SlideShare a Scribd company logo
1 of 38
Andrea Puppio- Todos los derechos 
reservados-
Andrea Puppio- Todos los derechos 
reservados-
Líquido amniótico 
(luego sem 16) 
Vellosidad Coriónica 
(sem 12 a 16) 
Andrea Puppio- Todos los derechos 
reservados-
SANGRE O SALIVA U OTRA MUESTRA DE 
LA MADRE, SANGRE EN EDTA, TARJETAS 
FTA, WHATMAN 
VELLOSIDAD O LÍQUIDO AMNIÓTICO 
O 
CORDÓN UMBILICAL 
Andrea Puppio- Todos los derechos 
reservados-
 Depende el estudio 
 Si es solo para STR con 15-20 ml. de líquido 
amniótico en tubo estéril BD es suficiente. Si 
requiere pruebas más complejas consultar al 
laboratorio cantidad necesaria 
 Si es solo para STR con 10-20 vellosidades limpias 
(disgregadas con aguja estéril de posible sangre), y 
llevada a volumen de 15-20 ml de solución 
fisiológica estéril es suficiente. Si requiere pruebas 
más complejas consultar al laboratorio cantidad 
necesaria 
Andrea Puppio- Todos los derechos 
reservados-
 Depende de cada paciente, y debe firmar un 
consentimiento informado donde se le informa a 
la paciente que hasta incluso esta practica puede 
ocasionarle la pérdida del embarazo 
 En general el riesgo es menor que el de una 
cesárea 
 En caso de haber problemas puede suspenderse 
la practica o esperar una semana o dos mas, por 
ejemplo en el caso que existan hematomas 
Andrea Puppio- Todos los derechos 
reservados-
 Se informa en el consentimiento informado sobre los riesgos y 
beneficios de la practica 
 Se le informa que la practica será realizada por el equipo de 
obstetricia bajo total control ecográfico 4D 
 Se solicitan previamente ecografías anteriores, y se solicita 
mandatoriamente los siguientes estudios serológicos de 
Hepatitis B y C, HIV, Toxoplasmosis, VDRL (sifilis), rubeola, y si 
es necesario otros estudios serológicos que puedan afectar al 
embrión. Se solicita también grupo y factor de sangre (en ciertos 
casos se receta aplicación de δ globulina) 
 A los 7 días se le realiza una ecografía de control en la zona de 
la toma de muestra 
Andrea Puppio- Todos los derechos 
reservados-
ES MANDATORIA y no 
se realiza habitualmente 
en América Latina 
Andrea Puppio- Todos los derechos 
reservados-
 Violación 
 Incesto 
 Hallazgo de bebé vivo o 
muerto con el cordón 
umbilical 
 Etc. 
 Determinar la paternidad 
de un niño/a, donde hay 
que saber si hay células 
de la madre mezcladas 
 Determinar si existe o no 
contaminación materna 
para un estudio con fin 
diagnostico (cariotipo, 
estudio molecular, etc.) 
Forenses No forenses 
Andrea Puppio- Todos los derechos 
reservados-
 Check for Maternal Cell Contamination 
◦ Presence of the 2nd maternal allele in the fetal sample at all loci – seen 
as a mixture with peaks of varying heights 
 Compare multiple preps for 
◦ Identity Testing (Compare 2 DNA preps, compare Amnio to CVS, etc) 
◦ Zygosity Testing 
 Demonstrate fetus/Mother relationship 
◦ Allele sharing 
Andrea Puppio- Todos los derechos 
reservados-
 Amniotic Fluid 
 Amniocyte Cultures 
 Chorionic Villi 
 Cultured chorionic villi 
 POC (Products of Conception, usually placenta) 
 Externally extracted DNA from any of these sources 
 + Maternal blood specimen, blood spot, or buccal mucosa 
Andrea Puppio- Todos los derechos 
reservados-
 PCR (long final extension – fragments up to 450bp) 
 Run products on ABI3500 8-cap or Beckman CEQ8000 for 
fragment separation and sizing 
 Review data 
 Confirmations for unexpected results 
◦ Sometimes even contaminated data is usable data! 
 Written genotype analysis submitted to Second Review 
Andrea Puppio- Todos los derechos 
reservados-
AmpFlSTR ID Direct also 
contains: 
D2S1338 
D19S433 
Combined DNA Indexing System – set of 13 loci with highly variable 
Short Tandem Repeats, plus gender XY Andrea Puppio- Todos los derechos 
reservados-
 Forward and reverse primers positioned at known locations 
 Amplify entire sequence between, including the highly variable 
short tandem repeats (TETRA-nucleotide rpts, here: TGAA) 
 Software will calculate the number of repeats based on each 
amplicon’s length (here: 6) 
Andrea Puppio- Todos los derechos 
reservados-
This slide shows the 17 loci in the color of the fluorochrome attached to the primers. Each 
locus has many common alleles, ALL of which are depicted in this artificial mix. A person 
will have 1 or 2 alleles at each locus. AMEL (in red) is not highly polymorphic but is useful 
as a gender test (next slide). 
Andrea Puppio- Todos los derechos 
reservados-
AMELX (amp = 105 bp) vs AMELY (amp = 111 bp) 
TGGGCTCTGTAAAGATAGTGTGTTGATTCTTTATCCC 
TGGGCTCTGTAAAGATAGTGGGTGGATTCTTCATCCC 
AGAT------GTTTCTCAAGTGGTCCTGATTTTACAG 
AAATAAAGTGGTTTCTCAAGTGGTCCTGATTTTACAG 
TTCCTACCACCAGCTTCCCAGTTTAAGCTCTGAT 
TTCCTACCACCAGCTTCCCAGTTTAAGCTCTGAT 
The copy of Amelogenin on X produces amplified DNA of 105 basepairs. 
The copy of Amelogenin on Y produces amplified DNA of 111 basepairs. 
Andrea Puppio- Todos los derechos 
reservados-
Percent of Specimens 
Maternal cells 
increase in CVS 
Andrea Puppio- Todos los derechos 
reservados- 
Amniotic Fluid Amniotic Fluid 
Cultures 
CVS CVS Cultures Products of Conception 
1.8% 0.4% 2.2% 5.5% 20.5% 
Maternal cells 
decrease in amnio 
cultures 
* “Contaminated” = 15-100% of cells are maternal 
cultures 
Tissue collected after 
fetal demise or abortion 
often contains maternal 
tissue.
Good Data without MCC – D3S1358 
 When HET, peaks approx 
equal heights 
 Fetal sample shares 1 allele 
with Mom at every locus 
 Fetal sample must differ from 
Mom for at least 1 locus 
 No peak in fetal prep at 
Mom’s UN-inherited allele 
Fetus 
Mom 
Andrea Puppio- Todos los derechos 
reservados-
Good Data without MCC - AMEL 
