1. The document discusses various molecular techniques used in nematode systematics, including nucleic acid extraction, amplification via PCR, restriction fragment analysis, DNA-DNA hybridization, and nucleotide sequencing.
2. Restriction fragment analysis techniques like RFLP, AFLP, and RAPD involve fragmenting DNA with restriction enzymes and comparing fragment patterns to determine relationships between taxa.
3. DNA-DNA hybridization and nucleotide sequencing provide more precise data for constructing phylogenetic trees and understanding evolutionary relationships between nematode species.
Isolation and characterization of a fungus for extracellular synthesis of sma...Nanomedicine Journal (NMJ)
Abstract
The use of biogenic selenium nanoparticles for various purposes is going to be an issue of considerable importance; thus, appropriate simple methods should be developed and tested for the synthesis and recovery of these nanoparticles. In this study, a fungus was isolated from a soil sample, identified as Aspergillus terreus and used for extracellular synthesis of selenium nanoparticles (Se NPs). UV–Vis spectroscopy and energy dispersive X-ray spectrum studies were carried out to confirm Se NPs formation within 60 min. Dynamic light scattering and scan electron microscopic methods were also used to characterize both size and shapes of the Se NPs. The results show that spherical particles with average size of 47 nm were formed by adding a culture supernatant of A. terreus to selenium ions solution. This approach appears to be an easy and appropriate method for extracellular synthesis of small Se NPs. Extracellular synthesis of small Se NPs has not been reported yet.
Modern cytogenetic tools in crop improvementShreyas A
it includes FISH, GISH and their recent modifications such as comparative genome hybridization, chromosome painting, spectral karyotyping, multicolour FISH, fiber FISH and Q-FISH
Isolation and characterization of a fungus for extracellular synthesis of sma...Nanomedicine Journal (NMJ)
Abstract
The use of biogenic selenium nanoparticles for various purposes is going to be an issue of considerable importance; thus, appropriate simple methods should be developed and tested for the synthesis and recovery of these nanoparticles. In this study, a fungus was isolated from a soil sample, identified as Aspergillus terreus and used for extracellular synthesis of selenium nanoparticles (Se NPs). UV–Vis spectroscopy and energy dispersive X-ray spectrum studies were carried out to confirm Se NPs formation within 60 min. Dynamic light scattering and scan electron microscopic methods were also used to characterize both size and shapes of the Se NPs. The results show that spherical particles with average size of 47 nm were formed by adding a culture supernatant of A. terreus to selenium ions solution. This approach appears to be an easy and appropriate method for extracellular synthesis of small Se NPs. Extracellular synthesis of small Se NPs has not been reported yet.
Modern cytogenetic tools in crop improvementShreyas A
it includes FISH, GISH and their recent modifications such as comparative genome hybridization, chromosome painting, spectral karyotyping, multicolour FISH, fiber FISH and Q-FISH
Personalized nanomedicine for the treatment of vascular hypertensionSusanta Kumar Rout
This study includes designing a nanomedical device for the treatment of vascular hypertension in polycystic kidney diseases (PKD) model through cilia targeting.
They generated and compared two different metal and polymer cilia-targeted nanoparticle drug delivery systems (DDS), i.e. gold (Au) and poly-lactic-co-glycolic acid (PLGA) nanoparticles (NPs)
The target is Dopamine-receptor type-5 (DRS) on primary cilia.
The drug-loaded is Fenoldopam (FD).
