The document provides an overview of object-oriented Perl by summarizing the key concepts and differences between procedural and object-oriented programming. It gives a simple example of converting an existing Perl module to an object-oriented structure by adding a "new" method and calling methods on instantiated objects. The concepts of abstraction, encapsulation, and inheritance are briefly introduced.
Have Your Cake and Eat It Too: Meta-Programming Techniques for JavaHoward Lewis Ship
The document discusses meta-programming in Java using bytecode manipulation libraries like ASM. It describes how ASM works by allowing the reading, modification, and writing of Java bytecode. This enables dynamically rewriting classes by adding, removing, or modifying fields and methods at runtime. The document provides an example of using ASM to add a private field to a class. It also discusses how meta-programming techniques can be used to implement features like aspect-oriented programming and dynamic proxies in Java.
The document discusses the Combined Public Key (CPK) cryptosystem used in OpenSolaris. CPK provides identity-based encryption and signature schemes as an alternative to traditional public key infrastructure. It maps identities to key pairs using a hash function and private/public key matrices. CPK interfaces with the Solaris cryptographic and key management frameworks using standards like PKCS #11 and PKCS #7.
Embedding Languages Without Breaking ToolsLukas Renggli
Domain-specific languages (DSLs) are increasingly used as embedded languages within general-purpose host languages. DSLs provide a compact, dedicated syntax for specifying parts of an application related to specialized domains. Unfortunately, such language extensions typically do not integrate well with the development tools of the host language. Editors, compilers and debuggers are either unaware of the extensions, or must be adapted at a non-trivial cost. We present a novel approach to embed DSLs into an existing host language by leveraging the underlying representation of the host language used by these tools. Helvetia is an extensible system that intercepts the compilation pipeline of the Smalltalk host language to seamlessly integrate language extensions. We validate our approach by case studies that demonstrate three fundamentally different ways to extend or adapt the host language syntax and semantics.
The document discusses using the Java Content Repository (JCR) specification and REST web services to build non-CMS web applications that access content in a flexible and standardized way. It provides an overview of JCR and how the Apache Sling framework uses JCR and REST to easily create dynamic websites and applications using content from a JCR-compliant repository without the need for server-side programming. Code snippets are included that demonstrate performing basic CRUD operations on content from a JCR repository using RESTful URLs and JavaScript.
This document introduces JCR (JSR-170 and JSR-283), including:
1. An overview of JSR-170 and the development of JCR 1.0.
2. Details about JCR 2.0 such as backwards compatibility, reorganization, and new features like access control management, retention policies, and versioning.
3. Descriptions of implementations of JCR standards like Apache Jackrabbit and frameworks built on top of it like Apache Sling.
This document provides a summary of key XML Schema components and their attributes. It defines elements such as <schema>, <element>, <complexType>, <simpleType>, <attribute>, <group> and <attributeGroup>. For each element, it lists important attributes like id, name, type and more. It also summarizes common XML Schema facets for constraining values like length, pattern, enumeration and others.
The document discusses evaluating how advanced techniques for splitting identifiers impact the performance of feature location techniques. It describes using different identifier splitting algorithms, such as CamelCase, Samurai, and a manually developed "perfect" splitting algorithm, within information retrieval and dynamic feature location techniques. The study compares the effectiveness of these feature location techniques when using different splitting algorithms using four software systems and associated datasets involving features and bugs. Results are presented using box plots to compare the median and average effectiveness across all data points for each technique and dataset.
CIS14: Developing with OAuth and OIDC ConnectCloudIDSummit
David Chase, Ping Identity
Exploring the implementation and architecture of OAuth and OpenID Connect, using web and mobile applications, with topics including grant types, choosing a grant type, refresh tokens, and managing sessions
Have Your Cake and Eat It Too: Meta-Programming Techniques for JavaHoward Lewis Ship
The document discusses meta-programming in Java using bytecode manipulation libraries like ASM. It describes how ASM works by allowing the reading, modification, and writing of Java bytecode. This enables dynamically rewriting classes by adding, removing, or modifying fields and methods at runtime. The document provides an example of using ASM to add a private field to a class. It also discusses how meta-programming techniques can be used to implement features like aspect-oriented programming and dynamic proxies in Java.
The document discusses the Combined Public Key (CPK) cryptosystem used in OpenSolaris. CPK provides identity-based encryption and signature schemes as an alternative to traditional public key infrastructure. It maps identities to key pairs using a hash function and private/public key matrices. CPK interfaces with the Solaris cryptographic and key management frameworks using standards like PKCS #11 and PKCS #7.
