Carnosic acid (CA) is a bioactive molecule found in rosemary and sage plants that has antioxidant and anticancer properties. This study examined the effects of CA on glioblastoma (GBM) cells. The results showed that CA decreased cell survival of GBM cells in a dose-dependent manner by inducing G2 cell cycle arrest and apoptosis. CA modulated key signaling pathways involved in proliferation and survival, including decreasing phosphorylation of STAT3 and AKT. It also promoted proteasomal degradation of proteins important for proliferation like SOX2 and GFAP. However, CA failed to degrade MYC. In conclusion, CA has potential as an anticancer agent for GBM but its clinical potential is limited as it cannot
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...BiologInc
[Biolog Webinar] Dr. Luigi Boccuto's presentation of his investigation of the pathogenic mechanisms of segmental overgrowth caused by mosaic mutations in the genes of the PI3K-AKT pathway. He will describe how Biolog Phenotype MicroArray™ Technology is used to identify new treatment targets and test compounds with potential therapeutic effects.
Molecular signaling involved in breast cancerainnie babarrr
Molecular signaling is very important to predict patient's clinical outcome. HER signaling is most important one, by its regulation cascade of pathways started. So, by understanding proteins over-expression we can target with inhibitors to suppress particular protein, which will results in treatment of breast cancer or Drug discovery.
Activation of AMPK inhibits cervical cancer cell growth through AKT/FOXO3a/FO...Enrique Moreno Gonzalez
Although advanced-stage cervical cancer can benefit from current treatments, approximately 30% patients may fail after definitive treatment eventually. Therefore, exploring alternative molecular therapeutic approaches is imperatively needed for this disease. We have recently shown that activation of AMP-activated protein kinase (AMPK), a metabolic sensor, hampers cervical cancer cell growth through blocking the Wnt/β-catenin signaling activity. Here, we report that activated AMPK (p-AMPK) also inhibits cervical cancer cell growth by counteracting FOXM1 function.
Metabolic investigation of segmental overgrowth: new insights in pathogenic m...BiologInc
[Biolog Webinar] Dr. Luigi Boccuto's presentation of his investigation of the pathogenic mechanisms of segmental overgrowth caused by mosaic mutations in the genes of the PI3K-AKT pathway. He will describe how Biolog Phenotype MicroArray™ Technology is used to identify new treatment targets and test compounds with potential therapeutic effects.
Molecular signaling involved in breast cancerainnie babarrr
Molecular signaling is very important to predict patient's clinical outcome. HER signaling is most important one, by its regulation cascade of pathways started. So, by understanding proteins over-expression we can target with inhibitors to suppress particular protein, which will results in treatment of breast cancer or Drug discovery.
Activation of AMPK inhibits cervical cancer cell growth through AKT/FOXO3a/FO...Enrique Moreno Gonzalez
Although advanced-stage cervical cancer can benefit from current treatments, approximately 30% patients may fail after definitive treatment eventually. Therefore, exploring alternative molecular therapeutic approaches is imperatively needed for this disease. We have recently shown that activation of AMP-activated protein kinase (AMPK), a metabolic sensor, hampers cervical cancer cell growth through blocking the Wnt/β-catenin signaling activity. Here, we report that activated AMPK (p-AMPK) also inhibits cervical cancer cell growth by counteracting FOXM1 function.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...eshaasini
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Involvement of Interleukin-6 Induced PI3K/Akt/mTor Pathway in the Regulation ...semualkaira
Hepatocellular Carcinoma (HCC) is an invasive
cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC
directly related to the disease agressivity. Télomérase, is expressed
by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by
IL-6 is activated in the HCC. Our aim is to investigate the effect
of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/
PRF/5 cell lines.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...semualkaira
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...eshaasini
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...semualkaira
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Molecular mechanisms of action and potential biomarkers of growth inhibition ...Enrique Moreno Gonzalez
Molecular targeted therapy has emerged as a promising treatment of Hepatocellular carcinoma (HCC). One potential target is the Src family Kinase (SFK). C-Src, a non-receptor tyrosine kinase is a critical link of multiple signal pathways that regulate proliferation, invasion, survival, metastasis, and angiogenesis. In this study, we evaluated the effects of a novel SFK inhibitor, dasatinib (BMS-354825), on SFK/FAK/p130CAS, PI3K/PTEN/Akt/mTOR, Ras/Raf/MAPK and Stats pathways in 9 HCC cell lines.
