Genome-wide gene expression patterns were evaluated in individuals with and without arsenical skin lesions from drinking arsenic-contaminated water. Differentially expressed genes were identified between the two groups. The study found 468 genes differentially expressed, with 467 downregulated in individuals with skin lesions. Further analysis restricting to only female never-smokers found 312 downregulated genes. Gene ontology analysis revealed 41 significant categories involved in processes like proliferation, apoptosis and wound healing. The study demonstrated that microarray analysis can help characterize the molecular effects of arsenic exposure and arsenic-induced diseases.
Lymphoma Diagnostics and Subtypes: Past, Present, and Futureupstatevet
Ariana Verrilli, DVM, Practice limited to Oncology
This lecture will explore the various subtypes of canine and feline lymphoma, and participants will learn how new and changing diagnostic tests can further our understanding of lymohoproliferative diseases.
Updated version of molecular basis, with implied clinical aspect of the molecular basis.
(contents are taken from standard textbook and i dont own the copyright for the content details.)
Lymphoma Diagnostics and Subtypes: Past, Present, and Futureupstatevet
Ariana Verrilli, DVM, Practice limited to Oncology
This lecture will explore the various subtypes of canine and feline lymphoma, and participants will learn how new and changing diagnostic tests can further our understanding of lymohoproliferative diseases.
Updated version of molecular basis, with implied clinical aspect of the molecular basis.
(contents are taken from standard textbook and i dont own the copyright for the content details.)
Objective: The prognostic indictors of age-related poor outcomes in patients with acute myeloid leukemia (AML) are still controversial. The aim of this work was to provide comprehensive insights into the effect of different hemocytes and to investigate the association between age and clinical features in adult patients with AML.
Study Design: A retrospective study was performed to determine the role of age in the therapeutic outcomes of AML. A total of 166 newly diagnosed adult patients’ data from January 2015 to November 2019 in Zhongshan Hospital of Xiamen University were collected and analyzed.
Results: Older patients presented a poorer prognosis (p=0.001) with shorter overall survival, which is served as age-related outcomes. Binary logistic regression demonstrated that cytogenetic risk (OR=4.508, 95% CI 2.733–7.435), leukocyte (OR=7.410, 95% CI 1.139–5.910), and bone marrow blast cells (OR=3.261, 95% CI 1.075–5.615) were independent indictors for age-related prognosis. In addition, Kaplan-Meier curve also revealed that the above factors were associated with overall survival (all p values <0.001).
Conclusion: Cytogenetic risk, leukocyte, and bone marrow blast cells are dominant factors which account for the age-related poor outcomes and shorter overall survival in AML.
Keywords: acute myeloid leukemia, adult, cytogenetic risk, hemocyte, leukemia, overall survival
DNA Amplification is a Ubiquitous Mechanism of Oncogene Activation in Lung an...Shryli Shreekar
Chromosomal translocation is the best-characterized
genetic mechanism for oncogene activation. However, there
are documented examples of activation by alternate
mechanisms, for example gene dosage increase, though
its prevalence is unclear. Here, we answered the fundamental question of the contribution of DNA amplification
as a molecular mechanism driving oncogenesis. Comparing
104 cancer lines representing diverse tissue origins
identified genes residing in amplification ‘hotspots’ and
discovered an unexpected frequency of genes activated by
this mechanism. The 3431 amplicons identified represent
B10 per hematological and B36 per epithelial cancer
genome. Many recurrently amplified oncogenes were
previously known to be activated only by disease-specific
translocations. The 135 hotspots identified contain 538
unique genes and are enriched for proliferation, apoptosis
and linage-dependency genes, reflecting functions advantageous to tumor growth. Integrating gene dosage with
expression data validated the downstream impact of the
novel amplification events in both cell lines and clinical
samples. For example, multiple downstream components of
the EGFR-family-signaling pathway, including CDK5,
AKT1 and SHC1, are overexpressed as a direct result of
gene amplification in lung cancer. Our findings suggest that
amplification is far more common a mechanism of
oncogene activation than previously believed and that
specific regions of the genome are hotspots of amplification.
Association of common palb2 polymorphisms with ovarian cancer a case control ...IJARIIT
Background: The partner and localizer of breast cancer 2 (PALB2) has an essential role in BRCA2 mediated DNA
double-strand break repair by serving as a bridging molecule and acting as the physical and functional link between BRCA1&
2 proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risk of developing
breast and /or ovarian cancer in different populations. The present study was designed to investigate the variants of PALB2 and
their association with OC.
