SlideShare a Scribd company logo
1 of 22
Dmitry Schigel
Virve Viertiö
University of Helsinki
On the wings of bark beetles:
Ips typographus and fungal arrival
to spruce trees in Finland
Outline
• Project: colonization gates
• GBIF.org and databases
• Student projects & Ips story
• Teaching dead wood in 2016
Dmitry Schigel: 2012-2015
Academy of Finland
Colonization gates and establishment
of wood-decaying fungi in European Spruce
In Southern Finland
Metsäkulma, Mäntsälä
Rörstrand, Sipoo
X =
2014 Basel -> GBIF
GBIF.org
Note new e-mail address: dschigel@gbif.org
GBIF BY THE NUMBERS
652,948,064
species occurrence
records
15,882
datasets
804
data-publishing
institutions
• http://www.gbif.org | 01 APR 2016
 O1 spatial and temporal aspects TIME
early colonization events SPACE
 O2 role of Coleoptera as vectors BEETLE
of wood-decaying fungi colonizing living trees
GBIF <- DATA
Colonization gates
Colonization gates: BEETLES & STUDENTS
Maria Faticov, MSc
University of Helsinki
fungivory and host use
Virve Viertiö,
University of Helsinki
MSc project on fungal
dispersal by insects
9
Colonization
of a new
resource
Fungal arrival to trees
• spores and mycelia
• Going thourgh defence
mechanisms of a tree
Animal vectors
Pheromone traps
• emptied once a
week all
summer
• beetles to zip-
lock bags and to
the freezer
• traps washed
with soap water
• catch 2013: total
73 000 beetles
10
Pics: D. Schigel
Air control
• to separate fungi
from the air only vs.
the trap catch
= air + beetles
• Eppendorfs with
fungal spores vs.
greywater from the
beetle washing
11
Pics: Virve Viertiö
>sample1
TTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATACAATTCGGTCGGCGGGAAGGAGGGGGAG
CTGTCGCTGGCCTTGTGGCATGTGCACGCTCTCTTTGGAACGTCGGTCGTCTTTCATATTTTCACCAGTG
CACCCAATGTAGGATGCCTCTCCTCCGGGAGGGGGGACCTATGTCTTTTTCAGACGCCCCCACAGTTTA
>sample2
GAAAGTCTCAGAATGTTTACTATCGTCGAACCATGACTTCCAGGAGACGTGGGTCGGCGAGATAAAAG
TTATCACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATG
TAATGTGAATTGCAGATCTACAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCCTCGGTGTTCCG
>sample3
PCR: Fungal ITS1 and ITS2 regions
primers ITS1F – ITS4
• Two sites
• 8 traps checked
• May to October
• Air samples as controls
• Fungal DNA present
• sorting and counting completed
• DNA extracted
-> PCR, Sequncing
Virve Viertiö
MSc student
MSc
project
14
• Using DNA, tens of fungal species / OTUs were detected in
every beetle and air sample
• Molecular identification and statistical analysis ongoing
• Which species of wood decomposing fungi will form a
community here in 10, 20, 50 years?
University of Helsinki
Finland
Moscow State University
Russia
Swedish University
of Agricultural Sciences
2016: Nordic – Russian Boreal Biodiversity
and Data Education Network
Education and outreach
• Polypores of the Białowieża forest Oct 2013
• Biodiversity in dead wood, Helsinki Nov 2013
• Next-gen seq sample prep course, Uppsala Jun 2014
• Biodiversity informatics and data management Jul 2014
• Polypore course, Russia Aug 2014
• Polypore course, Finland: ForBio Sep 2014
• Dead wood meeting, Lammi: SIU May 2015
* * *
• Dead wood meeting & course Lammi, FIN Aug 2016
• Polypores as indicator species Lammi, FIN Sep 2016
• Biodiversity data skills Tartu, EST Nov 2016
FUNGAL ECOLOGY MATHEMATICAL BIOLOGY GROUP
http://blogs.helsinki.fi/deadwoodmeeting
registration until 20 May, may close earlier
SX invertebrate teacher,
Conditions:
teaching for a cup of rice
(& travel, & accomodation)
Photo: Dmitry Schigel,
Virve Viertiö
Thank you!