Fetus  Heterozygous peaks approx 
equal height – especially 
important for Amel-X and 
Amel-Y 
Mom 
Andrea Puppio- Todos los derechos 
reservados-
Data with MCC – D7S820 
 Peaks in the fetal prep for 
ALL Maternal alleles 
 Easiest to see when both 
Fetus and Mom are 
heterozygous 
 Necessary for calculating 
level of MCC! 
Fetus 
Mom 
Andrea Puppio- Todos los derechos 
reservados-
Data with MCC – D16S539 
Fetus 
Mom 
 Peaks in the fetal prep for 
ALL Maternal alleles 
 Easiest to see when both 
Fetus and Mom are 
heterozygous 
 Necessary for calculating 
level of MCC! 
Andrea Puppio- Todos los derechos 
reservados-
Data with MCC – Which peak is which? 
Fetus 
Mom 
 Which peak is the Mixed Peak? 
 Inheritance from Mom PLUS 
MCC… 
 Which peak is the MCC peak? 
 Mom’s 2nd Allele… 
 Which peak is Fetus Only? 
 “Dad’s” Allele… 
 We’ll calc the level of MCC later… 
Andrea Puppio- Todos los derechos 
reservados-
Data with MCC – D13S317 
 Cannot quantify MCC when 
either sample is HOMOZYGOUS 
 Still visible though, but not 
informative. 
 Ex: Fetus is HOM and 
Mom is HET 
 IMPOSSIBLE to see at loci 
where Fetus and Mom are both 
HOMOZYGOUS 
Fetus 
Mom 
Andrea Puppio- Todos los derechos 
reservados-
Calculating % MCC – D8S1179 
 Marker must be informative: 
 Fetus heterozygous 
 Mom heterozygous 
 Different HET 
MCCarea 
Fetusarea + MCCarea 
x 100 = % MCC 
Andrea Puppio- Todos los derechos 
reservados-
Calculating MCC Level (%MCC) 
 Back to our previous example… D16S539 
6692 
5633 + 6692 
x 100 
= 54% MCC 
Mixed 
Fetus 
MCC 
 MCC peak will be bigger than the Fetus Only peak when 
MCC level is 50% or more 
Andrea Puppio- Todos los derechos 
reservados-
 Uninformative… Why??? 
 no Fetus Only (Paternal) peak… 
833 
? + 833 
x 100 
Calculating MCC Level (%) 
= ? %MCC 
Mixed 
MCC 
Andrea Puppio- Todos los derechos 
reservados-
Serendipitous Findings – non-MCC 
 Trisomies detected (apparent*): 4, 8, 11, 13, 15, 16, 18, 21 
 Some in Mosaic amounts 
Fetus 
Mom 
*Apparent since we target only one locus or gene, not entire chromosomes – NOT 
reportable based solely on MCC results 
Andrea Puppio- Todos los derechos 
reservados-
Serendipitous Findings – non-MCC (con’t) 
 XYY Syndrome (known) 
Fetus 
Mom 
 Trisomy rescue??? 
 Uniparental heterodisomy 
 Gain/Loss of a repeat length??? 
 Need Dad to solve... 
 Either way – no imprinting of Chr21 
Fetus 
Mom 
Andrea Puppio- Todos los derechos 
reservados-
 We can visually assess for Maternal Cell Contamination by 
the presence of 2nd maternal alleles (informative) 
 We can demonstrate Identity between fetal preps 
 We can determine that it is highly probable that a fetal 
sample is related to the Maternal sample indicated 
 We can confirm certain findings from other platforms IF we 
have an STR on the same chromosome 
Andrea Puppio- Todos los derechos 
reservados-
Case 1: Hydrocephalus detected on sonogram. Sequencing of the X-linked gene 
L1CAM gene was NEGATIVE on amnio cultures. It was important to make sure the 
DNA was not the mother’s. 
Amelogenin 
Mother has X 
Fetus has X 
and Y in equal 
amounts. 
Fetus is male 
and has no 
contamination. 
At this locus on 
Chr 18, 
Mother = 17, 18. 
Fetus = 13, 18. 
No contamination. 
D18S51 
Andrea Puppio- Todos los derechos 
reservados-
Case 1: Two other loci shown. Final interpretation was “Not 
Contaminated” 
D8S1179 
D13S317 
At this locus on 
Chr 8, 
Mother = 10, 13. 
Fetus = 10, 13. 
Not informative. 
At this locus on 
Chr 13, 
Mother = 8, 10. 
Fetus = 10, 11. 
No contamination. 
Andrea Puppio- Todos los derechos 
reservados-
Case 2: Test for Noonan Syndrome due to increased nuchal 
translucency. CVS cultures were submitted. 
D7S820 
TH01 
D8S1179 
CSF1PO 
All markers showed that the “fetal sample” was 100% 
overgrown with maternal cells. The gene sequence for the 
Noonan Syndrome genes could not be inteArpndrreeat ePudp.pio- Todos los derechos 
reservados-
Case 3: Prenatal Diagnosis for Junctional Epidermolyis Bullosa 
1. Baby with Junctional EB, died. DNA was saved. 
2. Test hotspots in Lamin 5 genes --> no mutations 
3. Sequence LAMB3 --> no mutations 
4. Sequenced LAMC2 --> no mutations 
5. Sequenced LAMA3 --> no mutations 
6. Pregnant! 
7. Sequenced COL17A1---> 2 different mutations found 
8. CVS ---> Very small sample, uncultured, positive for maternal 
contamination. 
Andrea Puppio- Todos los derechos 
reservados-
Case 3: MCC results on the first CVS Sample. 
C = CVS, M= Mother, F = Father* 
C 
Amelogenin X vs. Y D3S1358 D18S317 TH01 
All markers show maternal DNA in the fetal specimen. There are 
3 peaks, or, one peak is too high. 
M 
F 
* Testing of fathers is not necessary and is not done now. 
Andrea Puppio- Todos los derechos 
reservados-
Case 3: Prenatal Diagnosis for Junctional Epidermolyis Bullosa 
9. We did not test the cultures that were available from the first CVS 
procedure. They would be contaminated also. We requested they 
perform another CVS procedure and obtain a larger specimen. 
10. Repeat CVS --> Larger sample, uncultured, was free of maternal 
contamination. 
11. The COL17A1 result using the 2nd CVS specimen was: 
Maternal COL17A1 mutation PRESENT 
Paternal COL17A1 mutation ABSENT 
9. This result is indistinguishable from the maternal genotype but we 
know that it is the fetus’s genotype and he will be an unaffected 
carrier. 
Andrea Puppio- Todos los derechos 
reservados-
Utilización de Identifiler, Powerplex 
Mínimo de 15 loci + amelogenina 
Andrea Puppio- Todos los derechos 
reservados-
Andrea Puppio- Todos los derechos 
reservados-
 Preguntas 
 andreapuppio@gmail.com 
 +5411-4778-1724 
 Skype: andreapuppio 
Andrea Puppio- Todos los derechos 
reservados-