Material &Methods: A total of 150 histopathologically confirmed ovarian cancer patients and 250 healthy age matched controls
were collected. Three SNPs c.2794 G/A( rs45624036), c.1010 T/C(rs45494092), and c.1676A/G(rs152451) of PALB2 gene were
selected and genotyped by ARMS-PCR followed by agarose gel electrophoresis. Appropriate statistical tests were applied to test
for the significance of the results.
Results: A significant association of G/A (rs45624036) in inheritance models was observed & at the allelic level, the A allele
conferred four-fold increased risk compared to G allele. Regarding T/C (rs45494092) polymorphism all the models revealed an
association with OC and C allele showing eight-fold increased risk. With respect to A/G (rs152451) polymorphism, the protective
role was observed in tested inheritance models in OC patients.
The Haplo analysis for the combination of all the three variants revealed increased risk with A-T-A and G-C-G
haplotypes.(OR=4.50 ;95%CI 1.85-10.94;p=0.001,OR=26.36 ;95%CI 2.33 -297.91;p= 0.0085), whereas other haplotypes
conferred a protective role in OC.
Conclusions: The present study suggests an essential role of PALB2 in the etiology of ovarian cancer.
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Objective: The prognostic indictors of age-related poor outcomes in patients with acute myeloid leukemia (AML) are still controversial. The aim of this work was to provide comprehensive insights into the effect of different hemocytes and to investigate the association between age and clinical features in adult patients with AML.
Study Design: A retrospective study was performed to determine the role of age in the therapeutic outcomes of AML. A total of 166 newly diagnosed adult patients’ data from January 2015 to November 2019 in Zhongshan Hospital of Xiamen University were collected and analyzed.
Results: Older patients presented a poorer prognosis (p=0.001) with shorter overall survival, which is served as age-related outcomes. Binary logistic regression demonstrated that cytogenetic risk (OR=4.508, 95% CI 2.733–7.435), leukocyte (OR=7.410, 95% CI 1.139–5.910), and bone marrow blast cells (OR=3.261, 95% CI 1.075–5.615) were independent indictors for age-related prognosis. In addition, Kaplan-Meier curve also revealed that the above factors were associated with overall survival (all p values <0.001).
Conclusion: Cytogenetic risk, leukocyte, and bone marrow blast cells are dominant factors which account for the age-related poor outcomes and shorter overall survival in AML.
Keywords: acute myeloid leukemia, adult, cytogenetic risk, hemocyte, leukemia, overall survival
DNA Amplification is a Ubiquitous Mechanism of Oncogene Activation in Lung an...Shryli Shreekar
Chromosomal translocation is the best-characterized
genetic mechanism for oncogene activation. However, there
are documented examples of activation by alternate
mechanisms, for example gene dosage increase, though
its prevalence is unclear. Here, we answered the fundamental question of the contribution of DNA amplification
as a molecular mechanism driving oncogenesis. Comparing
104 cancer lines representing diverse tissue origins
identified genes residing in amplification ‘hotspots’ and
discovered an unexpected frequency of genes activated by
this mechanism. The 3431 amplicons identified represent
B10 per hematological and B36 per epithelial cancer
genome. Many recurrently amplified oncogenes were
previously known to be activated only by disease-specific
translocations. The 135 hotspots identified contain 538
unique genes and are enriched for proliferation, apoptosis
and linage-dependency genes, reflecting functions advantageous to tumor growth. Integrating gene dosage with
expression data validated the downstream impact of the
novel amplification events in both cell lines and clinical
samples. For example, multiple downstream components of
the EGFR-family-signaling pathway, including CDK5,
AKT1 and SHC1, are overexpressed as a direct result of
gene amplification in lung cancer. Our findings suggest that
amplification is far more common a mechanism of
oncogene activation than previously believed and that
specific regions of the genome are hotspots of amplification.
Association of common palb2 polymorphisms with ovarian cancer a case control ...IJARIIT
Background: The partner and localizer of breast cancer 2 (PALB2) has an essential role in BRCA2 mediated DNA
double-strand break repair by serving as a bridging molecule and acting as the physical and functional link between BRCA1&
2 proteins. Truncating mutations in the PALB2 gene are rare but are thought to be associated with increased risk of developing
breast and /or ovarian cancer in different populations. The present study was designed to investigate the variants of PALB2 and
their association with OC.