Techniques of DNA Extraction, Purification and QuantificationBHUMI GAMETI
Introduction
The overall process…
Uses of isolated genomic DNA
Extraction of DNA from plant material
Components of DNA extraction solutions
Cell Lysis or Cell disruption :
Purification of DNA
CTAB Method
Phenol–chloroform extraction
PROTEINASE K
Salting out
Silica adsorption method
Magnetic beads
FTA Paper
Nucleic acid quantification
Agarose Gel Electrophoresis
UV spectroscopy
DNA quantification using NanoDrop
this section helps students how to quanify the isolated DNA by spectrophotometer. specially life life science fields such as biotechnology, biology, and medical laboratory
Isolation and Purification of Chromosomal DNA,Plasmid DNA,Bacteriophage DNA used in Recombinant DNA Technology or Biotechnology to produce Recombinant DNA or Desired DNA
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
Abstract
Objective(s):
Biosynthesis of gold nanoparticles (NGPs) is environmentally safer than chemical and physical procedures. This method requires no use of toxic solvents and synthesis of dangerous products and is environmentally safe. In this study, we report the biosynthesis of NGPs using Streptomyces djakartensis
isolate B-5.
Materials and Methods:
NGPs were biosynthesized by reducing aqueous gold chloride solution via a Streptomyces isolate without the need for any additive for protecting nanoparticles from aggregation. We characterized the responsible Streptomycete; its genome DNA was isolated, purified and 16S rRNA was amplified by PCR. The amplified isolate was sequenced; using the BLAST search tool from NCBI, the microorganism was identified to species level.
Results:
Treating chloroauric acid solutions with this bacterium resulted in reduction of gold ions and formation of stable NGPs. TEM and SEM electro micrographs of NGPs indicated size range from 2- 25 nm with average of 9.09 nm produced intracellular by the bacterium. SEM electro micrographs revealed morphology of spores and mycelia. The amplified PCR fragment of 16S rRNA gene was cloned and sequenced from both sides; it consisted of 741 nucleotides. According to NCBI GenBank, the bacterium had 97.1% homology with Streptomyces djakartensis strain RT-49. The GenBank accession number for partial 16S rRNA gene was recorded as JX162550.
Conclusion:
Optimized application of such findings may create applications of Streptomycetes for use as bio-factories in eco-friendly production of NGPs to serve in demanding industries and related biomedical areas. Research in this area should also focus on the unlocking the full mechanism of NGPs biosynthesis by Streptomycetes.
The International Journal of Engineering and Science (IJES)theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
The methods used for DNA finger printing are the same Molecular markers...so for detailed note on the steps which is explained in DNA typing can be used to study the performance pf markers too...
An honest effort to present molecular marker in easiest way both informative and conceptual. Hybridization based (non-PCR) and PCR based markers are discussed to the point with suitable diagram.
Personalized nanomedicine for the treatment of vascular hypertensionSusanta Kumar Rout
This study includes designing a nanomedical device for the treatment of vascular hypertension in polycystic kidney diseases (PKD) model through cilia targeting.
They generated and compared two different metal and polymer cilia-targeted nanoparticle drug delivery systems (DDS), i.e. gold (Au) and poly-lactic-co-glycolic acid (PLGA) nanoparticles (NPs)
The target is Dopamine-receptor type-5 (DRS) on primary cilia.
The drug-loaded is Fenoldopam (FD).