More Related Content

What's hot

Hematopoietic stem cell transplantation for patients with AML
Hematopoietic stem cell transplantation for patients with AMLHematopoietic stem cell transplantation for patients with AML
Hematopoietic stem cell transplantation for patients with AMLAmir Abbas Hedayati Asl
 
Adequacy criteria for cytology specimens by Dr. Mahra Nourbakhsh
Adequacy criteria for cytology specimens by Dr. Mahra NourbakhshAdequacy criteria for cytology specimens by Dr. Mahra Nourbakhsh
Adequacy criteria for cytology specimens by Dr. Mahra NourbakhshMahra Nourbakhsh
 
Molecular profiling in breast cancer
Molecular profiling in breast cancerMolecular profiling in breast cancer
Molecular profiling in breast cancerShashidhara TS
 
Approach to undifferentiated tumors
Approach to undifferentiated tumorsApproach to undifferentiated tumors
Approach to undifferentiated tumorsDr. Varughese George
 
The bethesda system for reporting thyroid cytopathology
The bethesda system for reporting thyroid cytopathologyThe bethesda system for reporting thyroid cytopathology
The bethesda system for reporting thyroid cytopathologyIndira Shastry
 
Interpretation of testicular biopsy
Interpretation of testicular biopsyInterpretation of testicular biopsy
Interpretation of testicular biopsyAppy Akshay Agarwal
 
Classification and diagnostic approach to fnac of mediastinal
Classification and diagnostic approach to fnac of mediastinalClassification and diagnostic approach to fnac of mediastinal
Classification and diagnostic approach to fnac of mediastinalIndira Shastry
 
