Downloaded 12 times
Uploaded bySeven Sisters Development Organisation
Nuclic acid analysis in nematode systematic
1. The document discusses various molecular techniques used in nematode systematics, including nucleic acid extraction, amplification via PCR, restriction fragment analysis, DNA-DNA hybridization, and nucleotide sequencing. 2. Restriction fragment analysis techniques like RFLP, AFLP, and RAPD involve fragmenting DNA with restriction enzymes and comparing fragment patterns to determine relationships between taxa. 3. DNA-DNA hybridization and nucleotide sequencing provide more precise data for constructing phylogenetic trees and understanding evolutionary relationships between nematode species.
More Related Content
Similar to Nuclic acid analysis in nematode systematic
Nuclic acid analysis in nematode systematic
- 1.
- 2. CREDIT SEMINAR NUCLEIC ACIDANALYSIS IN NEMATODE SYSTEMATICS Presented By: Mahnur Ali A.A.U. Deptt. of Nematology.
- 3. Introduction Pathway to MolecularDiagnostics Molecular identification & Morphological identification Steps involve in nucleic acid analysis Extraction, Quantification, Amplification, Separation, Analysis and interpretation Utilization of different molecular techniques for nematode systematic Summary .
- 4. INTRODUCTION Due torelease of various metabolites by different (host & non-host) crops and environmental effects there may be change in the morphological characteristic of nematodes. To reveal the actual variation and true identification, nucleic acid analysis is important. Variation present in nucleotide sequence cannot be observe under microscope.
- 5. . NUCLEIC ACIDS DNA RNA Genome sizes Caenorhabditiselegens = 100 MB Meloidogyne incognita = 82 MB Meloidogyne hapla = 54 MB •Nucleic acids are polymers •Nucleotides are monomers Nitrogenous bases -Purines -Pyrimidine Sugar -Ribose -Deoxyribose Phosphates + Nucleoside=Nucleotides Nucleosides
- 6. . . Pathway to MolecularDiagnostics 1865 – G. Mendel, Law of Heredity 1866 –Johann Miescher, , Purification of DNA 1953 – Watson and Crick, Structure of DNA 1977 – DNA sequencing 1985 – Kary Mullis, in vitro Amplification of DNA (PCR) 1998 – C. elegans the first multi- cellular organism sequenced
- 7. Why Molecular Identification? . Morphological Identification Molecular Identification Set-up cost Low High Long-term cost High Low Employee requirement Highly trained, experienced Minimal training Length of process Slower More rapid Morphological characters Variable NA Females required Yes No Mixed species populations Difficult to distinguish No
- 8. STEPS INVOLVE INNUCLEIC ACID ANALYSIS Extraction and isolation of DNA Quantification Amplification by PCR Techniques used Analysis and & interpretation
- 9. Extraction of DNAfrom Nematodes . Single nematode Entire communityMultiple nematode (~25) Extraction from soil
- 10. Extraction of DNAfrom Nematodes Single/Multiple Nematodes Nematode Community Nematodes in Soil Cut nematodes with scalpel to disrupt cuticle Use a bead beater to disrupt nematode cuticle Kit that contains beads (Powersoil, Powermax) Use Nematode Extraction Buffer which includes Proteinase K Use Nematode Extraction Buffer which includes Proteinase K Place soil directly in tube Cooling and heating steps required Cooling and heating steps required Follow recipe
- 11. AMPLIFICATION BY PCR 5’ 3’ 3’ 5’ Target 1.Denature 2. Anneal primers 3. Extend primers Two copies of target 1. Denature 2. Anneal primers 3. Extend primers Four copies of target
- 12. Restriction Fragment Analysis Nucleic acids analysis techniques DNA-DNA Hybridization NucleotideSequencing For systematics Divided into 1. 3. 2.
- 13. 1.Restriction Fragment Analysis •This technique uses restriction enzymes to cleave DNA at specific sites along the DNA molecule. • Enzyme will digest DNA at specific sequence to generate fragments of DNA • Fragments are separated through gel electrophoresis. • The banding patterns are visualized under florescent stain (ethidium bromid) or by autoradiography.
- 14. Techniques involved inRestriction Fragment Analysis 1. RFLP ( Restriction Fragment Length Polymorphism ) 2. RAPD ( Random Amplified Polymorphic DNA ) 3. AFLP ( Amplified Fragment Length Polymorphism ) RFLPs involves fragmenting a sample of DNA by a restriction enzyme, which can recognize and cut DNA wherever a specific short sequence occurs. A RFLP occurs when the length of a detected fragment varies between individuals. PCR based product but the segments of DNA that are amplified are random we can amplify restricted fragments and reduces the complexity of material to be analyzed (approx 1000 folds). it can be used for comparison between closely related species only. 1 32
- 15. Enzyme Site Recognitionin RFLP . Restriction site Palindrome Fragment 1 Fragment 2 • enzyme will digests (cuts) DNA at a specific sequence = restriction site • Enzymes recognize 4- or 6- base pair, palindromic sequences (e.g. GAATTC)
- 16. . Power Supply Agarose gel Electrophoresis Electrical current carries negatively- charged DNA through gel towards positive (red) electrode. Small fragments move faster than large fragments . Gel running
- 17. . . Utilisation of differenttechniques for Restriction Fragment Analysis Method use limitations Application example 1. RFLP -Suited to differentiate between closely related taxa based on presence/ absence of restriction fragment bands -Lacks homology of characters - Requires large amounts of PCR products to use for different restriction enzymes -Detection of population within Steinernema spp. (Curran et al. 1985, (Oliveira et al., 2006; Barsi et al., 2008). 2.AFLP -Suited to assess variation among individuals of the same species -Lengthy procedure -Detection of species in Heterodera avenae group (Subbotin et al., 1999),.study of intra specific variation in Radopholus similes (Elbadri et al., 2002). 3.RAPD - Unlike AFLP this method doesn’t require a restriction step - Simple and rapid - Sensitive to variations in primer and DNA concentration -Detection of Globodera rostochiensis,G. pallida, Meloidogyne incognita, M. javanica, and M. arenaria. (Fullaondo et al., 1999; Zijlstra et al. 2000)
- 18. . . 2.DNA-DNA HYBRIDIZATION What is it? Whatit does? Why it is done?
