1. Optimization of qPCR for Detection of PPO in Apples
Justin L. Woodard, Samuel P. Hayes, Ann Taylor
Department of Chemistry, Wabash College, 301 W. Wabash Ave, Crawfordsville, IN 47933
Procedure
Serial Dilution Procedure
In the end it was found that EF would act as the best control in detecting levels of PPO in apples and
tobacco in future experiments. The lowest C(t) of PPO during the temperature gradient trials was 24.59 at the
approximate temperature of 50.8° C, and for EF it was 25.17 at an approximate temperature of 56.3 °C. The
ideal range for comparison between these two primers is 52.0°C to 52.4°C. After optimizing the qPCR with the
primers the future goal is to examine how wounding apples and tobacco plants impacts PPO levels. In order to
test how PPO levels change a non-bruised and bruised DNA sample is taken from the apples. In the tobacco
plants DNA is extracted from a control, a sample bruised with tweezers, and another covered in salicylic acid.
In order reach these steps in showing how PPO levels change in apples and tobacco, the primers and qPCR
must be further optimized with the goal of an R2
value greater than 0.980.
Results and Future Work
http://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_5279.pdf
Guardo, M. (2013) A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in
Apple (Malus x domestica Borkh.), PLoS One. 8(10).
Schmidt, G. (2010) Stable Internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana
tabacum) during development and abiotic stress, Mol Genet Genomics. 283, 233-241.
References
15
17
19
21
23
25
27
29
31
33
35
48 50 52 54 56 58 60 62 64
C(t)
Temperature (°C)
PPO Temperature Optimization
Temperature gradient testing of PPO was in the range of 50OC-62OC. The lowest C(t) value was found to be 24.59
at 50.8OC.
The goal of this experiment was to find a way to measure concentrations of polyphenol oxidase
(PPO) in apples and apply this to a classroom setting alongside a case study of PPO. PPO is typically
pigmented clear, but when it reacts with oxygen the clear appearance is catalyzed and turned into a brown
pigmentation in plants. This is also true in apples and is the main cause of the browning of apples. Arctic
apples do not brown and were the source of inspiration for the case study and experiments.
In order to find the concentration of PPO in an apple RNA was isolated for reverse transcription,
and DNA was also isolated. Three control primers were tested for comparison with the primer meant to
replicate the PPO gene. The Actin primer was designed from Guardo’s paper, “A Multidisciplinary
Approach Providing New Insights into Fruit Flesh Browning Physiology in Apple” and very little success
was obtained with this primer. Next, GAPDH and EF control primers tested in order to find a replacement
for Actin. Both GAPDH and EF proved to be more effective controls than the Actin tested, but between
the two EF was more reliable. This conclusion was made due to more consistent serial dilution data.
The results were based on the C(t) value given by the CFX 96 Bio-Rad qPCR instrument. The
instrument assigned an arbitrary fluorescence value and the number of cycles required for a sample to
reach the fluorescence value was the C(t) value. For serial dilutions it was hypothesized that the more
concentrated samples would have a smaller C(t) value. This was proven true since having a higher
concentration would mean more DNA and reaching the fluorescence value would require less cycles.
Abstract
25
25.5
26
26.5
27
27.5
28
48 50 52 54 56 58 60 62C(t)
Temperature (°C)
EF Temperature Optimization
Temperature gradient testing of EF in the range of 50OC-60OC. The lowest C(t) value was found to be 25.17 at
56.3OC.
y = 3.2714x + 15.087
R² = 0.9504
0
5
10
15
20
25
30
35
40
0 1 2 3 4 5 6 7
C(t)
-log[Dilution]
PPO Serial Dilution
C(t) vs. the –log of the amount of dilution of DNA sample.
y = 1.0269x + 30.397
R² = 0.8903
15.00
20.00
25.00
30.00
35.00
40.00
0 2 4 6 8 10
C(t)
-log([C(t))]
EF Serial Dilution
C(t) vs. the –log of the amount of dilution of DNA sample.
Thanks to the Eli Lilly Summer Undergraduate Research Grant and the Haines Fund for the Study of Biochemistry
at Wabash College.
Acknowledgements
The temperature proved to play an important role in the amount of DNA that was able to be replicated. If
the temperature was far enough below the melting point the primer would anneal but not complete the extension
step. When the annealing and extension temperature was above the optimal value the primer would not anneal. In
both cases the amplification of DNA is stopped due to too a large enough temperature difference from the
primer’s melting point. The temperature gradient helped to discover the optimal temperature to run PPO in
conjunction with one of the other three tested control genes.