La figura de Alberto Sols fue durante décadas una referencia para los bioquímicos españoles. Los días 20 y 21 de febrero de 2017, la Fundación Ramón Areces dedicó un simposio internacional a su memoria, rindiendo homenaje a sus principales logros: las levaduras como modelo experimental, la enzimología y regulación metabólica y la patología molecular. El encuentro científico, que estuvo coordinado por Carlos Gancedo y Joan Guinovart, reunió a expertos internacionales para debatir sobre el legado de este científico español.
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
More Related Content
Similar to Aditya - Cell Cycle Article Presentation.pptx
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...eshaasini
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Involvement of Interleukin-6 Induced PI3K/Akt/mTor Pathway in the Regulation ...semualkaira
Hepatocellular Carcinoma (HCC) is an invasive
cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC
directly related to the disease agressivity. Télomérase, is expressed
by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by
IL-6 is activated in the HCC. Our aim is to investigate the effect
of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/
PRF/5 cell lines.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...semualkaira
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...eshaasini
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Involvement of Interleukin-6 induced PI3K/Akt/mTor pathway in the regulation ...semualkaira
Hepatocellular Carcinoma (HCC) is an invasive cancer. Alphafoetoprotein (AFP) is a diagnostic marker for HCC directly related to the disease agressivity. Telomerase, is expressed by 90% of HCC. PI3K/Akt/mTOR pathway wich is regulated by IL-6 is activated in the HCC. Our aim is to investigate the effect of IL-6 on AFP and telomerase secretion in HepG2/C3A and PLC/ PRF/5 cell lines.
Molecular mechanisms of action and potential biomarkers of growth inhibition ...Enrique Moreno Gonzalez
Molecular targeted therapy has emerged as a promising treatment of Hepatocellular carcinoma (HCC). One potential target is the Src family Kinase (SFK). C-Src, a non-receptor tyrosine kinase is a critical link of multiple signal pathways that regulate proliferation, invasion, survival, metastasis, and angiogenesis. In this study, we evaluated the effects of a novel SFK inhibitor, dasatinib (BMS-354825), on SFK/FAK/p130CAS, PI3K/PTEN/Akt/mTOR, Ras/Raf/MAPK and Stats pathways in 9 HCC cell lines.
La figura de Alberto Sols fue durante décadas una referencia para los bioquímicos españoles. Los días 20 y 21 de febrero de 2017, la Fundación Ramón Areces dedicó un simposio internacional a su memoria, rindiendo homenaje a sus principales logros: las levaduras como modelo experimental, la enzimología y regulación metabólica y la patología molecular. El encuentro científico, que estuvo coordinado por Carlos Gancedo y Joan Guinovart, reunió a expertos internacionales para debatir sobre el legado de este científico español.
The IOSR Journal of Pharmacy (IOSRPHR) is an open access online & offline peer reviewed international journal, which publishes innovative research papers, reviews, mini-reviews, short communications and notes dealing with Pharmaceutical Sciences( Pharmaceutical Technology, Pharmaceutics, Biopharmaceutics, Pharmacokinetics, Pharmaceutical/Medicinal Chemistry, Computational Chemistry and Molecular Drug Design, Pharmacognosy & Phytochemistry, Pharmacology, Pharmaceutical Analysis, Pharmacy Practice, Clinical and Hospital Pharmacy, Cell Biology, Genomics and Proteomics, Pharmacogenomics, Bioinformatics and Biotechnology of Pharmaceutical Interest........more details on Aim & Scope).
Similar to Aditya - Cell Cycle Article Presentation.pptx (20)
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
Introduction to AI for Nonprofits with Tapp NetworkTechSoup
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
Model Attribute Check Company Auto PropertyCeline George
In Odoo, the multi-company feature allows you to manage multiple companies within a single Odoo database instance. Each company can have its own configurations while still sharing common resources such as products, customers, and suppliers.
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
How to Make a Field invisible in Odoo 17Celine George
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
Palestine last event orientationfvgnh .pptxRaedMohamed3
An EFL lesson about the current events in Palestine. It is intended to be for intermediate students who wish to increase their listening skills through a short lesson in power point.