Techniques of DNA Extraction, Purification and QuantificationBHUMI GAMETI
Introduction
The overall process…
Uses of isolated genomic DNA
Extraction of DNA from plant material
Components of DNA extraction solutions
Cell Lysis or Cell disruption :
Purification of DNA
CTAB Method
Phenol–chloroform extraction
PROTEINASE K
Salting out
Silica adsorption method
Magnetic beads
FTA Paper
Nucleic acid quantification
Agarose Gel Electrophoresis
UV spectroscopy
DNA quantification using NanoDrop
this section helps students how to quanify the isolated DNA by spectrophotometer. specially life life science fields such as biotechnology, biology, and medical laboratory
Isolation and Purification of Chromosomal DNA,Plasmid DNA,Bacteriophage DNA used in Recombinant DNA Technology or Biotechnology to produce Recombinant DNA or Desired DNA
DNA Barcoding of Stone Fish Uranoscopus Oligolepis: Intra Species Delineation...journal ijrtem
Abstract: The present study addresses this issue by examining the patterning of Cytochrome Oxidase I diversity in the stone fish Uranoscopus oligolepis the structurally diverse group of Family Uranoscopidae. The sequences were analyzed for their species identification using BOLD’s identification engine. The COI sequences of U. oligolepis from different geographical regions were extracted from NCBI for intra species variation analysis. All sequences were aligned using Clustal W. The sequences were trimmed using software and phylogenetic tree was constructed with bootstrap test. The results showed that the cytosine content was high (31%). The least molar concentration was observed in guanine (19.5%) and Adenine (19.6%). Thymine was the second predominant in molar concentration next to thymine which is followed by adenine. The G+C content was found to be 49.6% and A+T content was 50.4%. Leucine and Alanine content was high in the amino acid composition. From the study it is assumed that the mitochondrial gene COI can be the potential barcoding region to identify an organism up to the species level. Keywords: COI, intra species, Uranoscopus oligolepis, barcoding, phylogenetic
Abstract
Objective(s):
Biosynthesis of gold nanoparticles (NGPs) is environmentally safer than chemical and physical procedures. This method requires no use of toxic solvents and synthesis of dangerous products and is environmentally safe. In this study, we report the biosynthesis of NGPs using Streptomyces djakartensis
isolate B-5.
Materials and Methods:
NGPs were biosynthesized by reducing aqueous gold chloride solution via a Streptomyces isolate without the need for any additive for protecting nanoparticles from aggregation. We characterized the responsible Streptomycete; its genome DNA was isolated, purified and 16S rRNA was amplified by PCR. The amplified isolate was sequenced; using the BLAST search tool from NCBI, the microorganism was identified to species level.
Results:
Treating chloroauric acid solutions with this bacterium resulted in reduction of gold ions and formation of stable NGPs. TEM and SEM electro micrographs of NGPs indicated size range from 2- 25 nm with average of 9.09 nm produced intracellular by the bacterium. SEM electro micrographs revealed morphology of spores and mycelia. The amplified PCR fragment of 16S rRNA gene was cloned and sequenced from both sides; it consisted of 741 nucleotides. According to NCBI GenBank, the bacterium had 97.1% homology with Streptomyces djakartensis strain RT-49. The GenBank accession number for partial 16S rRNA gene was recorded as JX162550.
Conclusion:
Optimized application of such findings may create applications of Streptomycetes for use as bio-factories in eco-friendly production of NGPs to serve in demanding industries and related biomedical areas. Research in this area should also focus on the unlocking the full mechanism of NGPs biosynthesis by Streptomycetes.
The International Journal of Engineering and Science (IJES)theijes
The International Journal of Engineering & Science is aimed at providing a platform for researchers, engineers, scientists, or educators to publish their original research results, to exchange new ideas, to disseminate information in innovative designs, engineering experiences and technological skills. It is also the Journal's objective to promote engineering and technology education. All papers submitted to the Journal will be blind peer-reviewed. Only original articles will be published.
The methods used for DNA finger printing are the same Molecular markers...so for detailed note on the steps which is explained in DNA typing can be used to study the performance pf markers too...
An honest effort to present molecular marker in easiest way both informative and conceptual. Hybridization based (non-PCR) and PCR based markers are discussed to the point with suitable diagram.
DNA Fingerprinting & its techniques by Shiv Kalia (M.Pharma in Analytical Che...Shiv Kalia
DNA fingerprinting and below mention content widely cover in this presentation
History & Introduction of DNA fingerprinting
How was the first DNA fingerprint produced?
Types of DNA Based Markers
Polymerase Chain Reaction (PCR)
PCR based Methodology of DNA fingerprinting
Electrophoresis
Utility of DNA Based Markers
Various DNA Fingerprinting Techniques Advantages & Disadvantages
Authentication of Various Ayurvedic Herbs by DNA Fingerprinting
Advantages of DNA fingerprinting in Plants
Disadvantages of DNA fingerprinting in Plants
CONCLUSION
this presentation is about the molecular markers as we all know the molecular markers are the DNA sequences it can be easily detected and its inheritance is easily monitored.so the main basics of the molecular markers is the polymorphic nature so it can used as molecular markers.and this will gives you the idea about AFLP, RFLP, RAPD, SNPS,ETC.