Embedding Languages Without Breaking ToolsLukas Renggli
Domain-specific languages (DSLs) are increasingly used as embedded languages within general-purpose host languages. DSLs provide a compact, dedicated syntax for specifying parts of an application related to specialized domains. Unfortunately, such language extensions typically do not integrate well with the development tools of the host language. Editors, compilers and debuggers are either unaware of the extensions, or must be adapted at a non-trivial cost. We present a novel approach to embed DSLs into an existing host language by leveraging the underlying representation of the host language used by these tools. Helvetia is an extensible system that intercepts the compilation pipeline of the Smalltalk host language to seamlessly integrate language extensions. We validate our approach by case studies that demonstrate three fundamentally different ways to extend or adapt the host language syntax and semantics.
The document discusses using the Java Content Repository (JCR) specification and REST web services to build non-CMS web applications that access content in a flexible and standardized way. It provides an overview of JCR and how the Apache Sling framework uses JCR and REST to easily create dynamic websites and applications using content from a JCR-compliant repository without the need for server-side programming. Code snippets are included that demonstrate performing basic CRUD operations on content from a JCR repository using RESTful URLs and JavaScript.
This document introduces JCR (JSR-170 and JSR-283), including:
1. An overview of JSR-170 and the development of JCR 1.0.
2. Details about JCR 2.0 such as backwards compatibility, reorganization, and new features like access control management, retention policies, and versioning.
3. Descriptions of implementations of JCR standards like Apache Jackrabbit and frameworks built on top of it like Apache Sling.
This document provides a summary of key XML Schema components and their attributes. It defines elements such as <schema>, <element>, <complexType>, <simpleType>, <attribute>, <group> and <attributeGroup>. For each element, it lists important attributes like id, name, type and more. It also summarizes common XML Schema facets for constraining values like length, pattern, enumeration and others.
The document discusses evaluating how advanced techniques for splitting identifiers impact the performance of feature location techniques. It describes using different identifier splitting algorithms, such as CamelCase, Samurai, and a manually developed "perfect" splitting algorithm, within information retrieval and dynamic feature location techniques. The study compares the effectiveness of these feature location techniques when using different splitting algorithms using four software systems and associated datasets involving features and bugs. Results are presented using box plots to compare the median and average effectiveness across all data points for each technique and dataset.
CIS14: Developing with OAuth and OIDC ConnectCloudIDSummit
David Chase, Ping Identity
Exploring the implementation and architecture of OAuth and OpenID Connect, using web and mobile applications, with topics including grant types, choosing a grant type, refresh tokens, and managing sessions
New Study Of Gita Nov 28 Dr. Shriniwas J. Kashalikarbanothkishan
The document discusses several topics related to understanding concepts in the Bhagavad Gita. It notes that the Gita refers to 9 openings in the body but there are 10 for females. It argues that questioning scripture does not diminish its importance but helps arrive at the essence. Later passages discuss reconciling detachment from results with having specific objectives, how to avoid depression, and realizing one's true duties through self-study and remembrance of God's names.
This document discusses using the Perl programming language to automate cataloging tasks involving MARC records, particularly for electronic resources. Perl is well-suited for text processing and manipulating MARC records. The document provides examples of Perl scripts that create brief MARC records from title lists, edit vendor-supplied MARC records to add local information, and derive MARC records for ejournals based on print records. It also discusses MARC editing tools and resources for learning Perl.
This document provides an example JavaScript application to construct a call for a SAS macro. It presents the code and explains how it works. The application uses frames to separate an information area and data input area. The bottom frame contains a form with fields to enter macro parameter values. JavaScript is used to validate input and construct the macro call. Functions are defined to display help text for fields and reset values. When buttons are clicked, JavaScript functions run to display information, reset values, or construct the macro call. This allows generic code to create call-makers for different SAS macros by changing only the form fields and information page.
This document discusses the start of recruitment for the National Children's Study, which will track the health and development of over 100,000 children from before birth to age 21. The study aims to understand how genes and environment impact children's health. Recruitment will begin in two locations - Duplin County, NC and Queens, NY. Over the next 18 months, each of the initial 7 study centers will recruit approximately 375 volunteers to participate. The study will provide insights into birth disorders and conditions across childhood. It is intended to yield information that could help develop prevention strategies and treatments.
The document provides information on common HTML form elements like text boxes, radio buttons, checkboxes, dropdown lists, and text areas. It includes examples of the code needed to create each element. It also discusses using PHP to process form data submitted to a script and validates the form entries with JavaScript before submission. Validation ensures required fields are completed and data is in the expected format. The document provides an example HTML form incorporating the different elements and the corresponding PHP code to process the submitted values.
Οnline Marketing Case Study: Personal Style-icon by MindworksGiorgos Vareloglou
One of the first greek social media marketing case studies for stylewatch.gr by Mindworks presented at interactive marketing conference 2009 (#imc09)
http://mindworks.gr
This document provides a help and tutorial for TopStyle Pro version 3.11. It covers getting started with TopStyle, editing style sheets and HTML/XHTML, working with colors, previews, validation, site management, reports, mappings, customization, and third-party integration. It also includes appendices on CSS basics and tips, TopStyle tips and tricks, style sheet resources, keyboard shortcuts, and regular expressions.