More Related Content

Similar to Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

Forest Refine Newsletter No 6
Forest Refine Newsletter No 6Forest Refine Newsletter No 6
Forest Refine Newsletter No 6Kalvis Kons
 
Erscp 2014 ENG
Erscp 2014 ENGErscp 2014 ENG
Erscp 2014 ENGnigradmb
 
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...BOBCATSSS 2017
 
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
 Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-PurovaaraBusiness Finland
 
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministryNordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministryNordForsk
 
Presentation for Cardiff University Library staff
Presentation for Cardiff University Library staffPresentation for Cardiff University Library staff
Presentation for Cardiff University Library staffkratec
 
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...Brussels, Belgium
 
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...Brussels, Belgium
 
QQML 2015 Opening Presentation
QQML 2015 Opening PresentationQQML 2015 Opening Presentation
QQML 2015 Opening PresentationAris Meletiou
 
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural DevelopmentBelgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural DevelopmentSmart Villages
 
Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...Karlsruhe Institute of Technology (KIT)
 
Joint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in FinlandJoint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in FinlandAnna-Kaisa Sjölund
 
ViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERNViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERNVince Smith
 
Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)jmamtora
 
Towards National Open Access Policy in Finland
Towards National Open Access Policy in FinlandTowards National Open Access Policy in Finland
Towards National Open Access Policy in FinlandPekka Olsbo
 
Law Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of EnvironmentLaw Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of EnvironmentKornelija Petr
 

Similar to Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation. (20)

Forest Refine Newsletter No 6
Forest Refine Newsletter No 6Forest Refine Newsletter No 6
Forest Refine Newsletter No 6
 
Sciences Po Grenoble library and Research, France
Sciences Po Grenoble library and Research, FranceSciences Po Grenoble library and Research, France
Sciences Po Grenoble library and Research, France
 
Erscp 2014 ENG
Erscp 2014 ENGErscp 2014 ENG
Erscp 2014 ENG
 
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
Georgios Kourkoulos and Ruth Gbikpi - The EUI Library and the Delivery of Non...
 
ETDs in india
ETDs in indiaETDs in india
ETDs in india
 
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
 Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
Business and Innovation Opportunities in Brazil Seminar, Tiina Vihma-Purovaara
 
Good Data Battle in Slovenia – ADP experience
Good Data Battle in Slovenia – ADP experienceGood Data Battle in Slovenia – ADP experience
Good Data Battle in Slovenia – ADP experience
 
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministryNordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
NordForsk Open Access Reykjavik 14-15/8-2014:Status and-plans-finland-ministry
 
Call for papers: IASC 2014 3rd European Meeting
Call for papers: IASC 2014 3rd European MeetingCall for papers: IASC 2014 3rd European Meeting
Call for papers: IASC 2014 3rd European Meeting
 
Presentation for Cardiff University Library staff
Presentation for Cardiff University Library staffPresentation for Cardiff University Library staff
Presentation for Cardiff University Library staff
 
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
Scientix 9th SPNE Brussels 6 November 2015: Project for the Initiation to the...
 
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
Scientix 9th SPWatFCL Brussels 6-8 November 2015: Project for the Initiation ...
 
QQML 2015 Opening Presentation
QQML 2015 Opening PresentationQQML 2015 Opening Presentation
QQML 2015 Opening Presentation
 
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural DevelopmentBelgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
Belgium | Jun-17 | SVI-EASAC Workshop Smart Rural Development
 
Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...Making Research Data Repositories visible – the re3data Registry of Research ...
Making Research Data Repositories visible – the re3data Registry of Research ...
 
Joint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in FinlandJoint Open Access Statement of 26 Universities of Applied Sciences in Finland
Joint Open Access Statement of 26 Universities of Applied Sciences in Finland
 
ViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERNViBRANT 8th e-Concertation Meeting, CERN
ViBRANT 8th e-Concertation Meeting, CERN
 
Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)Iflaconferences august 2012 (2)
Iflaconferences august 2012 (2)
 
Towards National Open Access Policy in Finland
Towards National Open Access Policy in FinlandTowards National Open Access Policy in Finland
Towards National Open Access Policy in Finland
 
Law Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of EnvironmentLaw Students’ Information Literacy Skills and Protection of Environment
Law Students’ Information Literacy Skills and Protection of Environment
 

Recently uploaded

Mining Activity and Investment Opportunity in Myanmar.pptx
Mining Activity and Investment Opportunity in Myanmar.pptxMining Activity and Investment Opportunity in Myanmar.pptx
Mining Activity and Investment Opportunity in Myanmar.pptxKyawThanTint
 
Efficient spin-up of Earth System Models usingsequence acceleration
Efficient spin-up of Earth System Models usingsequence accelerationEfficient spin-up of Earth System Models usingsequence acceleration
Efficient spin-up of Earth System Models usingsequence accelerationSérgio Sacani
 
Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...
Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...
Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...kevin8smith
 
MSCII_ FCT UNIT 5 TOXICOLOGY.pdf
MSCII_              FCT UNIT 5 TOXICOLOGY.pdfMSCII_              FCT UNIT 5 TOXICOLOGY.pdf
MSCII_ FCT UNIT 5 TOXICOLOGY.pdfSuchita Rawat
 
SaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptx
SaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptxSaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptx
SaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptxPat (JS) Heslop-Harrison
 
Warming the earth and the atmosphere.pptx
Warming the earth and the atmosphere.pptxWarming the earth and the atmosphere.pptx
Warming the earth and the atmosphere.pptxGlendelCaroz
 
Taphonomy and Quality of the Fossil Record
Taphonomy and Quality of the  Fossil RecordTaphonomy and Quality of the  Fossil Record
Taphonomy and Quality of the Fossil RecordSangram Sahoo
 
GBSN - Microbiology (Unit 4) Concept of Asepsis
GBSN - Microbiology (Unit 4) Concept of AsepsisGBSN - Microbiology (Unit 4) Concept of Asepsis
GBSN - Microbiology (Unit 4) Concept of AsepsisAreesha Ahmad
 
Heat Units in plant physiology and the importance of Growing Degree days
Heat Units in plant physiology and the importance of Growing Degree daysHeat Units in plant physiology and the importance of Growing Degree days
Heat Units in plant physiology and the importance of Growing Degree daysBrahmesh Reddy B R
 
Introduction and significance of Symbiotic algae
Introduction and significance of  Symbiotic algaeIntroduction and significance of  Symbiotic algae
Introduction and significance of Symbiotic algaekushbuR
 
Costs to heap leach gold ore tailings in Karamoja region of Uganda
Costs to heap leach gold ore tailings in Karamoja region of UgandaCosts to heap leach gold ore tailings in Karamoja region of Uganda
Costs to heap leach gold ore tailings in Karamoja region of UgandaTimothyOkuna
 
PARENTAL CARE IN FISHES.pptx for 5th sem
PARENTAL CARE IN FISHES.pptx for 5th semPARENTAL CARE IN FISHES.pptx for 5th sem
PARENTAL CARE IN FISHES.pptx for 5th semborkhotudu123
 
NuGOweek 2024 programme final FLYER short.pdf
NuGOweek 2024 programme final FLYER short.pdfNuGOweek 2024 programme final FLYER short.pdf
NuGOweek 2024 programme final FLYER short.pdfpablovgd
 
POST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptx
POST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptxPOST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptx
POST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptxArpitaMishra69
 
EU START PROJECT. START-Newsletter_Issue_4.pdf
EU START PROJECT. START-Newsletter_Issue_4.pdfEU START PROJECT. START-Newsletter_Issue_4.pdf
EU START PROJECT. START-Newsletter_Issue_4.pdfStart Project
 
Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...
Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...
Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...yogeshlabana357357
 
Electricity and Circuits for Grade 9 students
Electricity and Circuits for Grade 9 studentsElectricity and Circuits for Grade 9 students
Electricity and Circuits for Grade 9 studentslevieagacer
 
Classification of Kerogen, Perspective on palynofacies in depositional envi...
Classification of Kerogen,  Perspective on palynofacies in depositional  envi...Classification of Kerogen,  Perspective on palynofacies in depositional  envi...
Classification of Kerogen, Perspective on palynofacies in depositional envi...Sangram Sahoo
 
Vital Signs of Animals Presentation By Aftab Ahmed Rahimoon
Vital Signs of Animals Presentation By Aftab Ahmed RahimoonVital Signs of Animals Presentation By Aftab Ahmed Rahimoon
Vital Signs of Animals Presentation By Aftab Ahmed Rahimoonintarciacompanies
 
FORENSIC CHEMISTRY ARSON INVESTIGATION.pdf
FORENSIC CHEMISTRY ARSON INVESTIGATION.pdfFORENSIC CHEMISTRY ARSON INVESTIGATION.pdf
FORENSIC CHEMISTRY ARSON INVESTIGATION.pdfSuchita Rawat
 

Recently uploaded (20)

Mining Activity and Investment Opportunity in Myanmar.pptx
Mining Activity and Investment Opportunity in Myanmar.pptxMining Activity and Investment Opportunity in Myanmar.pptx
Mining Activity and Investment Opportunity in Myanmar.pptx
 
Efficient spin-up of Earth System Models usingsequence acceleration
Efficient spin-up of Earth System Models usingsequence accelerationEfficient spin-up of Earth System Models usingsequence acceleration
Efficient spin-up of Earth System Models usingsequence acceleration
 
Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...
Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...
Harry Coumnas Thinks That Human Teleportation is Possible in Quantum Mechanic...
 