Material &Methods: A total of 150 histopathologically confirmed ovarian cancer patients and 250 healthy age matched controls
were collected. Three SNPs c.2794 G/A( rs45624036), c.1010 T/C(rs45494092), and c.1676A/G(rs152451) of PALB2 gene were
selected and genotyped by ARMS-PCR followed by agarose gel electrophoresis. Appropriate statistical tests were applied to test
for the significance of the results.
Results: A significant association of G/A (rs45624036) in inheritance models was observed & at the allelic level, the A allele
conferred four-fold increased risk compared to G allele. Regarding T/C (rs45494092) polymorphism all the models revealed an
association with OC and C allele showing eight-fold increased risk. With respect to A/G (rs152451) polymorphism, the protective
role was observed in tested inheritance models in OC patients.
The Haplo analysis for the combination of all the three variants revealed increased risk with A-T-A and G-C-G
haplotypes.(OR=4.50 ;95%CI 1.85-10.94;p=0.001,OR=26.36 ;95%CI 2.33 -297.91;p= 0.0085), whereas other haplotypes
conferred a protective role in OC.
Conclusions: The present study suggests an essential role of PALB2 in the etiology of ovarian cancer.
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Abstract:
It has been reported that the tumour suppressor gene germline adenomatous polyposis coli is mutated in many tumours particularly in prostate. This study was conducted to determine the APC gene mutations in prostate cancer patients in Osun State, Nigeria. Previously diagnosed paraffin wax tissue blocks with prostate cancer between 2014 and 2019 were selected for this study. Biodata information was obtained from the patient's request form and the laboratory surgical logbook. Sections were cut and stained for heamatoxylin and eosin staining technique to validate the diagnosis of prostate cancer previously reported. Sections for molecular analysis were dewaxed and macerated for DNA extraction. The APC-F “GGCAAGACCCAAACACATAATAG” and APC-R “GGAGATTTCGCTCCTGAAGAA” primers were used in the polymerase chain reaction and sequenced. The Big Dye terminator v3.1 cycle sequencing kit was used for sequencing the amplified fragments on an Applied Biosystems Genetic Analyzer 3130xl sequencer machine. This study observed mutations in the APC gene in some prostate cancer patients in Osun State, Nigeria. The mutations observed in this study involved the alanine nucleotides, glycine and an alanine-glycine nucleotide complex indicating the silent and missense mutations. In order to diagnose prostatic cancer early, manage and treat patients, routine genomic screening of males over 40 years is advocated.
https://www.biomedscidirect.com/archive/issue/76/articles
Adenomatous polyposis coli (apc) gene mutation in a population of prostate cancer patients in osun state, nigeria
Authors:Olubunmi Ebenezer Esan, Yetunde Sophia Akinbo, Olalekan Adegoke Aremu , Abiola Adeyemi Adefidipe, Frederick Olusegun Akinbo
Int J Biol Med Res. 2024; 15(1): 7712-7717
Diagonsis of cancer through saliva.pptxZaidAhmad42
Human saliva is an ideal body fluid for developing non-invasive diagnostics. Saliva contains naturally-occurring nanoparticles with unique structural and biochemical characteristics.
New Directions in Targeted Therapeutic Approaches for Older Adults With Mantl...i3 Health
i3 Health is pleased to make the speaker slides from this activity available for use as a non-accredited self-study or teaching resource.
This slide deck presented by Dr. Kami Maddocks, Professor-Clinical in the Division of Hematology and
Associate Division Director for Ambulatory Operations
The Ohio State University Comprehensive Cancer Center, will provide insight into new directions in targeted therapeutic approaches for older adults with mantle cell lymphoma.
STATEMENT OF NEED
Mantle cell lymphoma (MCL) is a rare, aggressive B-cell non-Hodgkin lymphoma (NHL) accounting for 5% to 7% of all lymphomas. Its prognosis ranges from indolent disease that does not require treatment for years to very aggressive disease, which is associated with poor survival (Silkenstedt et al, 2021). Typically, MCL is diagnosed at advanced stage and in older patients who cannot tolerate intensive therapy (NCCN, 2022). Although recent advances have slightly increased remission rates, recurrence and relapse remain very common, leading to a median overall survival between 3 and 6 years (LLS, 2021). Though there are several effective options, progress is still needed towards establishing an accepted frontline approach for MCL (Castellino et al, 2022). Treatment selection and management of MCL are complicated by the heterogeneity of prognosis, advanced age and comorbidities of patients, and lack of an established standard approach for treatment, making it vital that clinicians be familiar with the latest research and advances in this area. In this activity chaired by Michael Wang, MD, Professor in the Department of Lymphoma & Myeloma at MD Anderson Cancer Center, expert faculty will discuss prognostic factors informing treatment, the promising results of recent trials in new therapeutic approaches, and the implications of treatment resistance in therapeutic selection for MCL.
