screening results in dot1Δ background

20. 20
In Fig.7 B, Lanes 2 and 3 contain wild type. Only lane 2 contains a PCR fragment, which
indicates that wildtype only contains the endogenous Rad9 gene in its genome.
Lanes 4-9 contain clones from the three different parental strains. The presence of
PCR fragments in all 6 lanes indicate that our parental strains have both an endogenous Rad9
and a chimeric rad9 in their genome.
Lanes 10-19 contain five candidates taken from the parental clones that were placed
onto 5FOA. The presence of PCR fragments only when either the B or C set of primers were
used indicate that these candidates only contain a chimeric rad9 in their genomes.
In Fig.7 C, Lanes 2 and 3 contain dot1Δ. The presence of a band only in lane 2
indicates that dot1Δ only contains the endogenous Rad9 gene in its genome.
Lanes 4-9 contain clones from 2 parental strain. The presence of PCR fragments in all
6 lanes indicate that our parental strains have both an endogenous Rad9 and a chimeric rad9
in their genome.
Lanes 10-17 contain four candidates taken from the parental clones that were placed
onto 5FOA plates. The presence of PCR fragments only when either the B or C set of primers
were used indicate that these candidates only contain a chimeric rad9 in their genomes.
In essence, 2 candidates expressing each chimeric Rad9 were found in both
backgrounds, except for the dot1Δ rad953BP1Tu-Y798Q strain.
3.2 Western Blot Analysis of Rad9 expression in the positive candidates
A western blot was performed on protein extracts taken from the positive candidates to
ensure they were expressing full length Rad9 proteins. To summarise, we observed that only
the rad953BP1Tustrains in both backgrounds were expressing a full length Rad9.
The Rad9 protein was present in three positive controls; wildtype, dot1Δ, and
rad9Y798Q, and was not present in the negative control Rad9Δ. The Rad9 protein was only
present in the rad953BP1Tu strain in the wildtype background, and not in the rad953BP1Tu-Y798Q,
rad9crb2Tu strains. Similarly, the Rad9 protein was only present in the rad953BP1Tu strain in the
dot1Δ background, and not in the rad9crb2Tu strain.
From the DNA sequencing results, we can attribute the absence of Rad9 in the
rad953BP1Tu-Y798Q candidates to a deletion in their coding region, resulting in truncated Rad9
expression.
Fig.8 Western Blot Analysis of Rad9 expression in the positive candidates

21. 21
3.3 Droptest Analysis of Positive Clones
A droptest was undertaken on the positive candidates to determine whether they were
behaving normally in terms of phenotype, when compared with their respective controls. The
candidates were placed on glycerol media to investigate respiration, on -Uracil media to
ensure that the URA3 marker had been removed, and on YPD which was subsequently
exposed to UV to investigate the response to UV damage.
We first tested wildtype background, where the rad9Crb2Tu strain is clearly sensitive to
UV damage in comparison with the control; wildtype. The rad953BP1Tu 1.1 clone is resistant to
UV damage, and behaves like the control. Paradoxically, the rad953BP1Tu 1.2 clone produced
from the same parental strain actually sensitive to UV in comparison. The rad953BP1Tu-Y798Q
strain is sensitive to UV damage.
With respect to the dot1Δ background, the rad953BP1Tu strain is resistant to UV
damage and behaves like the control; dot1Δ. The rad9crb2Tu 1.2 clone is sensitive to UV
damage, while the rad9crb2Tu 3.1 clone is UV resistant.
In summary, the rad953BP1Tu strain in both backgrounds were behaving like the control
in terms of phenotype, which makes them eligible for use in a G1 arrest and release
experiment.
Fig.9 Droptest Analysis of the Positive Candidates

22. 22
3.4 Analysis of G1 checkpoint proficiency in the positive candidates
A G1 arrest and release experiment was undertaken to analyse the G1 checkpoint proficiency
of the rad953BP1Tustrain. Rad9 and Rad53 were tested for in protein extracts taken at three
stages; 1) Asynchronous (lanes 1-6), 2) G1 arrested (lanes 7-12), and 3) 15 minutes after IR
exposure (lanes 13-18). By investigating whether the phosphorylated forms of Rad9 and
Rad53 are present in irradiated cells (which act as markers for Checkpoint activation), we can
determine the G1 checkpoint proficiency of the strains.
The 6 samples taken at the Asynchronous stage all contain hypo-phosphorylated
forms of Rad9 and Rad53. Similarly the 6 samples taken at the G1 arrested stage all contain
hypo-phosphorylated forms of Rad9 and Rad53, indicating that the G1 Checkpoint has not
been activated.
The irradiated wildtype cells have activated the G1 checkpoint, which is clearly
indicated by presence of hyper phosphorylated Rad53. The irradiated dot1cells did not
activate the G1 checkpoint, which is indicated by the presence of hypo phosphorylated
Rad53. This is due to the due to the dot1strain lacking the crucial histone binding site
H3K79me, which is needed for Rad9 recruitment onto the chromatin.
Since hypo phosphorylated Rad53 is observed in the irradiated rad953BP1Tu
candidates, we see that the G1 checkpoint has not been activated. Thus we can conclude that
the 53BP1 Tudor domain cannot bind to H3K79me in vivo.
It is important to highlight that had hyper phosphorylated Rad53 been observed in the
irradiated rad953BP1Tu candidates, we could only experimentally conclude that the Rad953BP1Tu
protein binds H3K79me to activate the G1 checkpoint in vivo, by comparing this with its
respective negative control; dot1Δ 3.1/3.2 rad953BP1Tu.
Fig.10 Western Blot analysis of protein extracts taken during the G1 arrest and release
experiment