Optimizing qPCR
The C(t) value is the amount of cycles required for the amount of fluorescence detected to reach a
value assigned by the CFX 96 Bio-Rad qPCR instrument. In the figures below the y-axis is the number of
relative fluorescence units, which is a unit of measurement in detecting fluorescence. The x-axis is the number
of cycles that have occurred. The horizontal green line is the amount of fluorescence assigned by the qPCR
instrument. The C(t) value is determined when the fluorescence detected in a sample crosses that line. In a few
cases it was found to be possible that the amount of fluorescence in a sample would level out on the graph.
This occurred due to the concentration of DNA in the sample reaching a large enough value to where there was
not enough dye to bind to all the DNA in the solution.
A C(t) value allows for relative comparison of the amounts of DNA in different samples. A larger C(t)
value would imply beginning with a lower concentration of DNA while a smaller C(t) value would represent a
larger starting concentration of DNA. The same C(t) value between two samples would imply equal
concentrations between the two.
What is a C(t) value?
PCR is a method of DNA replication that uses three steps in order to accomplish replication.
The first step is denaturation, which splits the double stranded DNA into two single strands. Second, the
primer binds to the target site on the DNA strand, also called annealing. Third is extension, the primer
copies the desired sequence. The cycle then repeats for the desired amount of steps. A simple method of
cloning DNA, but one that does not allow for the determination of the starting amount of DNA in a
sample.
Quantitative Polymerase Chain Reaction, or qPCR, quantitatively allows for the determination of
the starting amount of DNA. It uses the similar protocol to that of PCR: denaturing annealing, and
extending the DNA and primer. After these steps occur there are now two identical double stranded pieces
of DNA. QPCR uses a fluorescent dye that attaches to double stranded DNA and is detected by a
fluorescence reader in the instrument. In order to optimize qPCR there are two tests that must be
performed. The first is to find the ideal temperature of each primer by running a temperature gradient.
Next, it must be proven that the starting amount of DNA alters the ending amount of DNA by running
serial dilutions. A temperature gradient and serial dilutions were performed in order to examine the
optimal conditions under which to perform qPCR with the following primers: PPO, Actin,
glyceraldehydes 3-phosphate dehydrogenase (GAPDH), and Elongation Factor 1α (EF).
PCR vs. qPCR
The serial dilution procedure is important because it validates optimization and the quantitative nature
of the primers. The PPO, Actin, GAPDH, and EF primers were all tested to prove they had been optimized and
could act quantitatively. In order to do this eight samples were prepared, each with a decreasing concentration
of DNA. The DNA samples used for testing of the PPO and Actin primers were taken from golden delicious
apples, and the GAPDH and EF primers were tested with tobacco of the nicotiana benthamiana species. If the
primers were quantitative then it was hypothesized that as the concentration of DNA in each sample decreased
the C(t) value would increase. In an optimized qPCR procedure the graph of log of dilution amount would be
linear or near linear. Once optimization of qPCR was validated, it is possible to compare the C(t) values of
known concentrations of DNA to unknown concentrations. The goal of optimization is when graphing to get
the R2
value to be greater than 0.980. This goal was unable to be achieved with the R2
values of PPO and EF
being 0.9504 and 0.8903 respectively. This was most likely due to possible pipeting error during the creation
of the master mix. If the amount of dilution of each sample was slightly different than believed, this would
create error that would cause the R2
value to be less than ideal.
Bruise one side of
an apple
Extract RNA from
apple
Perform DNase
treatment on RNA
Perform Reverse
Transcription
Perform qPCR on
cDNA
Store RNA in -80oC
and DNA in -20oC
Bruise one side
of an apple
Extract gDNA
from apple
Prepare primers
for use
Perform qPCR
on gDNA
Store gDNA
samples in -20oC
C(t) vs. Relative Fluorescence Units graph of PPO temperature gradient
C(t) vs. Relative Fluorescence Units graph of PPO serial dilution
PPO
CCTACTCACAAAGCCCAAGCGTTCCTTGGGACGTGAGGTCTCATGCAACGCCACAAACAATGACA
ATTTGATCAAGCACAGTCCAAACTAGACAGGAGAAATGTGCTTCTTGGICTIGGAGG
EF
AACCTTGACTGGTACAAGGGCCCAACCCTTCTTGAGGCTCTTGACCAGATTAATGAGCCCAAGAG
GCCCTCAGACAA