June 3, 2024 Anti-Semitism Letter Sent to MIT President Kornbluth and MIT Cor...Levi Shapiro
Letter from the Congress of the United States regarding Anti-Semitism sent June 3rd to MIT President Sally Kornbluth, MIT Corp Chair, Mark Gorenberg
Dear Dr. Kornbluth and Mr. Gorenberg,
The US House of Representatives is deeply concerned by ongoing and pervasive acts of antisemitic
harassment and intimidation at the Massachusetts Institute of Technology (MIT). Failing to act decisively to ensure a safe learning environment for all students would be a grave dereliction of your responsibilities as President of MIT and Chair of the MIT Corporation.
This Congress will not stand idly by and allow an environment hostile to Jewish students to persist. The House believes that your institution is in violation of Title VI of the Civil Rights Act, and the inability or
unwillingness to rectify this violation through action requires accountability.
Postsecondary education is a unique opportunity for students to learn and have their ideas and beliefs challenged. However, universities receiving hundreds of millions of federal funds annually have denied
students that opportunity and have been hijacked to become venues for the promotion of terrorism, antisemitic harassment and intimidation, unlawful encampments, and in some cases, assaults and riots.
The House of Representatives will not countenance the use of federal funds to indoctrinate students into hateful, antisemitic, anti-American supporters of terrorism. Investigations into campus antisemitism by the Committee on Education and the Workforce and the Committee on Ways and Means have been expanded into a Congress-wide probe across all relevant jurisdictions to address this national crisis. The undersigned Committees will conduct oversight into the use of federal funds at MIT and its learning environment under authorities granted to each Committee.
• The Committee on Education and the Workforce has been investigating your institution since December 7, 2023. The Committee has broad jurisdiction over postsecondary education, including its compliance with Title VI of the Civil Rights Act, campus safety concerns over disruptions to the learning environment, and the awarding of federal student aid under the Higher Education Act.
• The Committee on Oversight and Accountability is investigating the sources of funding and other support flowing to groups espousing pro-Hamas propaganda and engaged in antisemitic harassment and intimidation of students. The Committee on Oversight and Accountability is the principal oversight committee of the US House of Representatives and has broad authority to investigate “any matter” at “any time” under House Rule X.
• The Committee on Ways and Means has been investigating several universities since November 15, 2023, when the Committee held a hearing entitled From Ivory Towers to Dark Corners: Investigating the Nexus Between Antisemitism, Tax-Exempt Universities, and Terror Financing. The Committee followed the hearing with letters to those institutions on January 10, 202
Acetabularia Information For Class 9 .docxvaibhavrinwa19
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Francesca Gottschalk - How can education support child empowerment.pptxEduSkills OECD
Francesca Gottschalk from the OECD’s Centre for Educational Research and Innovation presents at the Ask an Expert Webinar: How can education support child empowerment?
Honest Reviews of Tim Han LMA Course Program.pptxtimhan337
Personal development courses are widely available today, with each one promising life-changing outcomes. Tim Han’s Life Mastery Achievers (LMA) Course has drawn a lot of interest. In addition to offering my frank assessment of Success Insider’s LMA Course, this piece examines the course’s effects via a variety of Tim Han LMA course reviews and Success Insider comments.
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
Welcome to TechSoup New Member Orientation and Q&A (May 2024).pdfTechSoup
In this webinar you will learn how your organization can access TechSoup's wide variety of product discount and donation programs. From hardware to software, we'll give you a tour of the tools available to help your nonprofit with productivity, collaboration, financial management, donor tracking, security, and more.
2. Salvia officinalis
Rosmarinus officinalis L.