TopStyle Help & <b>Tutorial</b>tutorialsruby
This document provides a table of contents for the TopStyle Pro Help & Tutorial, which teaches how to use the TopStyle software for editing style sheets and HTML/XHTML documents. It lists over 50 sections that provide explanations and instructions for features like creating and opening files, editing styles, working with colors, previews, validation, site management, reports and customizing the software. The document was created by Giampaolo Bellavite from the online help provided with TopStyle version 3.11.
The Art Institute of Atlanta IMD 210 Fundamentals of Scripting <b>...</b>tutorialsruby
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers for applications and researchers. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
Standardization and Knowledge Transfer – INS0tutorialsruby
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers and a flexible model. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation by defining rules for tags. CSS rules are defined in external style sheets to keep presentation separate from structure and content.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation through rules that target specific XHTML elements.
This document discusses how to create and use external cascading style sheets (CSS) in Dreamweaver. It provides steps to:
1. Open the CSS Styles tab in Dreamweaver and create a new external CSS stylesheet using a sample text style.
2. Save the stylesheet and link it to a new HTML page to style elements like headings, text sizes, and boxes.
3. Edit existing styles by selecting a tag in the CSS Styles panel and modifying properties directly, or by clicking the tag and using the pencil icon to edit in a window. This allows customizing styles globally across all linked pages.
This document provides an overview of how to create and use cascading style sheets (CSS) in Dreamweaver. It describes the different types of style sheets, including external and internal style sheets. It outlines the steps to create an external style sheet in Dreamweaver using the CSS Styles panel and provides instructions for linking the external style sheet to an HTML page. The document demonstrates how to experiment with predefined styles and how to edit, add, and delete styles in the CSS stylesheet.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using the bulletin board for questions.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on topics like TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using bulletin boards, and includes images related to these topics.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables adapting appearance for different devices. The document provides examples of using CSS classes to style template elements and explains how to set up a demo system using the included CSS and templates.
New Study Of Gita Nov 28 Dr. Shriniwas J. Kashalikarbanothkishan
The document discusses several topics related to understanding concepts in the Bhagavad Gita. It notes that the Gita refers to 9 openings in the body but there are 10 for females. It argues that questioning scripture does not diminish its importance but helps arrive at the essence. Later passages discuss reconciling detachment from results with having specific objectives, how to avoid depression, and realizing one's true duties through self-study and remembrance of God's names.
This document discusses using the Perl programming language to automate cataloging tasks involving MARC records, particularly for electronic resources. Perl is well-suited for text processing and manipulating MARC records. The document provides examples of Perl scripts that create brief MARC records from title lists, edit vendor-supplied MARC records to add local information, and derive MARC records for ejournals based on print records. It also discusses MARC editing tools and resources for learning Perl.
This document provides an example JavaScript application to construct a call for a SAS macro. It presents the code and explains how it works. The application uses frames to separate an information area and data input area. The bottom frame contains a form with fields to enter macro parameter values. JavaScript is used to validate input and construct the macro call. Functions are defined to display help text for fields and reset values. When buttons are clicked, JavaScript functions run to display information, reset values, or construct the macro call. This allows generic code to create call-makers for different SAS macros by changing only the form fields and information page.
This document discusses the start of recruitment for the National Children's Study, which will track the health and development of over 100,000 children from before birth to age 21. The study aims to understand how genes and environment impact children's health. Recruitment will begin in two locations - Duplin County, NC and Queens, NY. Over the next 18 months, each of the initial 7 study centers will recruit approximately 375 volunteers to participate. The study will provide insights into birth disorders and conditions across childhood. It is intended to yield information that could help develop prevention strategies and treatments.
The document provides information on common HTML form elements like text boxes, radio buttons, checkboxes, dropdown lists, and text areas. It includes examples of the code needed to create each element. It also discusses using PHP to process form data submitted to a script and validates the form entries with JavaScript before submission. Validation ensures required fields are completed and data is in the expected format. The document provides an example HTML form incorporating the different elements and the corresponding PHP code to process the submitted values.
Οnline Marketing Case Study: Personal Style-icon by MindworksGiorgos Vareloglou
One of the first greek social media marketing case studies for stylewatch.gr by Mindworks presented at interactive marketing conference 2009 (#imc09)
http://mindworks.gr
This document provides a help and tutorial for TopStyle Pro version 3.11. It covers getting started with TopStyle, editing style sheets and HTML/XHTML, working with colors, previews, validation, site management, reports, mappings, customization, and third-party integration. It also includes appendices on CSS basics and tips, TopStyle tips and tricks, style sheet resources, keyboard shortcuts, and regular expressions.
