Diagnosis of fungi

1. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Diagnosis of fungi conventionally and partially and recording by Genbank and genetic tree Prof. Dr. Ban Taha Mohammed College of Education for pure Sciences University of Kerbala Dr. Adnan A. Lahuf Plant Protection Dep.- Agriculture Col. University of Kerbala

2. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq

74. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Molecular identification of Fungi (Part 1) Dr. Adnan A. Lahuf Plant Protection Dep.- Agriculture Co. University of Kerbala

75. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Restriction Fragment length Polymorphism (RFLPs) • DNA digested with restriction enzymes • Fragments electrophoretically separated • DNA transferred to solid support • Hybridised using complementary DNA probe • Autoradiogarphy, visualisation of polymorph Disadvantages •Large quantities of DNA required •Slow and laborious

76. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq The advent of PCR  A wide range of new approaches to detect variation  User friendly  Amenable to automation  Allow large numbers to be genotyped  Scale useful to different aspects of biological researchers

77. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Common PCR methods for detecting variation  Randomly Amplified Polymorphic DNA (RAPDs)  Simple Sequence Repeats (SSRs)  Amplified Length Fragment Polymorphism (AFLPs) Direct sequencing discovery

78. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Random Amplified Polymorphic DNA (RAPDs) • Overview • RAPD analysis is a variant of standard PCR in which a short single primer (10bp in length) of arbitrary or random nucleotide sequences are used to amplify DNA segments. • Individual primers operate in both forward and reverse directions, amplifying between inverted repeats • Around 5 to 20 products • Polymorphisms are due to base changes in the primer sites and length variations between sites ******* Insertion Deletion 10bp random primer Individual 1 Individual 2 a b c ******* a d e Ind 1 Ind 2 a b c d e • Technical

79. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Amplified Fragment length Polymorphism (AFLPs) • AFLPs combines the power of RFLP with the flexibility of PCR-based technology by ligating primer-recognition sequence (adaptors) to the restricted DNA and selective PCR amplifications of restriction fragments using a limited set of primers. • Step 1. Genomic DNA digested with a pair of restriction enzymes which digest double stranded DNA to produce (Eco-Mse) • Step 2. Double stranded Eco and Mse adapters are ligated to restriction fragments. • Step 3. Pre-selective amplification, a subset of fragments are amplified, using primers complementary to adapter sequence with the addition of one nucleotide (Eco+A and Mse+C) • Step 4. The number of fragments further reduced by Selective amplification in which primers have an additional two

80. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Simple Sequence Repeats (SSRs) or microsatellites • Short tandem repeats of 2 to 6 bp • Generally these are mono-, di-, tri or tetra –nucleotides (e.g. [A]n, [CA]n, [AGC]n, [GACA]n) • Polymorphisms arise from errors during the replication of DNA or from unequal crossing-over( mispairing at repeats during normal replication) • Length variations are a b c d

81. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Direct sequencing discovery

82. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Polymerase Chain Reaction (PCR)

83. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Components of PCR reaction 1) The DNA template 2) DNA polymerase enzyme (Taq polymerase) 3) Pair of Primers 4) The four different deoxyribonucleotide triphosphates (dNTPs) Adenine (A), Guanine (G), Cytosine (C), Thymine (T). 5) Reaction buffer with Mg2+

84. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq PCR Products

85. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Molecular identification of Fungi (Part 2) Dr. Adnan A. Lahuf Plant Protection Dep.- Agriculture Col. University of Kerbala

86. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq DNA seq. data >180906-R03_I01_LSA_ITS1.ab1 NNNNNNGGTTCCAATGAGGCCTCTGGGTCACCTCC CACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCC CGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCC CCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAA CGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCG TAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTT CCGGCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCATAATTCAGTGAATCATCGAGTC TTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGG GCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCA CGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGG GGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTC CGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCT GTAGGCCCGGCCGGCGCCAGCCNNNNNNNNNNNNN NNNNNNN Chromatogram sequence

87. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Bioedite Program

88. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Global Alignment • Compares total length of genetic marker sequences with global sequence data. • By aligning query sequence against all sequences in a database, alignment can be used to search database for similar sequences • The most common bioinformatics software tool applied to conduct this type of alignment is Basic Local Alignment Search Tool (BLAST)

89. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq What is BLAST? Free, online service from National Center for Biotechnology Information (NCBI) http://blast.ncbi.nlm.nih.gov/Blast.cgi

96. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Phylogenetic analysis  Phylogeny term defined as the study of evolutionary relatedness among various taxa, species and populations

97. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq Molecular Evolutionary Genetic Analysis (MEGA)

104. Prof. Dr. Ban Taha Mohammed Dr. Adnan A. Lahuf https://uokerbala.edu.iq How to submit your sequence to GenBank database of NCBI

Diagnosis of fungi

Recommended

Recommended

More Related Content

Similar to Diagnosis of fungi

Similar to Diagnosis of fungi (20)

Recently uploaded

Recently uploaded (20)

Diagnosis of fungi