Restriction fragment length polymorphism (abbreviated RFLP) refers to differences (or variations) among people in their DNA sequences at sites recognized by restriction enzymes. Such variation results in different sized (or length) DNA fragments produced by digesting the DNA with a restriction enzyme.
RAPD markers are decamer DNA fragments.
RAPD is a type of PCR reaction.
as the name suggest it is a fast method when compared to the traditional PCR medthod.
Taxonomy is the branch of science concerned with the classification of organisms. A taxonomic designation is more than just a name. Ideally, it reflects evolutionary history and the relationship between organisms. Traditionally, taxonomic classification has relied upon morphological features and physiological characteristics. However, for bacterial taxonomy, phenotypic approaches have proven insufficient. Unrelated bacteria can exhibit identical traits, closely related bacteria can have divergent features, and methods for accurate identification may be too cumbersome for routine use. In contrast, molecular taxonomy approaches use data derived from hereditary material and provide a robust view of genetic relatedness. Advances in technology have been accompanied by improvements in the cost, speed, and availability of molecular methods. Here, we provide a brief history of approaches to prokaryotic classification and describe how molecular taxonomy is redefining our understanding of bacterial evolution and the tree of life.
Similar to Nuclic acid analysis in nematode systematic (20)
Jennifer Schaus and Associates hosts a complimentary webinar series on The FAR in 2024. Join the webinars on Wednesdays and Fridays at noon, eastern.
Recordings are on YouTube and the company website.
https://www.youtube.com/@jenniferschaus/videos
Presentation by Jared Jageler, David Adler, Noelia Duchovny, and Evan Herrnstadt, analysts in CBO’s Microeconomic Studies and Health Analysis Divisions, at the Association of Environmental and Resource Economists Summer Conference.
Jennifer Schaus and Associates hosts a complimentary webinar series on The FAR in 2024. Join the webinars on Wednesdays and Fridays at noon, eastern.
Recordings are on YouTube and the company website.
https://www.youtube.com/@jenniferschaus/videos
Russian anarchist and anti-war movement in the third year of full-scale warAntti Rautiainen
Anarchist group ANA Regensburg hosted my online-presentation on 16th of May 2024, in which I discussed tactics of anti-war activism in Russia, and reasons why the anti-war movement has not been able to make an impact to change the course of events yet. Cases of anarchists repressed for anti-war activities are presented, as well as strategies of support for political prisoners, and modest successes in supporting their struggles.
Thumbnail picture is by MediaZona, you may read their report on anti-war arson attacks in Russia here: https://en.zona.media/article/2022/10/13/burn-map
Links:
Autonomous Action
http://Avtonom.org
Anarchist Black Cross Moscow
http://Avtonom.org/abc
Solidarity Zone
https://t.me/solidarity_zone
Memorial
https://memopzk.org/, https://t.me/pzk_memorial
OVD-Info
https://en.ovdinfo.org/antiwar-ovd-info-guide
RosUznik
https://rosuznik.org/
Uznik Online
http://uznikonline.tilda.ws/
Russian Reader
https://therussianreader.com/
ABC Irkutsk
https://abc38.noblogs.org/
Send mail to prisoners from abroad:
http://Prisonmail.online
YouTube: https://youtu.be/c5nSOdU48O8
Spotify: https://podcasters.spotify.com/pod/show/libertarianlifecoach/episodes/Russian-anarchist-and-anti-war-movement-in-the-third-year-of-full-scale-war-e2k8ai4
ZGB - The Role of Generative AI in Government transformation.pdfSaeed Al Dhaheri
This keynote was presented during the the 7th edition of the UAE Hackathon 2024. It highlights the role of AI and Generative AI in addressing government transformation to achieve zero government bureaucracy
Jennifer Schaus and Associates hosts a complimentary webinar series on The FAR in 2024. Join the webinars on Wednesdays and Fridays at noon, eastern.