TopStyle Help & <b>Tutorial</b>tutorialsruby
This document provides a table of contents for the TopStyle Pro Help & Tutorial, which teaches how to use the TopStyle software for editing style sheets and HTML/XHTML documents. It lists over 50 sections that provide explanations and instructions for features like creating and opening files, editing styles, working with colors, previews, validation, site management, reports and customizing the software. The document was created by Giampaolo Bellavite from the online help provided with TopStyle version 3.11.
The Art Institute of Atlanta IMD 210 Fundamentals of Scripting <b>...</b>tutorialsruby
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
This document provides the course outline for IMD 210 Fundamentals of Scripting Languages at The Art Institute of Atlanta during the Spring 2005 quarter. The course focuses on integrating programming concepts with interface design using scripting languages like JavaScript and CSS. It will cover topics like DOM, CSS layout, JavaScript variables, conditionals, and events. Students will complete 4 assignments including redesigning existing websites, and there will be weekly quizzes, a midterm, and final exam. The course is worth 4 credits and meets once a week for class and lab.
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers for applications and researchers. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
Standardization and Knowledge Transfer – INS0tutorialsruby
The group aims to bridge gaps between peer-to-peer database architectures and scaling multimedia information retrieval. They develop a probabilistic multimedia database system with abstraction layers and a flexible model. They also research challenges of peer-to-peer networks for distributed data management. Both lines are supported by the MonetDB platform to exploit custom hardware and adaptive query optimization. The goal is a modular solution linking theoretical optimal solutions to application demands under resource limitations.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
This document provides an introduction to converting HTML documents to XHTML, including the basic syntax changes needed like making all tags lowercase and closing all tags. It provides examples of correct XHTML markup for different tags. It also explains the new DOCTYPE declaration and shows a sample well-formed XHTML document incorporating all the discussed changes. Resources for learning more about XHTML are listed at the end.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation by defining rules for tags. CSS rules are defined in external style sheets to keep presentation separate from structure and content.
XHTML is a markup language that provides structure and semantics to web pages. It is based on XML and is more strict than HTML. XHTML pages must have a document type definition, html and head tags, and a body where the visible content goes. Common XHTML tags include paragraphs, lists, links, images, and divisions to logically separate content. While XHTML provides structure, CSS is used to style pages and control visual presentation through rules that target specific XHTML elements.
This document discusses how to create and use external cascading style sheets (CSS) in Dreamweaver. It provides steps to:
1. Open the CSS Styles tab in Dreamweaver and create a new external CSS stylesheet using a sample text style.
2. Save the stylesheet and link it to a new HTML page to style elements like headings, text sizes, and boxes.
3. Edit existing styles by selecting a tag in the CSS Styles panel and modifying properties directly, or by clicking the tag and using the pencil icon to edit in a window. This allows customizing styles globally across all linked pages.
This document provides an overview of how to create and use cascading style sheets (CSS) in Dreamweaver. It describes the different types of style sheets, including external and internal style sheets. It outlines the steps to create an external style sheet in Dreamweaver using the CSS Styles panel and provides instructions for linking the external style sheet to an HTML page. The document demonstrates how to experiment with predefined styles and how to edit, add, and delete styles in the CSS stylesheet.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using the bulletin board for questions.
This document appears to be a weekly update from an intro to computer science course. It includes summaries of classmates' demographics, comfort levels, and prior experience. It also discusses time spent on problem sets and recommends upcoming courses in CS51 and CS61. Finally, it recommends reading on topics like TCP/IP, HTTP, XHTML, CSS, PHP, SQL and using bulletin boards, and includes images related to these topics.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables adapting appearance for different devices. The document provides examples of using CSS classes to style template elements and explains how to set up a demo system using the included CSS and templates.
The document discusses how to use Cascading Style Sheets (CSS) with Corvid Servlet Runtime templates to control formatting and layout. CSS allows separating design from content, making templates simpler and easier to maintain. It also enables customization of appearance for different devices. The document provides examples of how to apply CSS classes and rules to Corvid template elements to control fonts, colors, positioning and more.
The document provides an introduction to CSS and how it works with HTML to control the presentation and styling of web page content. It explains basic CSS concepts like selectors, properties and values, and how CSS rules are used to target specific HTML elements and style them. Examples are given of common CSS properties and selectors and how they can be used to style elements and format the layout of web pages.
The document introduces CSS and how it works with HTML to separate content from presentation, allowing the styling of web pages through rules that target HTML elements. It explains CSS syntax and various selectors like type, class, ID, and descendant selectors. Examples are provided of how CSS can be used to style properties like color, font, padding, and layout of elements on a page.
Cascading Style Sheets (CSS) allow users to define how HTML elements are presented on a page. CSS enables changing the appearance and layout of an entire website by editing just one CSS file. CSS uses selectors to apply styles to HTML elements via properties and values. Styles can be defined internally in HTML or externally in CSS files. CSS can control text formatting, colors, spacing, positioning and more to achieve visual consistency across web pages.