Target Audience
Hematology/oncology fellows, attending faculty, and other health care professionals involved in the treatment of patients with mantle cell lymphoma (MCL).
Learning Objectives
1.) Identify clinical and biological prognostic factors that can guide treatment decision making for older adults with MCL
2.) Evaluate emerging data on targeted therapeutic approaches for treatment-naive and relapsed/refractory MCL and their applicability to older adults
3.) Assess mechanisms of resistance to targeted therapies for MCL and their implications for treatment selection
These simplified slides by Dr. Sidra Arshad present an overview of the non-respiratory functions of the respiratory tract.
Learning objectives:
1. Enlist the non-respiratory functions of the respiratory tract
2. Briefly explain how these functions are carried out
3. Discuss the significance of dead space
4. Differentiate between minute ventilation and alveolar ventilation
5. Describe the cough and sneeze reflexes
Study Resources:
1. Chapter 39, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 34, Ganong’s Review of Medical Physiology, 26th edition
3. Chapter 17, Human Physiology by Lauralee Sherwood, 9th edition
4. Non-respiratory functions of the lungs https://academic.oup.com/bjaed/article/13/3/98/278874
Pulmonary Thromboembolism - etilogy, types, medical- Surgical and nursing man...VarunMahajani
Disruption of blood supply to lung alveoli due to blockage of one or more pulmonary blood vessels is called as Pulmonary thromboembolism. In this presentation we will discuss its causes, types and its management in depth.
Title: Sense of Taste
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the structure and function of taste buds.
Describe the relationship between the taste threshold and taste index of common substances.
Explain the chemical basis and signal transduction of taste perception for each type of primary taste sensation.
Recognize different abnormalities of taste perception and their causes.
Key Topics:
Significance of Taste Sensation:
Differentiation between pleasant and harmful food
Influence on behavior
Selection of food based on metabolic needs
Receptors of Taste:
Taste buds on the tongue
Influence of sense of smell, texture of food, and pain stimulation (e.g., by pepper)
Primary and Secondary Taste Sensations:
Primary taste sensations: Sweet, Sour, Salty, Bitter, Umami
Chemical basis and signal transduction mechanisms for each taste
Taste Threshold and Index:
Taste threshold values for Sweet (sucrose), Salty (NaCl), Sour (HCl), and Bitter (Quinine)
Taste index relationship: Inversely proportional to taste threshold
Taste Blindness:
Inability to taste certain substances, particularly thiourea compounds
Example: Phenylthiocarbamide
Structure and Function of Taste Buds:
Composition: Epithelial cells, Sustentacular/Supporting cells, Taste cells, Basal cells
Features: Taste pores, Taste hairs/microvilli, and Taste nerve fibers
Location of Taste Buds:
Found in papillae of the tongue (Fungiform, Circumvallate, Foliate)
Also present on the palate, tonsillar pillars, epiglottis, and proximal esophagus
Mechanism of Taste Stimulation:
Interaction of taste substances with receptors on microvilli
Signal transduction pathways for Umami, Sweet, Bitter, Sour, and Salty tastes
Taste Sensitivity and Adaptation:
Decrease in sensitivity with age
Rapid adaptation of taste sensation
Role of Saliva in Taste:
Dissolution of tastants to reach receptors
Washing away the stimulus
Taste Preferences and Aversions:
Mechanisms behind taste preference and aversion
Influence of receptors and neural pathways
Impact of Sensory Nerve Damage:
Degeneration of taste buds if the sensory nerve fiber is cut
Abnormalities of Taste Detection:
Conditions: Ageusia, Hypogeusia, Dysgeusia (parageusia)
Causes: Nerve damage, neurological disorders, infections, poor oral hygiene, adverse drug effects, deficiencies, aging, tobacco use, altered neurotransmitter levels
Neurotransmitters and Taste Threshold:
Effects of serotonin (5-HT) and norepinephrine (NE) on taste sensitivity
Supertasters:
25% of the population with heightened sensitivity to taste, especially bitterness
Increased number of fungiform papillae
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Ve...kevinkariuki227
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
TEST BANK for Operations Management, 14th Edition by William J. Stevenson, Verified Chapters 1 - 19, Complete Newest Version.pdf
These lecture slides, by Dr Sidra Arshad, offer a quick overview of physiological basis of a normal electrocardiogram.