Recordings are on YouTube and the company website.
https://www.youtube.com/@jenniferschaus/videos
This session provides a comprehensive overview of the latest updates to the Uniform Administrative Requirements, Cost Principles, and Audit Requirements for Federal Awards (commonly known as the Uniform Guidance) outlined in the 2 CFR 200.
With a focus on the 2024 revisions issued by the Office of Management and Budget (OMB), participants will gain insight into the key changes affecting federal grant recipients. The session will delve into critical regulatory updates, providing attendees with the knowledge and tools necessary to navigate and comply with the evolving landscape of federal grant management.
Learning Objectives:
- Understand the rationale behind the 2024 updates to the Uniform Guidance outlined in 2 CFR 200, and their implications for federal grant recipients.
- Identify the key changes and revisions introduced by the Office of Management and Budget (OMB) in the 2024 edition of 2 CFR 200.
- Gain proficiency in applying the updated regulations to ensure compliance with federal grant requirements and avoid potential audit findings.
- Develop strategies for effectively implementing the new guidelines within the grant management processes of their respective organizations, fostering efficiency and accountability in federal grant administration.
Donate to charity during this holiday seasonSERUDS INDIA
For people who have money and are philanthropic, there are infinite opportunities to gift a needy person or child a Merry Christmas. Even if you are living on a shoestring budget, you will be surprised at how much you can do.
Donate Us
https://serudsindia.org/how-to-donate-to-charity-during-this-holiday-season/
#charityforchildren, #donateforchildren, #donateclothesforchildren, #donatebooksforchildren, #donatetoysforchildren, #sponsorforchildren, #sponsorclothesforchildren, #sponsorbooksforchildren, #sponsortoysforchildren, #seruds, #kurnool
A process server is a authorized person for delivering legal documents, such as summons, complaints, subpoenas, and other court papers, to peoples involved in legal proceedings.
2. CREDIT SEMINAR
NUCLEIC ACID ANALYSIS IN NEMATODE
SYSTEMATICS
Presented By:
Mahnur Ali
A.A.U.
Deptt. of Nematology.
3. Introduction
Pathway to Molecular Diagnostics
Molecular identification & Morphological
identification
Steps involve in nucleic acid analysis
Extraction, Quantification, Amplification,
Separation, Analysis and interpretation
Utilization of different molecular
techniques for nematode systematic
Summary
.
4. INTRODUCTION
Due to release of various metabolites by different (host &
non-host) crops and environmental effects there may be
change in the morphological characteristic of nematodes.
To reveal the actual variation and true identification, nucleic
acid analysis is important.
Variation present in nucleotide sequence cannot be observe
under microscope.
6. .
.
Pathway to Molecular Diagnostics
1865 – G. Mendel, Law of Heredity
1866 –Johann Miescher, , Purification of DNA
1953 – Watson and Crick, Structure of DNA
1977 – DNA sequencing
1985 – Kary Mullis, in vitro Amplification of
DNA (PCR)
1998 – C. elegans the first multi-
cellular organism sequenced
7. Why Molecular Identification ?
. Morphological Identification Molecular Identification
Set-up cost Low High
Long-term cost High Low
Employee requirement Highly trained, experienced Minimal training
Length of process Slower More rapid
Morphological characters Variable NA
Females required Yes No
Mixed species
populations
Difficult to distinguish No
8. STEPS INVOLVE IN NUCLEIC ACID
ANALYSIS
Extraction and isolation of DNA
Quantification
Amplification by PCR
Techniques used
Analysis and & interpretation
9. Extraction of DNA from Nematodes
.