Cascading Style Sheets (CSS) allow users to define how HTML elements are presented on a page. CSS enables changing the appearance and layout of an entire website by editing just one CSS file. CSS uses selectors to apply styles to HTML elements via properties and values. Styles can be defined internally in HTML or externally in CSS files. CSS can control text formatting, colors, spacing, positioning and more to achieve visual consistency across web pages.
Unlock the Future of Search with MongoDB Atlas_ Vector Search Unleashed.pdfMalak Abu Hammad
Discover how MongoDB Atlas and vector search technology can revolutionize your application's search capabilities. This comprehensive presentation covers:
* What is Vector Search?
* Importance and benefits of vector search
* Practical use cases across various industries
* Step-by-step implementation guide
* Live demos with code snippets
* Enhancing LLM capabilities with vector search
* Best practices and optimization strategies
Perfect for developers, AI enthusiasts, and tech leaders. Learn how to leverage MongoDB Atlas to deliver highly relevant, context-aware search results, transforming your data retrieval process. Stay ahead in tech innovation and maximize the potential of your applications.
#MongoDB #VectorSearch #AI #SemanticSearch #TechInnovation #DataScience #LLM #MachineLearning #SearchTechnology
AI 101: An Introduction to the Basics and Impact of Artificial IntelligenceIndexBug
Imagine a world where machines not only perform tasks but also learn, adapt, and make decisions. This is the promise of Artificial Intelligence (AI), a technology that's not just enhancing our lives but revolutionizing entire industries.
In the rapidly evolving landscape of technologies, XML continues to play a vital role in structuring, storing, and transporting data across diverse systems. The recent advancements in artificial intelligence (AI) present new methodologies for enhancing XML development workflows, introducing efficiency, automation, and intelligent capabilities. This presentation will outline the scope and perspective of utilizing AI in XML development. The potential benefits and the possible pitfalls will be highlighted, providing a balanced view of the subject.
We will explore the capabilities of AI in understanding XML markup languages and autonomously creating structured XML content. Additionally, we will examine the capacity of AI to enrich plain text with appropriate XML markup. Practical examples and methodological guidelines will be provided to elucidate how AI can be effectively prompted to interpret and generate accurate XML markup.
Further emphasis will be placed on the role of AI in developing XSLT, or schemas such as XSD and Schematron. We will address the techniques and strategies adopted to create prompts for generating code, explaining code, or refactoring the code, and the results achieved.
The discussion will extend to how AI can be used to transform XML content. In particular, the focus will be on the use of AI XPath extension functions in XSLT, Schematron, Schematron Quick Fixes, or for XML content refactoring.
The presentation aims to deliver a comprehensive overview of AI usage in XML development, providing attendees with the necessary knowledge to make informed decisions. Whether you’re at the early stages of adopting AI or considering integrating it in advanced XML development, this presentation will cover all levels of expertise.
By highlighting the potential advantages and challenges of integrating AI with XML development tools and languages, the presentation seeks to inspire thoughtful conversation around the future of XML development. We’ll not only delve into the technical aspects of AI-powered XML development but also discuss practical implications and possible future directions.
Essentials of Automations: The Art of Triggers and Actions in FMESafe Software
In this second installment of our Essentials of Automations webinar series, we’ll explore the landscape of triggers and actions, guiding you through the nuances of authoring and adapting workspaces for seamless automations. Gain an understanding of the full spectrum of triggers and actions available in FME, empowering you to enhance your workspaces for efficient automation.
We’ll kick things off by showcasing the most commonly used event-based triggers, introducing you to various automation workflows like manual triggers, schedules, directory watchers, and more. Plus, see how these elements play out in real scenarios.
Whether you’re tweaking your current setup or building from the ground up, this session will arm you with the tools and insights needed to transform your FME usage into a powerhouse of productivity. Join us to discover effective strategies that simplify complex processes, enhancing your productivity and transforming your data management practices with FME. Let’s turn complexity into clarity and make your workspaces work wonders!
Communications Mining Series - Zero to Hero - Session 1DianaGray10
This session provides introduction to UiPath Communication Mining, importance and platform overview. You will acquire a good understand of the phases in Communication Mining as we go over the platform with you. Topics covered:
• Communication Mining Overview
• Why is it important?
• How can it help today’s business and the benefits
• Phases in Communication Mining
• Demo on Platform overview
• Q/A
Programming Foundation Models with DSPy - Meetup SlidesZilliz
Prompting language models is hard, while programming language models is easy. In this talk, I will discuss the state-of-the-art framework DSPy for programming foundation models with its powerful optimizers and runtime constraint system.
Threats to mobile devices are more prevalent and increasing in scope and complexity. Users of mobile devices desire to take full advantage of the features
available on those devices, but many of the features provide convenience and capability but sacrifice security. This best practices guide outlines steps the users can take to better protect personal devices and information.