Molecular classification of endometrial cancer
Molecular classification of endometrial cancerMolecular classification of endometrial cancer
Molecular classification of endometrial cancerMohammed Nassar
 
Whipple's specimen grossing
Whipple's  specimen grossingWhipple's  specimen grossing
Whipple's specimen grossingDr.Pooja Dwivedi
 
Stem cells as a cause of cancers
Stem cells as a cause of cancersStem cells as a cause of cancers
Stem cells as a cause of cancersAndleeb Sultana
 
Epithelial and mesenchymal transition in invasion and metastasis
Epithelial and mesenchymal transition in invasion and metastasisEpithelial and mesenchymal transition in invasion and metastasis
Epithelial and mesenchymal transition in invasion and metastasisAshwini Gowda
 
Molecular diagnostics of colorectal cancer
Molecular diagnostics   of colorectal cancerMolecular diagnostics   of colorectal cancer
Molecular diagnostics of colorectal cancerAddisu Alemu
 

What's hot (20)

Hematopoietic stem cell transplantation for patients with AML
Hematopoietic stem cell transplantation for patients with AMLHematopoietic stem cell transplantation for patients with AML
Hematopoietic stem cell transplantation for patients with AML
 
Adequacy criteria for cytology specimens by Dr. Mahra Nourbakhsh
Adequacy criteria for cytology specimens by Dr. Mahra NourbakhshAdequacy criteria for cytology specimens by Dr. Mahra Nourbakhsh
Adequacy criteria for cytology specimens by Dr. Mahra Nourbakhsh
 
Molecular profiling in breast cancer
Molecular profiling in breast cancerMolecular profiling in breast cancer
Molecular profiling in breast cancer
 
Approach to undifferentiated tumors
Approach to undifferentiated tumorsApproach to undifferentiated tumors
Approach to undifferentiated tumors
 
Immunohistochemistry
Immunohistochemistry Immunohistochemistry
Immunohistochemistry
 
The bethesda system for reporting thyroid cytopathology
The bethesda system for reporting thyroid cytopathologyThe bethesda system for reporting thyroid cytopathology
The bethesda system for reporting thyroid cytopathology
 
Genetics of Breast Cancer
Genetics of Breast CancerGenetics of Breast Cancer
Genetics of Breast Cancer
 
Metastasis pg activity
Metastasis pg activityMetastasis pg activity
Metastasis pg activity
 
Interpretation of testicular biopsy
Interpretation of testicular biopsyInterpretation of testicular biopsy
Interpretation of testicular biopsy
 
PEComas
PEComasPEComas
PEComas
 
Classification and diagnostic approach to fnac of mediastinal
Classification and diagnostic approach to fnac of mediastinalClassification and diagnostic approach to fnac of mediastinal
Classification and diagnostic approach to fnac of mediastinal
 
Molecular classification of endometrial cancer
Molecular classification of endometrial cancerMolecular classification of endometrial cancer
Molecular classification of endometrial cancer
 
Whipple's specimen grossing
Whipple's  specimen grossingWhipple's  specimen grossing
Whipple's specimen grossing
 
Microsatellite instability
Microsatellite instabilityMicrosatellite instability
Microsatellite instability
 
Factor V Leiden
Factor V LeidenFactor V Leiden
Factor V Leiden
 
Stem cells as a cause of cancers
Stem cells as a cause of cancersStem cells as a cause of cancers
Stem cells as a cause of cancers
 
Yokohama system cytology
Yokohama system cytologyYokohama system cytology
Yokohama system cytology
 
Epithelial and mesenchymal transition in invasion and metastasis
Epithelial and mesenchymal transition in invasion and metastasisEpithelial and mesenchymal transition in invasion and metastasis
Epithelial and mesenchymal transition in invasion and metastasis
 
Minimal residual disease
Minimal residual diseaseMinimal residual disease
Minimal residual disease
 
Molecular diagnostics of colorectal cancer
Molecular diagnostics   of colorectal cancerMolecular diagnostics   of colorectal cancer
Molecular diagnostics of colorectal cancer
 

Viewers also liked

Cinematica de crecimiento
Cinematica de crecimientoCinematica de crecimiento
Cinematica de crecimientoyehet 94
 
Lab. genetica forense2010
Lab. genetica forense2010Lab. genetica forense2010
Lab. genetica forense2010tanny88
 
Dnaprofiling
DnaprofilingDnaprofiling
Dnaprofilingallyjer
 
Regulacion de Crecimiento de Factores Internos
Regulacion de Crecimiento de Factores InternosRegulacion de Crecimiento de Factores Internos
Regulacion de Crecimiento de Factores InternosRosmery Vargas
 
ENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULAR
ENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULARENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULAR
ENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULARRobert Manuel Bracho
 
Proteinas derivadas del esmalte dme
Proteinas derivadas del esmalte dmeProteinas derivadas del esmalte dme
Proteinas derivadas del esmalte dmeArantxa Zamarripa
 
Third trimester Bleeding
Third trimester BleedingThird trimester Bleeding
Third trimester BleedingTana Kiak
 
Biología del Esmalte Dental Humano
Biología del Esmalte Dental HumanoBiología del Esmalte Dental Humano
Biología del Esmalte Dental HumanoJuan Carlos Munévar
 