Learning objectives:
1. Define an electrocardiogram (ECG) and electrocardiography
2. Describe how dipoles generated by the heart produce the waveforms of the ECG
3. Describe the components of a normal electrocardiogram of a typical bipolar leads (limb II)
4. Differentiate between intervals and segments
5. Enlist some common indications for obtaining an ECG
Study Resources:
1. Chapter 11, Guyton and Hall Textbook of Medical Physiology, 14th edition
2. Chapter 9, Human Physiology - From Cells to Systems, Lauralee Sherwood, 9th edition
3. Chapter 29, Ganong’s Review of Medical Physiology, 26th edition
4. Electrocardiogram, StatPearls - https://www.ncbi.nlm.nih.gov/books/NBK549803/
5. ECG in Medical Practice by ABM Abdullah, 4th edition
6. ECG Basics, http://www.nataliescasebook.com/tag/e-c-g-basics
Title: Sense of Smell
Presenter: Dr. Faiza, Assistant Professor of Physiology
Qualifications:
MBBS (Best Graduate, AIMC Lahore)
FCPS Physiology
ICMT, CHPE, DHPE (STMU)
MPH (GC University, Faisalabad)
MBA (Virtual University of Pakistan)
Learning Objectives:
Describe the primary categories of smells and the concept of odor blindness.
Explain the structure and location of the olfactory membrane and mucosa, including the types and roles of cells involved in olfaction.
Describe the pathway and mechanisms of olfactory signal transmission from the olfactory receptors to the brain.
Illustrate the biochemical cascade triggered by odorant binding to olfactory receptors, including the role of G-proteins and second messengers in generating an action potential.
Identify different types of olfactory disorders such as anosmia, hyposmia, hyperosmia, and dysosmia, including their potential causes.
Key Topics:
Olfactory Genes:
3% of the human genome accounts for olfactory genes.
400 genes for odorant receptors.
Olfactory Membrane:
Located in the superior part of the nasal cavity.
Medially: Folds downward along the superior septum.
Laterally: Folds over the superior turbinate and upper surface of the middle turbinate.
Total surface area: 5-10 square centimeters.
Olfactory Mucosa:
Olfactory Cells: Bipolar nerve cells derived from the CNS (100 million), with 4-25 olfactory cilia per cell.
Sustentacular Cells: Produce mucus and maintain ionic and molecular environment.
Basal Cells: Replace worn-out olfactory cells with an average lifespan of 1-2 months.
Bowman’s Gland: Secretes mucus.
Stimulation of Olfactory Cells:
Odorant dissolves in mucus and attaches to receptors on olfactory cilia.
Involves a cascade effect through G-proteins and second messengers, leading to depolarization and action potential generation in the olfactory nerve.
Quality of a Good Odorant:
Small (3-20 Carbon atoms), volatile, water-soluble, and lipid-soluble.
Facilitated by odorant-binding proteins in mucus.
Membrane Potential and Action Potential:
Resting membrane potential: -55mV.
Action potential frequency in the olfactory nerve increases with odorant strength.
Adaptation Towards the Sense of Smell:
Rapid adaptation within the first second, with further slow adaptation.
Psychological adaptation greater than receptor adaptation, involving feedback inhibition from the central nervous system.
Primary Sensations of Smell:
Camphoraceous, Musky, Floral, Pepperminty, Ethereal, Pungent, Putrid.
Odor Detection Threshold:
Examples: Hydrogen sulfide (0.0005 ppm), Methyl-mercaptan (0.002 ppm).
Some toxic substances are odorless at lethal concentrations.
Characteristics of Smell:
Odor blindness for single substances due to lack of appropriate receptor protein.
Behavioral and emotional influences of smell.
Transmission of Olfactory Signals:
From olfactory cells to glomeruli in the olfactory bulb, involving lateral inhibition.
Primitive, less old, and new olfactory systems with different path
- Video recording of this lecture in English language: https://youtu.be/lK81BzxMqdo
- Video recording of this lecture in Arabic language: https://youtu.be/Ve4P0COk9OI
- Link to download the book free: https://nephrotube.blogspot.com/p/nephrotube-nephrology-books.html
- Link to NephroTube website: www.NephroTube.com
- Link to NephroTube social media accounts: https://nephrotube.blogspot.com/p/join-nephrotube-on-social-media.html
Acute scrotum is a general term referring to an emergency condition affecting the contents or the wall of the scrotum.