Single nematode
Entire communityMultiple nematode (~25)
Extraction from soil
10. Extraction of DNA from Nematodes
Single/Multiple Nematodes Nematode Community Nematodes in Soil
Cut nematodes with
scalpel to disrupt cuticle
Use a bead beater to disrupt
nematode cuticle
Kit that contains beads
(Powersoil, Powermax)
Use Nematode Extraction
Buffer which includes
Proteinase K
Use Nematode Extraction
Buffer which includes
Proteinase K
Place soil directly
in tube
Cooling and heating steps
required
Cooling and heating steps
required
Follow recipe
11. AMPLIFICATION BY PCR
5’
3’
3’
5’
Target
1. Denature
2. Anneal primers
3. Extend primers
Two copies
of target
1. Denature
2. Anneal primers
3. Extend primers
Four copies
of target
13. 1.Restriction Fragment Analysis
• This technique uses restriction enzymes to cleave DNA at
specific sites along the DNA molecule.
• Enzyme will digest DNA at specific sequence to generate
fragments of DNA
• Fragments are separated through gel electrophoresis.
• The banding patterns are visualized under florescent stain
(ethidium bromid) or by autoradiography.
14. Techniques involved in Restriction
Fragment Analysis
1. RFLP ( Restriction Fragment Length Polymorphism )
2. RAPD ( Random Amplified Polymorphic DNA )
3. AFLP ( Amplified Fragment Length Polymorphism )
RFLPs involves fragmenting
a sample of DNA by a
restriction enzyme, which can
recognize and cut DNA
wherever a specific short
sequence occurs.
A RFLP occurs when the
length of a detected fragment
varies between individuals.
PCR based product but
the segments of DNA that
are amplified are random
we can amplify restricted
fragments and reduces the
complexity of material to be
analyzed (approx 1000
folds).
it can be used for
comparison between closely
related species only.
1 32
15. Enzyme Site Recognition in
RFLP
.
Restriction site Palindrome
Fragment 1 Fragment 2
• enzyme will digests (cuts) DNA at a
specific sequence = restriction site
• Enzymes recognize 4- or 6- base
pair, palindromic sequences
(e.g. GAATTC)
16. .
Power Supply
Agarose gel
Electrophoresis
Electrical current
carries negatively-
charged DNA
through gel
towards positive
(red) electrode.
Small fragments
move faster than
large fragments
.
Gel running
17. .
.
Utilisation of different techniques for
Restriction Fragment Analysis
Method use limitations Application example
1. RFLP
-Suited to differentiate
between closely related
taxa based on presence/
absence of restriction
fragment bands
-Lacks homology of
characters
- Requires large amounts of
PCR products to use for
different restriction
enzymes
-Detection of population within
Steinernema spp. (Curran et al. 1985,
(Oliveira et al., 2006; Barsi et al.,
2008).
2.AFLP -Suited to assess variation
among individuals of the
same species
-Lengthy procedure -Detection of species in Heterodera
avenae group (Subbotin et al.,
1999),.study of intra specific variation
in Radopholus similes (Elbadri et al.,
2002).
3.RAPD - Unlike AFLP this
method doesn’t require a
restriction step
- Simple and rapid
- Sensitive to variations in
primer and DNA
concentration
-Detection of Globodera
rostochiensis,G. pallida, Meloidogyne
incognita, M. javanica, and M.
arenaria. (Fullaondo et al., 1999;
Zijlstra et al. 2000)
19. Extracted DNA
..
DNA Samples
Separated strands
allow to Cool or ( re-anneal )
Heated
Low Tm=not closely related High Tm= closely related
0% homology
100% homology
M. hapla from M. arenaria , M. incognita M. Javanica
(C. Sereno, 2006 )
20. Process of determining precise order of nucleotides
within a DNA molecule.
Sequencing is done
NUCLEOTIDE SEQUENCING
To confirm the identity of genes isolated by hybridization or
amplified PCR.
For determine the DNA sequence of promoters and other
regulatory sequence.
Reveal the fine structure of genes and other DNA.
To confirm the sequence of cDNA .
To identify mutation.