Cosa hanno in comune un mattoncino Lego e la backdoor XZ?Speck&Tech
ABSTRACT: A prima vista, un mattoncino Lego e la backdoor XZ potrebbero avere in comune il fatto di essere entrambi blocchi di costruzione, o dipendenze di progetti creativi e software. La realtà è che un mattoncino Lego e il caso della backdoor XZ hanno molto di più di tutto ciò in comune.
Partecipate alla presentazione per immergervi in una storia di interoperabilità, standard e formati aperti, per poi discutere del ruolo importante che i contributori hanno in una comunità open source sostenibile.
BIO: Sostenitrice del software libero e dei formati standard e aperti. È stata un membro attivo dei progetti Fedora e openSUSE e ha co-fondato l'Associazione LibreItalia dove è stata coinvolta in diversi eventi, migrazioni e formazione relativi a LibreOffice. In precedenza ha lavorato a migrazioni e corsi di formazione su LibreOffice per diverse amministrazioni pubbliche e privati. Da gennaio 2020 lavora in SUSE come Software Release Engineer per Uyuni e SUSE Manager e quando non segue la sua passione per i computer e per Geeko coltiva la sua curiosità per l'astronomia (da cui deriva il suo nickname deneb_alpha).
TrustArc Webinar - 2024 Global Privacy SurveyTrustArc
How does your privacy program stack up against your peers? What challenges are privacy teams tackling and prioritizing in 2024?
In the fifth annual Global Privacy Benchmarks Survey, we asked over 1,800 global privacy professionals and business executives to share their perspectives on the current state of privacy inside and outside of their organizations. This year’s report focused on emerging areas of importance for privacy and compliance professionals, including considerations and implications of Artificial Intelligence (AI) technologies, building brand trust, and different approaches for achieving higher privacy competence scores.
See how organizational priorities and strategic approaches to data security and privacy are evolving around the globe.
This webinar will review:
- The top 10 privacy insights from the fifth annual Global Privacy Benchmarks Survey
- The top challenges for privacy leaders, practitioners, and organizations in 2024
- Key themes to consider in developing and maintaining your privacy program
For the full video of this presentation, please visit: https://www.edge-ai-vision.com/2024/06/building-and-scaling-ai-applications-with-the-nx-ai-manager-a-presentation-from-network-optix/
Robin van Emden, Senior Director of Data Science at Network Optix, presents the “Building and Scaling AI Applications with the Nx AI Manager,” tutorial at the May 2024 Embedded Vision Summit.
In this presentation, van Emden covers the basics of scaling edge AI solutions using the Nx tool kit. He emphasizes the process of developing AI models and deploying them globally. He also showcases the conversion of AI models and the creation of effective edge AI pipelines, with a focus on pre-processing, model conversion, selecting the appropriate inference engine for the target hardware and post-processing.
van Emden shows how Nx can simplify the developer’s life and facilitate a rapid transition from concept to production-ready applications.He provides valuable insights into developing scalable and efficient edge AI solutions, with a strong focus on practical implementation.
UiPath Test Automation using UiPath Test Suite series, part 5DianaGray10
Welcome to UiPath Test Automation using UiPath Test Suite series part 5. In this session, we will cover CI/CD with devops.
Topics covered:
CI/CD with in UiPath
End-to-end overview of CI/CD pipeline with Azure devops
Speaker:
Lyndsey Byblow, Test Suite Sales Engineer @ UiPath, Inc.
Full-RAG: A modern architecture for hyper-personalizationZilliz
Mike Del Balso, CEO & Co-Founder at Tecton, presents "Full RAG," a novel approach to AI recommendation systems, aiming to push beyond the limitations of traditional models through a deep integration of contextual insights and real-time data, leveraging the Retrieval-Augmented Generation architecture. This talk will outline Full RAG's potential to significantly enhance personalization, address engineering challenges such as data management and model training, and introduce data enrichment with reranking as a key solution. Attendees will gain crucial insights into the importance of hyperpersonalization in AI, the capabilities of Full RAG for advanced personalization, and strategies for managing complex data integrations for deploying cutting-edge AI solutions.
HCL Notes and Domino License Cost Reduction in the World of DLAUpanagenda
Webinar Recording: https://www.panagenda.com/webinars/hcl-notes-and-domino-license-cost-reduction-in-the-world-of-dlau/
The introduction of DLAU and the CCB & CCX licensing model caused quite a stir in the HCL community. As a Notes and Domino customer, you may have faced challenges with unexpected user counts and license costs. You probably have questions on how this new licensing approach works and how to benefit from it. Most importantly, you likely have budget constraints and want to save money where possible. Don’t worry, we can help with all of this!
We’ll show you how to fix common misconfigurations that cause higher-than-expected user counts, and how to identify accounts which you can deactivate to save money. There are also frequent patterns that can cause unnecessary cost, like using a person document instead of a mail-in for shared mailboxes. We’ll provide examples and solutions for those as well. And naturally we’ll explain the new licensing model.