Viewers also liked (10)

Cccontamination
CccontaminationCccontamination
Cccontamination
 
Cinematica de crecimiento
Cinematica de crecimientoCinematica de crecimiento
Cinematica de crecimiento
 
Lab. genetica forense2010
Lab. genetica forense2010Lab. genetica forense2010
Lab. genetica forense2010
 
Dnaprofiling
DnaprofilingDnaprofiling
Dnaprofiling
 
Regulacion de Crecimiento de Factores Internos
Regulacion de Crecimiento de Factores InternosRegulacion de Crecimiento de Factores Internos
Regulacion de Crecimiento de Factores Internos
 
ENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULAR
ENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULARENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULAR
ENFERMEDADES INMUNOLÓGICAS Y DEL COLÁGENO VASCULAR
 
Proteinas derivadas del esmalte dme
Proteinas derivadas del esmalte dmeProteinas derivadas del esmalte dme
Proteinas derivadas del esmalte dme
 
Third trimester Bleeding
Third trimester BleedingThird trimester Bleeding
Third trimester Bleeding
 
Biología del Esmalte Dental Humano
Biología del Esmalte Dental HumanoBiología del Esmalte Dental Humano
Biología del Esmalte Dental Humano
 
Colágeno
Colágeno Colágeno
Colágeno
 

Similar to Maternal cell contamination (mcc) testing 2014 ecuador_draft

Practical 5 07
Practical 5 07Practical 5 07
Practical 5 07medik.cz
 
NIPT inservice talk May 2015
NIPT inservice talk May 2015NIPT inservice talk May 2015
NIPT inservice talk May 2015Kathryn Murray
 
Prenatal diagnosis
Prenatal diagnosisPrenatal diagnosis
Prenatal diagnosisobgymgmcri
 
Biochemical parameters
Biochemical parametersBiochemical parameters
Biochemical parameterspoojasingh974
 
NIPT, Dr. Sharda Jain, Life Care centre
NIPT, Dr. Sharda Jain, Life Care centre NIPT, Dr. Sharda Jain, Life Care centre
NIPT, Dr. Sharda Jain, Life Care centre Lifecare Centre
 
genetic tests.pptx
genetic tests.pptxgenetic tests.pptx
genetic tests.pptxmkniranda
 
Antenatal monitoring of fetal well being 2
Antenatal monitoring of fetal well being 2Antenatal monitoring of fetal well being 2
Antenatal monitoring of fetal well being 2ravikanth gowder
 
pregnancy &prenatal diagnosisi
pregnancy &prenatal diagnosisipregnancy &prenatal diagnosisi
pregnancy &prenatal diagnosisiPALANIANANTH.S
 
Antenatal fetal surveillance dr rabi
Antenatal fetal surveillance dr rabiAntenatal fetal surveillance dr rabi
Antenatal fetal surveillance dr rabiRabi Satpathy
 
Ultrasonography Scans in Pregnancy
Ultrasonography Scans in PregnancyUltrasonography Scans in Pregnancy
Ultrasonography Scans in PregnancyDrNisheethOza
 
prenatal genet.pptx
prenatal genet.pptxprenatal genet.pptx
prenatal genet.pptxkrts131j
 
02 giuseppe sarli
02 giuseppe sarli02 giuseppe sarli
02 giuseppe sarliMerial EMEA
 
Genetictesting 140305094745-phpapp01
Genetictesting 140305094745-phpapp01Genetictesting 140305094745-phpapp01
Genetictesting 140305094745-phpapp01t7260678
 
Genetic screening..dr.padmesh
Genetic screening..dr.padmeshGenetic screening..dr.padmesh
Genetic screening..dr.padmeshv_padmesh
 
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandunganPrenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandunganHendrik Sutopo
 

Similar to Maternal cell contamination (mcc) testing 2014 ecuador_draft (20)

Maternal screening in Pregnancy (Double & quadruple marker)
Maternal screening in Pregnancy (Double & quadruple marker)Maternal screening in Pregnancy (Double & quadruple marker)
Maternal screening in Pregnancy (Double & quadruple marker)
 
Practical 5 07
Practical 5 07Practical 5 07
Practical 5 07
 
NIPT inservice talk May 2015
NIPT inservice talk May 2015NIPT inservice talk May 2015
NIPT inservice talk May 2015
 
Prenatal diagnosis
Prenatal diagnosisPrenatal diagnosis
Prenatal diagnosis
 
Prenatal cytogenetic
Prenatal cytogenetic Prenatal cytogenetic
Prenatal cytogenetic
 
Biochemical parameters
Biochemical parametersBiochemical parameters
Biochemical parameters
 
NIPT, Dr. Sharda Jain, Life Care centre
NIPT, Dr. Sharda Jain, Life Care centre NIPT, Dr. Sharda Jain, Life Care centre
NIPT, Dr. Sharda Jain, Life Care centre
 
genetic tests.pptx
genetic tests.pptxgenetic tests.pptx
genetic tests.pptx
 
Antenatal monitoring of fetal well being 2
Antenatal monitoring of fetal well being 2Antenatal monitoring of fetal well being 2
Antenatal monitoring of fetal well being 2
 