- 19. Extracted DNA .. DNA Samples Separatedstrands allow to Cool or ( re-anneal ) Heated Low Tm=not closely related High Tm= closely related 0% homology 100% homology M. hapla from M. arenaria , M. incognita M. Javanica (C. Sereno, 2006 )
- 20. Process of determiningprecise order of nucleotides within a DNA molecule. Sequencing is done NUCLEOTIDE SEQUENCING To confirm the identity of genes isolated by hybridization or amplified PCR. For determine the DNA sequence of promoters and other regulatory sequence. Reveal the fine structure of genes and other DNA. To confirm the sequence of cDNA . To identify mutation.
- 21. METHOD Principle- Useof dideoxynucleotide triphosphate (ddNTP’s) as DNA chain terminator. Method requires :- 1. Single stranded DNA template. 2. DNA primer. 3. DNA polymerase. 4. Normal dideoxynucleotide phosphates (dNTP’s ). 5. Modified nucleotides (ddNTP’s) that terminate DNA strand elongation. Chain-termination method(Sanger method). F. Sanger in 1977By
- 22. . Complementary strand Template strand3’ 3’5’ 5’ primer 5’3’ 1.DNA polymerase 2. dNTP’s 3. ddNTP’s + Dideoxy ATP + Dideoxy TTP + Dideoxy CTP + Dideoxy GTP DNA strand
- 23. . 1 2 34 3’ 5’ T G G T A C G Position of nucleotides from 5’ to 3’
- 24. . Method Use LimitationsApplication example DNA Sequencing Variation in primer and DNA concentration, DNA template quality, gel electrophoresis, and the type of DNA polymerase) can be controlled and the sequencing step can be optimized. - Fast and accurate Difficult in finding an ideal gene for phylogenetic inference , that works in all nematode groups. Choice of marker is still an open issue. Used in case of family Hoplolaimidae, (Subbotin et al., 2007), order Tylenchida (Subbotin et al., 2006), suborder Criconematina (Subbotin et al., 2005), suborder Cephalobina (Nadler et al.,2006) , .
- 25. . , M. arenaria TCGGCGATAGAGGTAAATGAC TCGAGGGCATCTAATAAAGG 420bp 950bp Zijlstra et al., 2000 Dong et al., 2001 M. chitwoodi CCAATGATAGAGATAGGAAC GATCTATGGCAGATGGTATGGA TGGAGAGCAGCAGGAGAAAGA 400 bp 900 bp 800 bp Williamson et al., 1997 Petersen et al., 1997 Zijlstra, 2000 M. exigua CATCCGTGCTGTAGCTGCGAG CTCCGTGGGAAGAAAGACTG 562 bp Randig et al., 2002 M. hapla CAGGCCCTTCCAGCTAAAGA TGACGGCGGTGAGTGCGA GGCTGAGCATAGTAGATGATGTT GGATGGCGTGCTTTCAAC 960 bp 610 bp 1500 bp 440 bp Williamson et al., 1997 Zijlstra, 2000 Dong et al., 2001bp Wishart et al., 2002 M. incognita CTCTGCCCAATGAGCTGTCC TAGGCAGTAGGTTGTCGGG GGGATGTGTAAATGCTCCTG GTGAGGATTCAGCTCCCCAG 1200 bp 1350 bp 399 bp 955 bp Zijlstra et al., 2000 Dong et al., 2001 Randig et al., 2002 Meng et al., 2004 M. javanica CCTTAATGTCAACACTAGAGCC GGTGCGCGATTGAACTGAGC ACGCTAGAATTCGACCCTGG 1650 bp 670 bp 519 bp Dong et al., 2001b Zijlstra et al., 2000 Meng et al., 2004 M. mayaguensis GAAATTGCTTTATTGTTACTAAG 322 bp Blok et al., 2002 M. naasi CTCTTTATGGAGAATAATCGT 433 bp Zijlstra et al., 2004 M. paranaensis GCCCGACTCCATTTGACGGA 208 bp Randig et al., 2002 Species Primer set ( 5’-3’ ) Amplicon length Reference
- 26. SUMMARY Molecular techniques inthe field of biology has helped us to get the accurate identification of nematode species and to detect the smallest variations within species and even within individual strains. One can see the degree of relationship among different species of nematodes by hybridization technique. Nucleotide sequencing methods are most informative in the study of systematic of nematode species. The data obtained from such studies are used to construct phylogenetic trees
- 27. Traditional methodsare although important but molecular evidences could be final or confirmatory evidences. Gel electrophoresis can separate fragments of DNA on the basis of their sizes, base pair and form a useful method to characterize nematode species. By comparing the base sequences of nematode species, one can determine the exact number of mutational variations. .
- 28.