There are a number of conditions that present acutely, predominantly with pain and/or swelling
A careful and detailed history and examination, and in some cases, investigations allow differentiation between these diagnoses. A prompt diagnosis is essential as the patient may require urgent surgical intervention
Testicular torsion refers to twisting of the spermatic cord, causing ischaemia of the testicle.
Testicular torsion results from inadequate fixation of the testis to the tunica vaginalis producing ischemia from reduced arterial inflow and venous outflow obstruction.
The prevalence of testicular torsion in adult patients hospitalized with acute scrotal pain is approximately 25 to 50 percent
ARTIFICIAL INTELLIGENCE IN HEALTHCARE.pdfAnujkumaranit
Artificial intelligence (AI) refers to the simulation of human intelligence processes by machines, especially computer systems. It encompasses tasks such as learning, reasoning, problem-solving, perception, and language understanding. AI technologies are revolutionizing various fields, from healthcare to finance, by enabling machines to perform tasks that typically require human intelligence.
Ethanol (CH3CH2OH), or beverage alcohol, is a two-carbon alcohol
that is rapidly distributed in the body and brain. Ethanol alters many
neurochemical systems and has rewarding and addictive properties. It
is the oldest recreational drug and likely contributes to more morbidity,
mortality, and public health costs than all illicit drugs combined. The
5th edition of the Diagnostic and Statistical Manual of Mental Disorders
(DSM-5) integrates alcohol abuse and alcohol dependence into a single
disorder called alcohol use disorder (AUD), with mild, moderate,
and severe subclassifications (American Psychiatric Association, 2013).
In the DSM-5, all types of substance abuse and dependence have been
combined into a single substance use disorder (SUD) on a continuum
from mild to severe. A diagnosis of AUD requires that at least two of
the 11 DSM-5 behaviors be present within a 12-month period (mild
AUD: 2–3 criteria; moderate AUD: 4–5 criteria; severe AUD: 6–11 criteria).
The four main behavioral effects of AUD are impaired control over
drinking, negative social consequences, risky use, and altered physiological
effects (tolerance, withdrawal). This chapter presents an overview
of the prevalence and harmful consequences of AUD in the U.S.,
the systemic nature of the disease, neurocircuitry and stages of AUD,
comorbidities, fetal alcohol spectrum disorders, genetic risk factors, and
pharmacotherapies for AUD.
Couples presenting to the infertility clinic- Do they really have infertility...Sujoy Dasgupta
Dr Sujoy Dasgupta presented the study on "Couples presenting to the infertility clinic- Do they really have infertility? – The unexplored stories of non-consummation" in the 13th Congress of the Asia Pacific Initiative on Reproduction (ASPIRE 2024) at Manila on 24 May, 2024.
10. Abstract
Millions of individuals worldwide are chronically
exposed to arsenic through their drinking water. Our
primary statistical analysis involved identifying
differentially expressed genes between participants with
and without arsenical skin lesions.In this study, genome-
wide gene expression patterns was evaluated using RNA
from peripheral blood lymphocytes of individuals. Our
findings show that microarray-based gene expression
analysis is a powerful method to characterize the
molecular profile of arsenic exposure and arsenic-
induced diseases.
10
13. Pilot survey
13
40 individuals
15 individuals with
arsenical skin lesions
25 individuals
without lesions
20 individuals 5 individuals
2 arrays
low
arsenic
exposure
<70 µg/g
3 arrays
high
arsenic
exposure
>70 µg/g
6 arrays
low
arsenic
exposure
<162 µg/g
14 arrays
high
arsenic
exposure
>162 µg/g
14. Blood Sample processing
14
Supernatant
plasma was
removed
and sterile
1x PBS
was added
up to 15 mL.
Mononuclear
cells, were
transferred to
another 15 mL
DNase- and
RNase-free tube
and 1x PBS was
added up to 15
mL.
PBS removed
Trizol buffer was
added and stored
at -80°C
Venous blood 10 mL Vacutainer tube Cooler box DNase- and RNase-
free 15 mL tube
Centrifuged at 2,400 rpm
for 10 mins
Centrifuged at 2,700 rpm
for 25 mins.
Centrifuge
Fig : Blood sample processing.
15. RNA extraction
15
-TRIzol samples were incubated at 30°C
-chloroform was added .
-Samples were shaken vigorously by hand for 15 seconds
-incubated at 30°C for 3 minutes.
-Centrifuged at 10,000 rpm for 15 minutes.