Join HCL Ambassador Marc Thomas in this webinar with a special guest appearance from Franz Walder. It will give you the tools and know-how to stay on top of what is going on with Domino licensing. You will be able lower your cost through an optimized configuration and keep it low going forward.
These topics will be covered
- Reducing license cost by finding and fixing misconfigurations and superfluous accounts
- How do CCB and CCX licenses really work?
- Understanding the DLAU tool and how to best utilize it
- Tips for common problem areas, like team mailboxes, functional/test users, etc
- Practical examples and best practices to implement right away
Sudheer Mechineni, Head of Application Frameworks, Standard Chartered Bank
Discover how Standard Chartered Bank harnessed the power of Neo4j to transform complex data access challenges into a dynamic, scalable graph database solution. This keynote will cover their journey from initial adoption to deploying a fully automated, enterprise-grade causal cluster, highlighting key strategies for modelling organisational changes and ensuring robust disaster recovery. Learn how these innovations have not only enhanced Standard Chartered Bank’s data infrastructure but also positioned them as pioneers in the banking sector’s adoption of graph technology.
1. Object Oriented Perl Overview
Review of references... example from hash of
hashes
Overview of why use objects (again)
Brian O'Connor Simple example, convert Lincoln's module to an
UCLA object-oriented module
boconnor@ucla.edu
What are objects really?
Inheritance
Simple inheritance example from Simon's code
The Long Way
Hash of Hashes Review
This is the long
(perhaps clearer)
Hash_1
$hash_ref value
way...
key (hash_ref) Hash_2
*
GeneA * key value
seq ccta...
GeneB *
length 67
GeneC *
gc% 52%
2. The Long Way
If we dump $data, which is a hashref, we get Hash of Hashes Review
the following:
$VAR1 = { Hash_1
'GeneC' => { $hash_ref value
'length' => 10, key (hash_ref) Hash_2
'gc' => '0.5',
*
'seq' => 'cccggattat' GeneA * key value
},
'GeneB' => { seq ccta...
'length' => 10,
'gc' => '0.5',
GeneB *
'seq' => 'cccggattat' length 67
},
'GeneA' => {
GeneC *
'length' => 10, gc% 52%
'gc' => '0.5',
'seq' => 'cccggattat'
}
};
The Short Way The Short Way
Compare that with the way I showed you You can see the structure produced is the same:
yesterday:
$VAR1 = {
'GeneC' => {
'length' => 10,
'gc' => '0.5',
'seq' => 'cccggattat'
},
'GeneB' => {
'length' => 10,
'gc' => '0.5',
'seq' => 'cccggattat'
},
'GeneA' => {
'length' => 10,
'gc' => '0.5',
'seq' => 'cccggattat'
}
};
3. Why Objects Why Object Oriented Perl?
Small App Small App
Small App
MONOLITHIC vs. Obj 1 Obj 3 Obj 1 Obj 3
Obj 2 Small App Obj 2
Look Inside an Object Modules vs. Objects
First, let's convert Lincoln's MySequence module
Obj1
from an earlier lecture to an object-oriented
module
method_1
The difference is pretty clear:
Data
method_2 modules let you import variables and subroutines into
your current program when you say “use”
method_3
objects are encapsulated, you get a reference to one
(usually using “new”) and call methods on them
directly
4. The Original Module Code to Call MySequence
the subroutines in this module are now available
in your code
Exporter
What we
export
Works as You Expect Conflicts
By saying use MySequence; all the subroutines What happens when you have conflicts for
and data MySequence exports is available within subroutines or variables?
your program
[boconnor@dhcp10-51 module]$ perl test.pl
original = gattccggatttccaaagggttcccaatttggg
complement = cccaaattgggaaccctttggaaatccggaatc
5. Conflicts
The Object Oriented Way
What happens when you have conflicts for
subroutines or variables?
Let's recode this as an object-oriented module
[boconnor@dhcp10-51 module]$ perl test.pl
Avoids pollution of your namespace
HI!! Key terms
original = gattccggatttccaaagggttcccaatttggg
complement = 1 abstraction
encapsulation
The new subroutine interferes with the
MySequence subroutine
Recall from Yesterday Recall from Yesterday
How to create an object from an Object Oriented How to then call methods on that object...
Module...
#!/usr/bin/perl -w $sequence->subseq(1,40);
use strict; $sequence->id();
use Bio::PrimarySeq; $sequence->desc();
my $sequence = Bio::PrimarySeq->new(
-seq => 'gattaca',
-id => 'oligo234',
-alphabet => 'dna'
);
6. The Original Module The Object Oriented Module
Need to When you make a method
call on an OO Module the
eliminate the first argument is the class
Exporter
code
Need to
include a
“new”
method
The Object Oriented Module The Object Oriented Module
You create a new hash bless associates this new
reference ($self) and this bit of memory with a class
will store all the objects type (i.e. package to call
data methods with)
7. What Does bless Mean? What Does bless Mean?
an example... in the debugger
an example...