Prenatal diagnosis
Prenatal diagnosis Prenatal diagnosis
Prenatal diagnosis
 
pregnancy &prenatal diagnosisi
pregnancy &prenatal diagnosisipregnancy &prenatal diagnosisi
pregnancy &prenatal diagnosisi
 
Antenatal fetal surveillance dr rabi
Antenatal fetal surveillance dr rabiAntenatal fetal surveillance dr rabi
Antenatal fetal surveillance dr rabi
 
Ultrasonography Scans in Pregnancy
Ultrasonography Scans in PregnancyUltrasonography Scans in Pregnancy
Ultrasonography Scans in Pregnancy
 
prenatal diagnosis.ppt..pptx
prenatal diagnosis.ppt..pptxprenatal diagnosis.ppt..pptx
prenatal diagnosis.ppt..pptx
 
prenatal genet.pptx
prenatal genet.pptxprenatal genet.pptx
prenatal genet.pptx
 
02 giuseppe sarli
02 giuseppe sarli02 giuseppe sarli
02 giuseppe sarli
 
Genetictesting 140305094745-phpapp01
Genetictesting 140305094745-phpapp01Genetictesting 140305094745-phpapp01
Genetictesting 140305094745-phpapp01
 
Fertility tests
Fertility testsFertility tests
Fertility tests
 
Genetic screening..dr.padmesh
Genetic screening..dr.padmeshGenetic screening..dr.padmesh
Genetic screening..dr.padmesh
 
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandunganPrenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
Prenatal Testing, deteksi kelainan bawaan sejak dalam kandungan
 

Recently uploaded

Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Lokesh Kothari
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...Sérgio Sacani
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksSérgio Sacani
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...jana861314
 
Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Patrick Diehl
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptxRajatChauhan518211
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisDiwakar Mishra
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTSérgio Sacani
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfSumit Kumar yadav
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRDelhi Call girls
 
GFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptxGFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptxAleenaTreesaSaji
 
Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)PraveenaKalaiselvan1
 
Cultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxCultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxpradhanghanshyam7136
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPirithiRaju
 
Isotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoIsotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoSérgio Sacani
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfSumit Kumar yadav
 
Broad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptxBroad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptxjana861314
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxgindu3009
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxUmerFayaz5
 

Recently uploaded (20)

Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 
CELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdfCELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdf
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 
Formation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disksFormation of low mass protostars and their circumstellar disks
Formation of low mass protostars and their circumstellar disks
 
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
Traditional Agroforestry System in India- Shifting Cultivation, Taungya, Home...
 
Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?Is RISC-V ready for HPC workload? Maybe?
Is RISC-V ready for HPC workload? Maybe?
 
Green chemistry and Sustainable development.pptx
Green chemistry  and Sustainable development.pptxGreen chemistry  and Sustainable development.pptx
Green chemistry and Sustainable development.pptx
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdf
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
 
GFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptxGFP in rDNA Technology (Biotechnology).pptx
GFP in rDNA Technology (Biotechnology).pptx
 
Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)Recombinant DNA technology (Immunological screening)
Recombinant DNA technology (Immunological screening)
 
Cultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptxCultivation of KODO MILLET . made by Ghanshyam pptx
Cultivation of KODO MILLET . made by Ghanshyam pptx
 
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdfPests of cotton_Sucking_Pests_Dr.UPR.pdf
Pests of cotton_Sucking_Pests_Dr.UPR.pdf
 
Isotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on IoIsotopic evidence of long-lived volcanism on Io
Isotopic evidence of long-lived volcanism on Io
 
Zoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdfZoology 4th semester series (krishna).pdf
Zoology 4th semester series (krishna).pdf
 
Broad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptxBroad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptx
 
Presentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptxPresentation Vikram Lander by Vedansh Gupta.pptx
Presentation Vikram Lander by Vedansh Gupta.pptx
 
Animal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptxAnimal Communication- Auditory and Visual.pptx
Animal Communication- Auditory and Visual.pptx
 