-The aqueous phase containing RNA was removed to RNase-free tube and RLT was added.
Then, 500 µL alcohol was added and mixed.
RLT preserved samples were incubated at 37ºCfor 10 minutes.
Centrifugation at 13,000 rpm for 2 minutes. The filter was discarded and 70% alcohol (600 AL) was added.
Sample-filled QIAamp spin column was centrifuged and the filtrate was discarded. RNA was bound to the filter
membrane was washed with RW1 buffer, treated with DNase, and washed again with RW1 buffer followed by
RPE buffer. RNA was eluted in RNase-free water.
16. Microarray analysis
• The Affymetrix genechip standard protocol was followed for
microarray analysis.
16Fig : Schematic representation of microarray process.
Cells from
normal
individual
ccCells from individuals
with arsenical skin
lesions
17. Statistical analysis
For statistical analyses, genes were filtered by applying two
exclusion criteria:
1. genes showing minimal variation across the set of arrays
2. genes with >50% missing data were excluded from statistical analysis.
Gene filtering yeilded separate lists of 4,456 genes.
Gene Ontology (GO) and pathway comparisons were also
conducted based on the lists of 4,456 filtered genes.
For each gene in a GO category, a P for differential expression
comparing the two conditions of interest was computed.
A GO category was considered significantly differentially
expressed if either significance level was <0.005.
17
18. Result
• The number of differentially expressed genes generated
from the significance analysis of microarrays statistic was
468 (467 down-regulated and 1 up-regulated genes in
the skin lesion group).
• Restricting the study sample to females only resulted in
330 differentially expressed genes (all down-regulated in
the skin lesion group).
• Further restricting the study sample to female never-
smokers resulted in 312 differentially expressed genes
(all downregulated in the skin lesion group).
• GO analysis, revealed 41 significant GO categories.
18
19. Discussion
Gene Effect in arsenic affected individuals
Thymopoietin Up-regulated. It is over-expressed in cancer cell
lines
Superoxide dismutase 2 It act as a tumor suppression gene. down-
regulated expression of superoxide dismutase 2 in
individuals with skin lesions, which may indicate
an increased vulnerability to reactive oxygen
species generated by arsenic
Tumor necrosis factor (TNF) It is involved in cell proliferation, differentiation,
apoptosis, lipid metabolism, and coagulation. Its
down regulation lead to deficient wound healing.
19
20. Limitations
• Only mRNAs from coding regions of the
genome are assessed. Recent study suggest
that noncoding regions may also play key
roles in carcinogenesis
• Only RNA with a polyA tail is amplified and
reverse transcribed. A recent study reported
that a substantial proportion of transcribed
messages in the genome may include RNA
without polyA tail and thus may not be detected
in the currently available microarray-based gene
expression analyses.
20
21. 1. Chowdhury A. Arsenic crisis in Bangladesh. Sci Am 2004;291:86 – 91.
2. British Geological Survey. Groundwater studies for arsenic contamination in Bangladesh—
phase 1 findings; 1999 [cited 2005 Apr 14]. Available from: http://www.bgs.ac.uk/arsenic/.
3. IARC. IARC monographs on the evaluation of the carcinogenic risks to humans: arsenic and
arsenic compounds (group 1). Lyon: IARC; 1987.
4. Chen CJ, Chen CW, Wu MM, Kuo TL. Cancer potential in liver, lung, bladder and kidney due to
ingested inorganic arsenic in drinking water. Br J Cancer 1992;66:888 – 92.
5. Hopenhayn-Rich C, Biggs ML, Fuchs A, et al. Bladder cancer mortality associated with arsenic in
drinking water in Argentina. Epidemiology 1996; 7:117 – 24.
6. Hopenhayn-Rich C, Biggs ML, Smith AH. Lung and kidney cancer mortality associated with
arsenic in drinking water in Cordoba, Argentina. Int J Epidemiol 1998;27:561 – 9.
7. Smith AH, Goycolea M, Haque R, Biggs ML. Marked increase in bladder and lung cancer
mortality in a region of northern Chile due to arsenic in drinking water. Am J Epidemiol
1998;147:660 – 9.
8. Tseng WP. Effects and dose-response relationships of skin cancer and blackfoot disease with
arsenic. Environ Health Perspect 1977;19:109 – 19.
9. Brouwer OF, Onkenhout W, Edelbroek PM, de Kom JF, de Wolff FA, Peters AC. Increased
neurotoxicity of arsenic in methylenetetrahydrofolate reductase deficiency. Clin Neurol
Neurosurg 1992;94:307 – 10.