23. 23
4. Conclusion and Discussion
Having created S. cerevisiae cells expressing chimeric Rad9s, we investigated their G1
checkpoint proficiency following IR. Our results show that the rad953BP1Tu strain cannot
activate the G1 checkpoint in response to IR. Therefore we can conclude that the 53BP1
Tudor domain cannot bind H3K79me in vivo.
Further work should be undertaken to determine whether the rad9crb2Tu strain can
activate the G1 checkpoint in response to IR. The expected result would be that G1
checkpoint would not be activated, as H3K79me is not present in S. pombe.
Another potential experiment, would be to insert the set9 gene into the S. cerevisiae
genome, which would produce the H4K20me binding site in this strain. Then, the G1 arrest
and release experiment could be performed again to see if the rad953BP1Tu strain can activate
the G1 checkpoint by binding to H4K20me. This could substantiate the work of Sanders et.
Al, who claims that 53BP1 binds to H4K20me in vivo.
The inverse of this experiment could also be performed; determining whether S.
pombe cells expressing Crb2rad9Tu , and Crb253BP1Tu cancause Crb2 foci formation in
response to IR.

24. 24
5.References
Agarwal,R.,Z. Tang, etal. (2002). "The role of Pds1 phosphorylationinthe DNA damage induced
checkpointarrest." MolecularBiologyof the Cell 13:1579.
Bermudez,V.P.,L.A. Lindsey-Boltz,etal.(2003)."Loadingof the human9-1-1 checkpointcomplex
ontoDNA bythe checkpointclamploaderhRad17-replicationfactorCcomplex invitro."
Proceedingsof the National Academyof Sciencesof the UnitedStatesof America100(4):
1633-1638.
Bird,A. W.,D. Y. Yu,et al. (2002). "Acetylationof histoneH4by Esa1 isrequiredforDNA double-
strand breakrepair." Nature 419(6905): 411-415.
Blankley,R.T.and D. Lydall (2004). "A domainof Rad9 specificallyrequiredforactivationof Chk1in
buddingyeast." Journal of Cell Science 117(4):601-608.
Botuyan,M. V.,J. Lee,etal. (2006). "Structural basisfor the methylationstate-specificrecognitionof
histone H4-K20 by53BP1 andCrb2 inDNA repair." Cell 127(7): 1361-1373.
Cao, L.,E. Alani,etal.(1990). "A PATHWAYFOR GENERATION ANDPROCESSINGOFDOUBLE-STRAND
BREAKSDURING MEIOTIC RECOMBINATION IN SACCHAROMYCES-CEREVISIAE."Cell 61(6):
1089-1101.
Carr, A. M. (2002). "DNA structure dependentcheckpointsasregulatorsof DNA repair." DNA Repair
1(12): 983-994.
Cohen-Fix,O.andD. Koshland(1997)."The anaphase inhibitorof Saccharomycescerevisiae Pds1pis
a target of the DNA damage checkpointpathway."Proceedingsof the National Academyof
Sciencesof the UnitedStatesof America 94(26): 14361-14366.
Durocher,D., I.A. Taylor,etal. (2000). "The molecularbasisof FHA Domain: Phosphopeptide
bindingspecificityandimplicationsforphospho-dependentsignalingmechanisms."
MolecularCell 6(5):1169-1182.
Elledge,S.J.,Z.Zhou,et al.(1993). "DNA-DAMAGEANDCELL-CYCLE REGULATION OF
RIBONUCLEOTIDEREDUCTASE." Bioessays 15(5):333-339.
Ellison,V.andB. Stillman(2003)."Biochemical characterizationof DNA damage checkpoint
complexes:Clamploaderandclampcomplexeswithspecificityfor5' recessedDNA." Plos
Biology 1(2):231-243.
Falck,J.,J. Coates,etal. (2005). "Conservedmodesof recruitmentof ATM,ATR and DNA-PKcsto
sitesof DNA damage."Nature 434(7033): 605-611.
Georgieva,B.,X.Zhao,et al.(2000). "Damage response anddNTPregulation:The interaction
betweenribonucleotide reductase anditsinhibitor,Sml1." ColdSpringHarborSymposiaon
Quantitative Biology 65:343-346.
Grenon,M., T. Costelloe,etal.(2007). "Dockingontochromatinvia the Saccharomycescerevisiae
Rad9 Tudor domain." Yeast24(2): 105-119.
Harrison,J. C.and J. E. Haber (2006). "Survivingthe breakup:The DNA damage checkpoint." Annual
Reviewof Genetics 40:209-235.
Ivanov,E. L.,N. Sugawara,et al.(1994). "MUTATIONSIN XRS2 ANDRAD50 DELAY BUT DO NOT
PREVENTMATING-TYPE SWITCHINGIN SACCHAROMYCES-CEREVISIAE."Molecularand
CellularBiology 14(5):3414-3425.
Lee,S. E.,J. K. Moore,et al.(1998). "SaccharomycesKu70, Mre11/Rad50, andRPA proteinsregulate
adaptationtoG2/M arrestafterDNA damage." Cell 94(3):399-409.
Majka, J.and P. M. Burgers (2005). "Functionof Rad17/Mec3/Ddc1 and itspartial complexesinthe
DNA damage checkpoint." DNA Repair4(10):1189-1194.
Nakada,D., Y. Hirano,etal. (2004). "Requirementof the Mre11 complex andexonuclease1for
activationof the Mec1 signalingpathway." MolecularandCellularBiology 24(22):10016-
10025.