$obj = { name => 'mini', color =>
$obj = { name => 'mini', color => 'yellow' };
'yellow' }; x $obj
print ref($obj), “ ”, $obj->{name}, “n”;
bless ($obj, “Fruit::Banana”); Fruit::Banana=HASH(0x8ec7980)
print ref($obj), “ ”, $obj->{name}, “n”; 'color' => 'yellow'
'name' => 'mini'
HASH mini
Fruit::Banana mini What is an object then? A
hashref that stores data and is
associated with a package
The Object Oriented Module The Object Oriented Module
The object is now created
and returned to the
program that called new.
When called in an object
context the object is
automatically passed in at
the first argument
8. What is $self? Code to Call MySequence
the actual object you're calling this method from Let's take a look at the code that uses the new OO
allows you to manipulate the data within that MySequence module
specific object instance (it's just a hashref)
compare this to new() and other method calls
like it
Output is Identical! Why Object Oriented Perl?
Identical output to the previous version
Small App
[boconnor@dhcp10-51 oo_module]$ perl test.pl Small App
original = gattccggatttccaaagggttcccaatttggg
complement = cccaaattgggaaccctttggaaatccggaatc
Obj 1 Obj 3
And you can create your own reversec subroutine log log
and not have it conflict with the MySequence Obj 2
Small App
method! log
9. Inheritance Inheritance
In this example every object has a log()
method Independent parent Base
& Redundant log
Wouldn't it be nice to only write this once?
becomes
Solution: Inheritance! Obj 1
log child Obj 1 Obj 2
Obj 2
log Neither actually
implements a log
method
More Generally Simon's Example: The Machines!
Let's take a look at the implementation of the
superclass Fruit name, color, shape
following hierarchy
isa
isa
Machine voltage
name, color, shape,
subclass Grape Banana peel
isa
isa
Think of Banana inherits voltage voltage
Refrigerator ATM
inheritance as an name, color & temp cash
“isa” relationship shape
banana adds peel
10. Simon's Example: The Machines! Simon's Example: The Machines!
We want to implement Machine and Refrigerator The means that we can create a Refrigerator
so that Machine defines the voltage() method object and call either voltage() or temp()
and Refrigerator defines the temp() method on it
Machine voltage Machine voltage
isa
isa
isa
isa
voltage voltage voltage voltage
Refrigerator ATM Refrigerator ATM
temp cash temp cash
Let's Start with test.pl Let's Start with test.pl
“use” what you want Always include a method to
to create before you create a new object.
call new Call it using this OOP syntax.
* differs from calling Machine::Refrigerator::new()
11. The Refrigerator The Refrigerator
Recall, the Refrigerator
needs to do 2 things for magic
the client:
get/set a temperature
get/set a voltage magic
The Refrigerator The Refrigerator
This says, use the Machine, as the root
“Machine” module class, handles the
as a base class. creation and
Everything a initialization of the
Machine can do so object via its new
can a Refrigerator. method. This is how
you call it.
12. The Machine
The Refrigerator
Call new() to Create a Refrigerator
magic
It returns a new object
of type
Machine::Refrigerator!!
magic
The Machine The Machine
Call new() to Create a Refrigerator Call new() to Create a Refrigerator
so the object ($self) is just
a reference to an empty
hash! Just like in the
How does it become a MySequence example,
Machine::Refrigerator? the bless command
associates a hashref with
a class
(Machine::Refrigerator
in this case)
13. The Refrigerator Finish back at test.pl
$r (a Machine::Refrigerator)
has both the voltage()
method (from Machine) and it's
Finish setting up own temp() method
Refrigerator
specific information
and return the new
object $self
Look at the Output Lessons
You can call both temp() and voltage() on When you call a method this way:
the $r object which is of type
Machine::Refrigerator->new(
Machine::Refrigerator temp => 20,
voltage => 110 );
my $self = $class->SUPER::new(@_);
[boconnor@dhcp10-51]$ perl test.pl
Start temp: 20
Start voltage: 110 The first var is a string of the class (package)
New temp: 45 name you're calling on... In both cases it's
“Machine::Refrigerator”
14. Lessons Lessons
When you call a method this way (through an The returned object is a bit of memory (a hashref)
object): associated with a given class and it's methods
$r->temp();
Here's a dump in the debugger of the $r object:
The first var is a reference to the object itself so
you can get/set data within it... it's just a
“blessed” hashref! DB<2> x $r
Machine::Refrigerator=HASH(0x94e3bd8)
sub temp { 'temp' => 20
my $self = shift;
'voltage' => 110
...
}
So Now You... For More Information
Can use references Perl Cookbook, Programming Perl
Can use other people's objects perlobj and perlref man pages
Can create objects of your own Google
Can create complex object trees through Simon's Object Tutorial, try implementing the
inheritance ATM class