http://florawww.eeb.uconn.edu/images/byspecies/Rosmarinus_officinalis01.jpg http://www.pflanzenreich.com/media/images/gartenatlas/Salvia_officinalis_Nana_Zwerg-Salbei.jpg
Have bioactive molecule called Carnosic Acid (CA)
Introduction
3. • Phenolic diterpene with a
formula C20H28O4
• Antioxidant agent
• Reported have ability to
inhibit cancer cell growth
• Another report, CA
indicated as a powerful
chemotherapeutic agent
(Birtic et al. 2015)
Carnosic Acid (CA)
4. (Jung et al. 2015)
Carnosic Acid (CA) sensitize
TRAIL-mediated apoptosis on kidney cancer
(Wang & El-Deiry 2003)
5. Carnosic Acid (CA) modulated the AKT signaling in
myeloid leukemia cells & prostate carcinoma
(Kar et al. 2012)
7. Cell survival measurement using
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay
Normal Astrocytes & U251MG GBM cell line grown on mixture
of matrigel and CA
Cell count using flowcytometry analysis
Immunoblot analysis
Immunofluorescence analysis
RB1 gene quantification using qPCR
Student’s t-test using a two tailed distribution statistical analysis
Method Flow
8. U251MG GBM cell line grown on
8 group composition of matrigel and CA
1. DMSO
2. CA 17,5 µM
3. CA 20 µM
4. CA 22,5 µM
5. CA 25 µM
6. CA 27,5 µM
7. CA 30 µM
8. CA 40 µM
Cell Culture
Normal Astrocytes cell line grown on
5 group composition of matrigel and CA
1. DMSO
2. CA 10 µM
3. CA 20 µM
4. CA 30 µM
5. CA 50 µM
Cell survival measurement using
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) colorimetric assay
10. Cell Count
Cells were harvested after 48 hours
Centrifuged at 980 g for 5 min
Stained with DAPI
Flow cytometric analysis performed
Stained with Sytox Blue Dead Cell
13. Immunoblot & Immunofluorescence
Protein cell were extracted & SDS-PAGE were performed
HRP conjugated goat anti-rabbit or goat anti mouse IgG & SuperSignal west Pico
Chemiluminescent substrate (Thermo Scientific) were used for immunodetection
1. AKT Pro Survival
2. Calreticulin Pro Apoptosis
3. Cyclin A Pro Proliferation
4. Cyclin B1 Pro Proliferation
5. ERK 1/2 Pro Survival (MAPK pathway)
6. GFAP (Glial fibrillary acidic protein)
Pro Proliferation
7. HSP70 Pro Proliferation
8. MYC Pro Proliferation
9. P21WAF Pro Apoptosis
10. Phospho-AKT (Ser473) Pro Survival
(mTOR pathway)
11. Phospho-AKT (Thr308) Pro Survival
(mTOR pathway)
12. Phospho-CDK Substrate [pTPXK] Pro Proliferation
13. Phospho-Erk1/2 (Thr202/Tyr204) Pro Proliferation
14. Phospho-Histone H3 (Ser10) Pro Proliferation
15. Phospho-Rb (Ser567) Pro Proliferation
16. Phospho-Rb (Ser807/811) Pro Proliferation
17. Phospho-STAT3 (Tyr705) Pro Proliferation
18. Phospho-STAT3 (Ser727) Pro Proliferation
19. RB Tumor Suppresor
20. SOD1 Associated with Apoptotis
21. SOX2 Pro Proliferation
22. Tubulin Pro Proliferation
Antibody used :
14. CA induces a G2 growth arrest
via P21WAF in GBM cells
pSer10H3 : Phospho-Histone H3 (Ser10) pro proliferation
Active form of CDK5, which has also been called neuronal cdc2-like kinase
CDK5
16. CA induces a G2 growth arrest
via P21WAF in GBM cells
pSer10H3 : Phospho-Histone H3 (Ser10) pro proliferation
17. CA modulates STAT3 and AKT
but not ERK 1/2 phosphorylation status
pERK : phosphorylated Extracellular signal–Regulated Kinases
ERK : Extracellular signal–Regulated Kinases Pro Survival (MAPK pathway)
Phospho-AKT (Ser473) Pro Survival (mTOR pathway)
Phospho-AKT (Thr308) Pro Survival (mTOR pathway)
Phospho-STAT3 (Tyr705) Pro Proliferation
Phospho-STAT3 (Ser727) Pro Proliferation
18. CA modulates STAT3 and AKT
but not ERK 1/2 phosphorylation status
(Chang et al. 2003)
19. CA modulates STAT3 and AKT
but not ERK 1/2 phosphorylation status
http://www.mdpi.com/cancers/cancers-06-01441/article_deploy/html/images/cancers-06-01441-g001-1024.png
20. CA promotes proteasomal degradation of
SOX2 & GFAP but not that of MYC
GFAP (Glial fibrillary acidic protein)
Pro Proliferation
SOX2 Pro Proliferation
MYC Pro Proliferation
CHX : Cycloheximide
Inhibit protein expression
(block translational elongation
LCC : Lactacystin Proteasome Inhibitor
21. CA promotes RB proteasomal degradation
Phospho-Rb (Ser807/811) Pro Proliferation
CHX : Cycloheximide Inhibit protein expression (block translational elongation
LCC : Lactacystin Proteasome Inhibitor
22. RB1 expression quantification
Total RNA isolated from 48 hours GBM cell cultured using
miRNeasy® mini kit (Qiagen, Milan, Italy)
cDNA was synthesized by using an Oligo(dT)20,
Random hexamers mix & a Superscript III
first-strand synthesis system supermix for RT-PCR
(Invitrogen).