Maternal cell contamination (mcc) testing 2014 ecuador_draft

  • 1. Andrea Puppio- Todos los derechos reservados-
  • 2. Andrea Puppio- Todos los derechos reservados-
  • 3. Líquido amniótico (luego sem 16) Vellosidad Coriónica (sem 12 a 16) Andrea Puppio- Todos los derechos reservados-
  • 4. SANGRE O SALIVA U OTRA MUESTRA DE LA MADRE, SANGRE EN EDTA, TARJETAS FTA, WHATMAN VELLOSIDAD O LÍQUIDO AMNIÓTICO O CORDÓN UMBILICAL Andrea Puppio- Todos los derechos reservados-
  • 5.  Depende el estudio  Si es solo para STR con 15-20 ml. de líquido amniótico en tubo estéril BD es suficiente. Si requiere pruebas más complejas consultar al laboratorio cantidad necesaria  Si es solo para STR con 10-20 vellosidades limpias (disgregadas con aguja estéril de posible sangre), y llevada a volumen de 15-20 ml de solución fisiológica estéril es suficiente. Si requiere pruebas más complejas consultar al laboratorio cantidad necesaria Andrea Puppio- Todos los derechos reservados-
  • 6.  Depende de cada paciente, y debe firmar un consentimiento informado donde se le informa a la paciente que hasta incluso esta practica puede ocasionarle la pérdida del embarazo  En general el riesgo es menor que el de una cesárea  En caso de haber problemas puede suspenderse la practica o esperar una semana o dos mas, por ejemplo en el caso que existan hematomas Andrea Puppio- Todos los derechos reservados-
  • 7.  Se informa en el consentimiento informado sobre los riesgos y beneficios de la practica  Se le informa que la practica será realizada por el equipo de obstetricia bajo total control ecográfico 4D  Se solicitan previamente ecografías anteriores, y se solicita mandatoriamente los siguientes estudios serológicos de Hepatitis B y C, HIV, Toxoplasmosis, VDRL (sifilis), rubeola, y si es necesario otros estudios serológicos que puedan afectar al embrión. Se solicita también grupo y factor de sangre (en ciertos casos se receta aplicación de δ globulina)  A los 7 días se le realiza una ecografía de control en la zona de la toma de muestra Andrea Puppio- Todos los derechos reservados-
  • 8. ES MANDATORIA y no se realiza habitualmente en América Latina Andrea Puppio- Todos los derechos reservados-
  • 9.  Violación  Incesto  Hallazgo de bebé vivo o muerto con el cordón umbilical  Etc.  Determinar la paternidad de un niño/a, donde hay que saber si hay células de la madre mezcladas  Determinar si existe o no contaminación materna para un estudio con fin diagnostico (cariotipo, estudio molecular, etc.) Forenses No forenses Andrea Puppio- Todos los derechos reservados-
  • 10.  Check for Maternal Cell Contamination ◦ Presence of the 2nd maternal allele in the fetal sample at all loci – seen as a mixture with peaks of varying heights  Compare multiple preps for ◦ Identity Testing (Compare 2 DNA preps, compare Amnio to CVS, etc) ◦ Zygosity Testing  Demonstrate fetus/Mother relationship ◦ Allele sharing Andrea Puppio- Todos los derechos reservados-
  • 11.  Amniotic Fluid  Amniocyte Cultures  Chorionic Villi  Cultured chorionic villi  POC (Products of Conception, usually placenta)  Externally extracted DNA from any of these sources  + Maternal blood specimen, blood spot, or buccal mucosa Andrea Puppio- Todos los derechos reservados-
  • 12.  PCR (long final extension – fragments up to 450bp)  Run products on ABI3500 8-cap or Beckman CEQ8000 for fragment separation and sizing  Review data  Confirmations for unexpected results ◦ Sometimes even contaminated data is usable data!  Written genotype analysis submitted to Second Review Andrea Puppio- Todos los derechos reservados-
  • 13. AmpFlSTR ID Direct also contains: D2S1338 D19S433 Combined DNA Indexing System – set of 13 loci with highly variable Short Tandem Repeats, plus gender XY Andrea Puppio- Todos los derechos reservados-
  • 14.  Forward and reverse primers positioned at known locations  Amplify entire sequence between, including the highly variable short tandem repeats (TETRA-nucleotide rpts, here: TGAA)  Software will calculate the number of repeats based on each amplicon’s length (here: 6) Andrea Puppio- Todos los derechos reservados-
  • 15. This slide shows the 17 loci in the color of the fluorochrome attached to the primers. Each locus has many common alleles, ALL of which are depicted in this artificial mix. A person will have 1 or 2 alleles at each locus. AMEL (in red) is not highly polymorphic but is useful as a gender test (next slide). Andrea Puppio- Todos los derechos reservados-
  • 16. AMELX (amp = 105 bp) vs AMELY (amp = 111 bp) TGGGCTCTGTAAAGATAGTGTGTTGATTCTTTATCCC TGGGCTCTGTAAAGATAGTGGGTGGATTCTTCATCCC AGAT------GTTTCTCAAGTGGTCCTGATTTTACAG AAATAAAGTGGTTTCTCAAGTGGTCCTGATTTTACAG TTCCTACCACCAGCTTCCCAGTTTAAGCTCTGAT TTCCTACCACCAGCTTCCCAGTTTAAGCTCTGAT The copy of Amelogenin on X produces amplified DNA of 105 basepairs. The copy of Amelogenin on Y produces amplified DNA of 111 basepairs. Andrea Puppio- Todos los derechos reservados-