21. METHOD
Principle- Use of dideoxynucleotide triphosphate
(ddNTP’s) as DNA chain terminator.
Method requires :-
1. Single stranded DNA template.
2. DNA primer.
3. DNA polymerase.
4. Normal dideoxynucleotide phosphates (dNTP’s ).
5. Modified nucleotides (ddNTP’s) that terminate DNA
strand elongation.
Chain-termination
method(Sanger method). F. Sanger in 1977By
23. .
1 2 3 4
3’
5’
T
G
G
T
A
C
G
Position of nucleotides from 5’ to 3’
24. .
Method Use Limitations Application example
DNA
Sequencing
Variation in primer
and DNA
concentration, DNA
template quality, gel
electrophoresis, and
the type of DNA
polymerase) can be
controlled and the
sequencing step can
be optimized.
- Fast and accurate
Difficult in finding
an ideal gene for
phylogenetic
inference , that
works in all
nematode groups.
Choice of marker is
still an open issue.
Used in case of family
Hoplolaimidae,
(Subbotin et al., 2007),
order Tylenchida
(Subbotin et al., 2006),
suborder
Criconematina (Subbotin
et al., 2005),
suborder Cephalobina
(Nadler et al.,2006) , .
25. .
,
M. arenaria TCGGCGATAGAGGTAAATGAC
TCGAGGGCATCTAATAAAGG
420 bp
950bp
Zijlstra et al., 2000
Dong et al., 2001
M. chitwoodi CCAATGATAGAGATAGGAAC
GATCTATGGCAGATGGTATGGA
TGGAGAGCAGCAGGAGAAAGA
400 bp
900 bp
800 bp
Williamson et al., 1997
Petersen et al., 1997
Zijlstra, 2000
M. exigua CATCCGTGCTGTAGCTGCGAG
CTCCGTGGGAAGAAAGACTG
562 bp Randig et al., 2002
M. hapla CAGGCCCTTCCAGCTAAAGA
TGACGGCGGTGAGTGCGA
GGCTGAGCATAGTAGATGATGTT
GGATGGCGTGCTTTCAAC
960 bp
610 bp
1500 bp
440 bp
Williamson et al., 1997
Zijlstra, 2000
Dong et al., 2001bp
Wishart et al., 2002
M. incognita CTCTGCCCAATGAGCTGTCC
TAGGCAGTAGGTTGTCGGG
GGGATGTGTAAATGCTCCTG
GTGAGGATTCAGCTCCCCAG
1200 bp
1350 bp
399 bp
955 bp
Zijlstra et al., 2000
Dong et al., 2001
Randig et al., 2002
Meng et al., 2004
M. javanica CCTTAATGTCAACACTAGAGCC
GGTGCGCGATTGAACTGAGC
ACGCTAGAATTCGACCCTGG
1650 bp
670 bp
519 bp
Dong et al., 2001b
Zijlstra et al., 2000
Meng et al., 2004
M. mayaguensis GAAATTGCTTTATTGTTACTAAG 322 bp Blok et al., 2002
M. naasi CTCTTTATGGAGAATAATCGT 433 bp Zijlstra et al., 2004
M. paranaensis GCCCGACTCCATTTGACGGA 208 bp Randig et al., 2002
Species Primer set ( 5’-3’ ) Amplicon length Reference
26. SUMMARY
Molecular techniques in the field of biology has helped
us to get the accurate identification of nematode
species and to detect the smallest variations within
species and even within individual strains.
One can see the degree of relationship among
different species of nematodes by hybridization
technique.
Nucleotide sequencing methods are most informative
in the study of systematic of nematode species. The
data obtained from such studies are used to construct
phylogenetic trees
27. Traditional methods are although important
but molecular evidences could be final or
confirmatory evidences.
Gel electrophoresis can separate fragments of
DNA on the basis of their sizes, base pair and
form a useful method to characterize nematode
species.
By comparing the base sequences of nematode
species, one can determine the exact number of
mutational variations.
.