ATP5B, CYC1 and SDHA used as endogenous control
RB1 qPCR performed using primers:
Forward : CTTCCTCATGCTGTTCAGGAG
Reverse : TGCATGAAGACCGAGTTATAGAAT
note:
23. CA didn’t affect RB mRNA transcription
ATP5B : ATP synthase subunit beta 5
CYC1 : Cytochrome C-1
SDHA : Succinate Dehydrogenase Complex, Subunit A
24. Conclusion
• CA can induce apoptosis on GBM cell
• CA promotes deregulation of cell cycle control & reduce
survival rate of GBM cell via proteasome-mediated
degradation of Cyclin B1, Rb & SOX2
• But, CA fails to show clinical potential in GBM cell because
can’t degrade MYC
25. Additional References
Birtic, S. et al., 2015. Carnosic acid. Phytochemistry, 115, pp.9–19.
Chang, F. et al., 2003. Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine
receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia, 17(7),
pp.1263–1293. Available at:
http://www.nature.com/leu/journal/v17/n7/full/2402945a.htmlnhttp://www.nature.com/leu/journal/v
17/n7/pdf/2402945a.pdf.
Jung, K.-J. et al., 2015. Carnosic acid sensitized TRAIL-mediated apoptosis through down-regulation of c-FLIP
and Bcl-2 expression at the post translational levels and CHOP-dependent up-regulation of DR5, Bim, and
PUMA expression in human carcinoma caki cells. Oncotarget, 6(3), pp.1556–1568.
Kar, S. et al., 2012. Carnosic acid modulates Akt/IKK/NF-??B signaling by PP2A and induces intrinsic and
extrinsic pathway mediated apoptosis in human prostate carcinoma PC-3 cells. Apoptosis, 17(7), pp.735–
747.
Wang, S. & El-Deiry, W.S., 2003. TRAIL and apoptosis induction by TNF-family death receptors. Oncogene,
22(53), pp.8628–33. Available at: http://www.ncbi.nlm.nih.gov/pubmed/14634624.
Thank you
Editor's Notes
Ada dua tumbuhan yaitu rosemary dan salvia, mereka adalah tumbuhan dalam family Lamiaceae. Tumbuhan yang terkenal dari family ini adalah lavender
Kedua tumbuhan ini memiliki daun yang didalamnya terkandung molekul bioaktif yang disebut dengan Carnosic Acid (CA)
CA adalah molekul fenolik diterpen dengan formula C20 H28 O4
CA ini banyak dilaporkan sebagai zat antioksidant, dan dilaporkan bahwa CA memiliki kemampuan menghambat sel kanker.
