As a frontier biotech service provider, Creative Biolabs provides superior recombinant lentivirus products for our clients all over the world. https://www.creative-biolabs.com/gene-therapy/category-recombinant-lentivirus-306.htm

1. shRNA Lentivirus (self-inactivating), pU6-(DDX3X-shRNA-Seq1)
Cat. No.: LV-SI0001WQ
For Research Use Only. Do NOT use in humans or animals.
PRODUCT INFORMATION
ProductOverview This product is a DDX3X-shRNA encoding Lentivirus, which is based on HIV-1 serotype.
The protein encoded by DDX3X has ATP-dependent RNA helicase activity and display a
high level of RNA-independent ATPase activity. Misregulation of this gene has been
implicated in tumorigenesis and alternative splicing results in multiple transcript variants.
The expression of DDX3X-shRNA leads to target gene silencing and this product can be
used in gene therapy research and development.
SPECIFICATIONS
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DDX3X-shRNA-Seq1
RelatedTarget/Protein DDX3X
Region 3UTR
TargetSeq CCCTGCCAAACAAGCTAATAT
NCBIRefSeq NM_001356
AlternativeNames DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102
Titer >1*10^10 GC/mL
SUITE 203, 17 Ramsey Road, Shirley, NY 11967, USA Email: info@creative-biolabs.com
Tel: 1-631-466-5530 Fax: 1-631-207-8356 © Creative Biolabs All Rights Reserved
Page 1 of 2

2. RelatedDiseases X-linked recessive inheritance
GENE INFORMATION
Fullname DEAD-box helicase 3 X-linked
TargetIntroduction The protein encoded by this gene is a member of the large DEAD-box protein family, that
is defined by the presence of the conserved Asp-Glu-Ala-Asp (DEAD) motif, and has
ATP-dependent RNA helicase activity. This protein has been reported to display a high
level of RNA-independent ATPase activity, and unlike most DEAD-box helicases, the
ATPase activity is thought to be stimulated by both RNA and DNA. This protein has
multiple conserved domains and is thought to play roles in both the nucleus and
cytoplasm. Nuclear roles include transcriptional regulation, mRNP assembly, pre-mRNA
splicing, and mRNA export. In the cytoplasm, this protein is thought to be involved in
translation, cellular signaling, and viral replication. Misregulation of this gene has been
implicated in tumorigenesis. This gene has a paralog located in the nonrecombining
region of the Y chromosome. Pseudogenes sharing similarity to both this gene and the
DDX3Y paralog are found on chromosome 4 and the X chromosome. Alternative splicing
results in multiple transcript variants.
SUITE 203, 17 Ramsey Road, Shirley, NY 11967, USA Email: info@creative-biolabs.com
Tel: 1-631-466-5530 Fax: 1-631-207-8356 © Creative Biolabs All Rights Reserved
Page 2 of 2