MSCII_ FCT UNIT 5 TOXICOLOGY.pdf
MSCII_              FCT UNIT 5 TOXICOLOGY.pdfMSCII_              FCT UNIT 5 TOXICOLOGY.pdf
MSCII_ FCT UNIT 5 TOXICOLOGY.pdf
 
SaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptx
SaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptxSaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptx
SaffronCrocusGenomicsThessalonikiOnlineMay2024TalkOnline.pptx
 
Warming the earth and the atmosphere.pptx
Warming the earth and the atmosphere.pptxWarming the earth and the atmosphere.pptx
Warming the earth and the atmosphere.pptx
 
Taphonomy and Quality of the Fossil Record
Taphonomy and Quality of the  Fossil RecordTaphonomy and Quality of the  Fossil Record
Taphonomy and Quality of the Fossil Record
 
GBSN - Microbiology (Unit 4) Concept of Asepsis
GBSN - Microbiology (Unit 4) Concept of AsepsisGBSN - Microbiology (Unit 4) Concept of Asepsis
GBSN - Microbiology (Unit 4) Concept of Asepsis
 
Heat Units in plant physiology and the importance of Growing Degree days
Heat Units in plant physiology and the importance of Growing Degree daysHeat Units in plant physiology and the importance of Growing Degree days
Heat Units in plant physiology and the importance of Growing Degree days
 
Introduction and significance of Symbiotic algae
Introduction and significance of  Symbiotic algaeIntroduction and significance of  Symbiotic algae
Introduction and significance of Symbiotic algae
 
Costs to heap leach gold ore tailings in Karamoja region of Uganda
Costs to heap leach gold ore tailings in Karamoja region of UgandaCosts to heap leach gold ore tailings in Karamoja region of Uganda
Costs to heap leach gold ore tailings in Karamoja region of Uganda
 
PARENTAL CARE IN FISHES.pptx for 5th sem
PARENTAL CARE IN FISHES.pptx for 5th semPARENTAL CARE IN FISHES.pptx for 5th sem
PARENTAL CARE IN FISHES.pptx for 5th sem
 
NuGOweek 2024 programme final FLYER short.pdf
NuGOweek 2024 programme final FLYER short.pdfNuGOweek 2024 programme final FLYER short.pdf
NuGOweek 2024 programme final FLYER short.pdf
 
POST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptx
POST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptxPOST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptx
POST TRANSCRIPTIONAL GENE SILENCING-AN INTRODUCTION.pptx
 
EU START PROJECT. START-Newsletter_Issue_4.pdf
EU START PROJECT. START-Newsletter_Issue_4.pdfEU START PROJECT. START-Newsletter_Issue_4.pdf
EU START PROJECT. START-Newsletter_Issue_4.pdf
 
Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...
Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...
Soil and Water Conservation Engineering (SWCE) is a specialized field of stud...
 
Electricity and Circuits for Grade 9 students
Electricity and Circuits for Grade 9 studentsElectricity and Circuits for Grade 9 students
Electricity and Circuits for Grade 9 students
 
Classification of Kerogen, Perspective on palynofacies in depositional envi...
Classification of Kerogen,  Perspective on palynofacies in depositional  envi...Classification of Kerogen,  Perspective on palynofacies in depositional  envi...
Classification of Kerogen, Perspective on palynofacies in depositional envi...
 
Vital Signs of Animals Presentation By Aftab Ahmed Rahimoon
Vital Signs of Animals Presentation By Aftab Ahmed RahimoonVital Signs of Animals Presentation By Aftab Ahmed Rahimoon
Vital Signs of Animals Presentation By Aftab Ahmed Rahimoon
 
FORENSIC CHEMISTRY ARSON INVESTIGATION.pdf
FORENSIC CHEMISTRY ARSON INVESTIGATION.pdfFORENSIC CHEMISTRY ARSON INVESTIGATION.pdf
FORENSIC CHEMISTRY ARSON INVESTIGATION.pdf
 

Schigel DS, Viertiö V 2016: On the wings of bark beetles: Ips typographus and fungal arrival to spruce trees in Finland. IX symposium on the conservation of saproxylic beetles, Genk, Belgium; oral presentation.

Editor's Notes

  1. New email address Traits Citizen science
  2. GBIF logo to add in bottom left
  3. When and how do the wood decomposing fungi arrive to trees? Does the bark beetle Ips typographus vector some wood decomposing fungi to the trees it attacks? Is there a difference in the fungal community carried by the beetle’s 1st and 2nd generation?
  4. We use DNA to detect and to quantify species, testing hypothesis and molecular curiosity, Sonja
  5. New network name
  6. Other events include species identification and sample preparetion skills, data management skills and finally, dead wood symposium
  7. A few snapshots from these courses; important, try to recall the event, the person or the book that made you decide that you would like to be a biologists, or to work with biologists
  8. Screenshots from 2015 Group photo, programme Archive slides!
  9. POSter Almost a society, beetles, fungi, Almost have a journal Almost have a website and social media groups Almost have a conferences Almost have a study programme.