CA juga dilaporkan sebagai salah satu agen kemoterapi
Penelitian yang telah ada mengenai CA,
Ternyata CA dapat mensitisasi apoptosis melalui jalur TRAIL pada kanker ginjal
Berikut adalah pathway nya
TRAIL akan diterima oleh 5 domain reseptor dan akan mengaktifkan cascade cascade dibawahnya untuk aktivasi apoptosis
Laporan lain juga menyebutkan CA dapat menghambat AKT signaling pada myeloid leukemia cell dan kanker prostat, berikut adalah aktivasi yang apoptosis dari penghambatan jalur AKT
Tetapi masih belum diketahui efek CA terhadap Glioma atau kanker syaraf
Jadi penelitian ini ingin mengetahui efek dari CA terhadap Glioma
Berikut adalah aliran metode yang dilakukan oleh peneliti
Pertama – tama,
Sel astrosit normal dan GBM cell line ditumbuhkan pada campuran Matrigel dan CA
Kemudian dihitung tingkat ketahanan sel terhadap CA menggunakan MTT assay
Lalu dihitung jumlah selnya menggunakan FACS
Dilakukan imunobloting dan immunofluorescence
Dilakukan kuantifikasi gen RB1 menggunakan qPCR
Dan terakhir dilakukan uji statistik
Berikut adalah detail dari cell kulturnya
Sel kanker ditumbuhkan pada konsentrasi CA yang bertingkat, begitu pula dengan NA yang juga ditumbuhkan dengan CA yang meningkat
Lalu dilakukan MTT assay untuk melihat level ketahanan hidup sel
Berikut adalah hasil kultur setelah 48 jam
Ternyata baik NA dan PT2 (sel kanker) mengalami penurunan survival rate seiring dengan meningkatnya konsentrasi CA
Disini DMSO berfungsi sbagai control, dia tidak diberi CA
Selanjutnya dilakukan penghitungan sel menggunakan metode flowcytometry
Sel dipanen setelah dikultur 48 jam
Kemudian disentrifus
Kemudian ada 2 kelompok pewarnaan yaitu menggunakan DAPI (untuk cek nukleusnya) dan Sytox Blue untuk deteksi apoptosisnya
Kemudian dilakukan flowcytometry
Ternyata CA dapat menyebabkan cell cycle arrest di fase G2
Terlihat pada gambar, terjadi perbedaan nyata antara CA dan DMSO
CA juga dapat menginduksi terjadinya apoptosis dibuktikan pada diagram, level apoptosis pada sel dengan perlakuan CA lebih tinggi dibandingkan dengan DMSO
Selanjutnya dilakukan immunobloting dan imunofluoresense
Peneliti mendeteksi 22 protein berfungsi untuk konfirmasi jalur apa yang dipakai CA untuk menghambat progresi glioma
Disebut proteinnya.
Berdasarkan hasil imunoblot
CA menginduksi g2 arrest dengan aktivasi protein 21 sehingga cyclin b1 tidak terbentuk, juga tidak terbentuk fosforilasi histon,
Pada gambar ini hanya terekspresi CDK5, setelah saya cari ternyata CDK5 itu adalah CDK unik yang hanya terdapat pada jaringan saraf yang strukturnya mirip dengan cdc2
Nah ini untuk mengingatkan posisi cyclin b1 dan cdk cdk yang berperan dalam siklus sel
Aktivasi p21 ini juga dibuktikan dengan uji immunofluorescence yang menunjukkan bahwa
Phosphorilasi histon berbeda nyata,
Level b1 juga rendah
CDK rendah
Sedangkan p21 lebih tinggi dan Cyclin A2 tidak berbeda nyata
Selanjutnya peneliti ingin mencari CA menghambat jalur apa,
Dan ternyata CA dapat menghambat jalur STAT3 AKT tetapi tidak bisa menghambat jalur ERK1/2
Cuman saya masih belum mengerti kenapa band di perlakuan CA ada yg lebih tebal dan ada yang lebih tipis
Untuk sekedar info ini adlah jalur ERK
Selanjutnya CA juga dapat mendukung terjadinya degradasi proteasomal protein SOX2, GFAP, tetapi tidak pada MYC
Pada gambar B, terlihat ditambahkan CHX dan LCC
CHX adalah zat yang dapat menghambat ekspresi protein sedangkan LCC adalah zat yang dapat menghambat kerja proteasome
Jadi peneliti ingin tahu CA mempengaruhi SOX dan GFAP di level ekspresi gennya atau di level degradasinya dan ternyata CA mempengaruhi di level degradasinya
Selanjutnya CA juga mempengaruhi degradasi RB
Dan ternyata phosphorilasi rb tidak terjadi, sehingga pasti diikuti cyclin dan CDK yang tidak akan berikatan
CA juga mempengaruhi RB di tingkat degradasi proteasomenya, bukan di level ekspresi gennya
Untuk membuktikan bahwa ekspresi RB tidak terpengaruh keberadaan CA, dilakukan qPCR
Berikut adalah metodenya
Berdasarkan hasil qPCR ternyata memang ekspresi RB tidak dipengaruhi oleh CA, malah pada SDHA terdapat kenaikan yg hampir signifikan pada perlakuan CA
Kesimpulan dari jurnal ini adalah:
CA dapat menginduksi apoptosis pada sel GBM
CA mendukung deregulasi siklus sel dan tingkat ketahanan sel melalui degradasi Cyclin B1, Rb dan SOX2
Tapi secara umum CA gagal menunjukkan kemampuan klinisnya melawan sel GBM karena tidak dapat mendegradasi MYC yang merupakan mitogen