10. Wu M, Kuo TL, Hwang YH, Chen CJ. Dose-response relation between arsenic concentration in
well water and mortality from cancers and vascular diseases. Am J Epidemiol 1989;130:1123
21
References
22. 8. Tseng WP. Effects and dose-response relationships of skin cancer and blackfoot disease with arsenic.
Environ Health Perspect 1977;19:109 – 19.
9. Brouwer OF, Onkenhout W, Edelbroek PM, de Kom JF, de Wolff FA, Peters AC. Increased
neurotoxicity of arsenic in methylenetetrahydrofolate reductase deficiency. Clin Neurol Neurosurg
1992;94:307 – 10.
10. Wu M, Kuo TL, Hwang YH, Chen CJ. Dose-response relation between arsenic concentration in well
water and mortality from cancers and vascular diseases. Am J Epidemiol 1989;130:1123 – 32.
11. Rahman M, Tondel M, Ahmad SA, Axelson O. Diabetes mellitus associated with arsenic exposure in
Bangladesh. Am J Epidemiol 1998;148:198 – 203.
12. Rahman M, Tondel M, Ahmad SA, Chowdhury IA, Faruquee MH, Axelson O. Hypertension and
arsenic exposure in Bangladesh. Hypertension 1999;33: 74 – 8.
13. National Research Council. Arsenic in drinking water 2001 update. Washington (DC): National
Academy Press; 2001.
14. Ahn WS, Bae SM, Lee KH, et al. Comparison of effects of As2O3 and As4O6 on cell growth
inhibition and gene expression profiles by cDNA microarray analysis in SiHa cells. Oncol Rep
2004;12:573 – 80.
15. Bae DS, Hanneman WH, Yang RS, Campain JA. Characterization of gene expression changes
associated with MNNG, arsenic, or metal mixture treatment in human keratinocytes: application
of cDNA microarray technology. Environ Health Perspect 2002;110:931 – 41.
16. Bae DS, Handa RJ, Yang RS, Campain JA. Gene expression patterns as potential molecular
biomarkers for malignant transformation in human keratinocytes treated with MNNG, arsenic, or
a metal mixture. Toxicol Sci 2003;74:32 – 42.
22
23. 23
17. Chen H, Li S, Liu J, Diwan BA, Barrett JC, Waalkes MP. Chronic inorganic arsenic exposure induces
hepatic global and individual gene hypomethylation: implications for arsenic hepatocarcinogenesis.
Carcinogenesis 2004;25: 1779 – 86.
18. Chen H, Liu J, Merrick BA, Waalkes MP. Genetic events associated with arsenic-induced malignant
transformation: applications of cDNA microarray technology. Mol Carcinog 2001;30:79 – 87.
19. Chen H, Liu J, Zhao CQ, Diwan BA, Merrick BA, Waalkes MP. Association of c-myc overexpression and
hyperproliferation with arsenite-induced malignant transformation. Toxicol Appl Pharmacol 2001;175:260
– 8.
20. Chou WC, Chen HY, Yu SL, Cheng L, Yang PC, Dang CV. Arsenic suppresses gene expression in
promyelocytic leukemia cells partly through Sp1 oxidation. Blood 2005;106:304 – 10.
21. Dvorakova K, Payne CM, Tome ME, et al. Molecular and cellular characterization of imexon-resistant
RPMI8226/I myeloma cells. Mol Cancer Ther 2002;1:185 – 95.
22. Hamadeh HK, Trouba KJ, Amin RP, Afshari CA, Germolec D. Coordination of altered DNA repair and
damage pathways in arsenite-exposed keratinocytes. Toxicol Sci 2002;69:306 – 16.
23. Hirano S, Cui X, Li S, et al. Difference in uptake and toxicity of trivalent and
pentavalent inorganic arsenic in rat heart microvessel endothelial cells. Arch
Toxicol 2003;77:305 – 12.
24. Kanzawa T, Zhang L, Xiao L, Germano IM, Kondo Y, Kondo S. Arsenic trioxide induces autophagic cell
death in malignant glioma cells by upregulation of mitochondrial cell death protein BNIP3. Oncogene
2005; 24:980 – 91.
25. Liu J, Chen H,Miller DS, et al. Overexpression of glutathione S-transferase II and multidrug resistance
transport proteins is associated with acquired tolerance to inorganic arsenic. Mol Pharmacol 2001;60:302
– 9.