25. 25
Nakada,D., K.Matsumoto,et al.(2003). "ATM-relatedTel1associateswithdouble-strandbreaks
throughan Xrs2-dependentmechanism." Genes&Development 17(16): 1957-1962.
Paciotti,V.,M. Clerici,etal.(2000). "The checkpointproteinDdc2,functionallyrelatedtoS.pombe
Rad26, interactswith Mec1 and isregulatedbyMec1-dependentphosphorylationin
buddingyeast." Genes&Development 14(16): 2046-2059.
Pellicioli,A.andM. Foiani (2005). "Signal transduction:How Rad53 kinase isactivated." Current
Biology 15(18): R769-R771.
Rogakou,E. P.,C. Boon,et al. (1999). "Megabase chromatindomainsinvolvedinDNA double-strand
breaksinvivo." Journal of Cell Biology 146(5):905-915.
Rouse,J.and S. P.Jackson(2000). "LCD1: an essentialgene involvedincheckpointcontrol and
regulationof the MEC1 signallingpathwayinSaccharomycescerevisiae." EmboJournal
19(21): 5801-5812.
Sanchez,Y.,J. Bachant, etal. (1999). "Control of the DNA damage checkpointbyChk1and Rad53
proteinkinasesthroughdistinctmechanisms." Science 286(5442): 1166-1171.
Schwartz,M. F.,J. K.Duong,et al.(2002). "Rad9 phosphorylationsitescoupleRad53to the
SaccharomycescerevisiaeDNA damage checkpoint."MolecularCell 9(5):1055-1065.
Sogo,J. M., M. Lopes,etal.(2002). "Forkreversal andssDNA accumulationatstalledreplication
forksowingto checkpointdefects." Science 297(5581): 599-602.
Soulier,J.andN.F. Lowndes(1999). "The BRCT domainof the S-cerevisiae checkpointproteinRad9
mediatesaRad9-Rad9 interactionafterDNA damage." CurrentBiology 9(10):551-554.
Sun,Z. X.,J. Hsiao,et al.(1998). "Rad53 FHA domainassociatedwithphosphorylatedRad9inthe
DNA damage checkpoint." Science 281(5374): 272-274.
Tsubouchi,H.and H. Ogawa (1998). "A novel mre11mutationimpairsprocessingof double-strand
breaksof DNA duringbothmitosisandmeiosis." MolecularandCellularBiology 18(1):260-
268.
Venclovas,C.andM. P. Thelen(2000)."Structure-basedpredictionsof Rad1,Rad9, Hus1 andRad17
participationinslidingclampandclamp-loadingcomplexes."NucleicAcidsResearch 28(13):
2481-2493.
Wakayama,T., T. Kondo,etal. (2001). "Pie1,a proteininteractingwithMec1,controlscell growth
and checkpointresponsesinSaccharomycescerevisiae." MolecularandCellularBiology
21(3): 755-764.
Weinert,T.A.and L. H. Hartwell (1988)."THE RAD9 GENE CONTROLSTHE CELL-CYCLE RESPONSETO
DNA DAMAGE IN SACCHAROMYCES-CEREVISIAE."Science241(4863): 317-322.
Zhao,X. L., A.Chabes,etal. (2001). "The ribonucleotidereductase inhibitorSml1isa new target of
the Mec1/Rad53 kinase cascade duringgrowthand inresponse toDNA damage." Embo
Journal 20(13): 3544-3553.
Zhao,X. L. and R. Rothstein(2002). "The Dun1 checkpointkinase phosphorylatesandregulatesthe
ribonucleotide reductase inhibitorSmI1." Proceedingsof the NationalAcademyof Sciences
of the UnitedStatesof America 99(6): 3746-3751.
Zou,L. and S. J. Elledge (2003)."SensingDNA damage throughATRIPrecognitionof RPA-ssDNA
complexes."Science300(5625): 1542-1548.