  • 17. Percent of Specimens Maternal cells increase in CVS Andrea Puppio- Todos los derechos reservados- Amniotic Fluid Amniotic Fluid Cultures CVS CVS Cultures Products of Conception 1.8% 0.4% 2.2% 5.5% 20.5% Maternal cells decrease in amnio cultures * “Contaminated” = 15-100% of cells are maternal cultures Tissue collected after fetal demise or abortion often contains maternal tissue.
  • 18. Good Data without MCC – D3S1358  When HET, peaks approx equal heights  Fetal sample shares 1 allele with Mom at every locus  Fetal sample must differ from Mom for at least 1 locus  No peak in fetal prep at Mom’s UN-inherited allele Fetus Mom Andrea Puppio- Todos los derechos reservados-
  • 19. Good Data without MCC - AMEL Fetus  Heterozygous peaks approx equal height – especially important for Amel-X and Amel-Y Mom Andrea Puppio- Todos los derechos reservados-
  • 20. Data with MCC – D7S820  Peaks in the fetal prep for ALL Maternal alleles  Easiest to see when both Fetus and Mom are heterozygous  Necessary for calculating level of MCC! Fetus Mom Andrea Puppio- Todos los derechos reservados-
  • 21. Data with MCC – D16S539 Fetus Mom  Peaks in the fetal prep for ALL Maternal alleles  Easiest to see when both Fetus and Mom are heterozygous  Necessary for calculating level of MCC! Andrea Puppio- Todos los derechos reservados-
  • 22. Data with MCC – Which peak is which? Fetus Mom  Which peak is the Mixed Peak?  Inheritance from Mom PLUS MCC…  Which peak is the MCC peak?  Mom’s 2nd Allele…  Which peak is Fetus Only?  “Dad’s” Allele…  We’ll calc the level of MCC later… Andrea Puppio- Todos los derechos reservados-
  • 23. Data with MCC – D13S317  Cannot quantify MCC when either sample is HOMOZYGOUS  Still visible though, but not informative.  Ex: Fetus is HOM and Mom is HET  IMPOSSIBLE to see at loci where Fetus and Mom are both HOMOZYGOUS Fetus Mom Andrea Puppio- Todos los derechos reservados-
  • 24. Calculating % MCC – D8S1179  Marker must be informative:  Fetus heterozygous  Mom heterozygous  Different HET MCCarea Fetusarea + MCCarea x 100 = % MCC Andrea Puppio- Todos los derechos reservados-
  • 25. Calculating MCC Level (%MCC)  Back to our previous example… D16S539 6692 5633 + 6692 x 100 = 54% MCC Mixed Fetus MCC  MCC peak will be bigger than the Fetus Only peak when MCC level is 50% or more Andrea Puppio- Todos los derechos reservados-
  • 26.  Uninformative… Why???  no Fetus Only (Paternal) peak… 833 ? + 833 x 100 Calculating MCC Level (%) = ? %MCC Mixed MCC Andrea Puppio- Todos los derechos reservados-
  • 27. Serendipitous Findings – non-MCC  Trisomies detected (apparent*): 4, 8, 11, 13, 15, 16, 18, 21  Some in Mosaic amounts Fetus Mom *Apparent since we target only one locus or gene, not entire chromosomes – NOT reportable based solely on MCC results Andrea Puppio- Todos los derechos reservados-
  • 28. Serendipitous Findings – non-MCC (con’t)  XYY Syndrome (known) Fetus Mom  Trisomy rescue???  Uniparental heterodisomy  Gain/Loss of a repeat length???  Need Dad to solve...  Either way – no imprinting of Chr21 Fetus Mom Andrea Puppio- Todos los derechos reservados-
  • 29.  We can visually assess for Maternal Cell Contamination by the presence of 2nd maternal alleles (informative)  We can demonstrate Identity between fetal preps  We can determine that it is highly probable that a fetal sample is related to the Maternal sample indicated  We can confirm certain findings from other platforms IF we have an STR on the same chromosome Andrea Puppio- Todos los derechos reservados-
  • 30. Case 1: Hydrocephalus detected on sonogram. Sequencing of the X-linked gene L1CAM gene was NEGATIVE on amnio cultures. It was important to make sure the DNA was not the mother’s. Amelogenin Mother has X Fetus has X and Y in equal amounts. Fetus is male and has no contamination. At this locus on Chr 18, Mother = 17, 18. Fetus = 13, 18. No contamination. D18S51 Andrea Puppio- Todos los derechos reservados-
  • 31. Case 1: Two other loci shown. Final interpretation was “Not Contaminated” D8S1179 D13S317 At this locus on Chr 8, Mother = 10, 13. Fetus = 10, 13. Not informative. At this locus on Chr 13, Mother = 8, 10. Fetus = 10, 11. No contamination. Andrea Puppio- Todos los derechos reservados-
  • 32. Case 2: Test for Noonan Syndrome due to increased nuchal translucency. CVS cultures were submitted. D7S820 TH01 D8S1179 CSF1PO All markers showed that the “fetal sample” was 100% overgrown with maternal cells. The gene sequence for the Noonan Syndrome genes could not be inteArpndrreeat ePudp.pio- Todos los derechos reservados-
  • 33. Case 3: Prenatal Diagnosis for Junctional Epidermolyis Bullosa 1. Baby with Junctional EB, died. DNA was saved. 2. Test hotspots in Lamin 5 genes --> no mutations 3. Sequence LAMB3 --> no mutations 4. Sequenced LAMC2 --> no mutations 5. Sequenced LAMA3 --> no mutations 6. Pregnant! 7. Sequenced COL17A1---> 2 different mutations found 8. CVS ---> Very small sample, uncultured, positive for maternal contamination. Andrea Puppio- Todos los derechos reservados-
  • 34. Case 3: MCC results on the first CVS Sample. C = CVS, M= Mother, F = Father* C Amelogenin X vs. Y D3S1358 D18S317 TH01 All markers show maternal DNA in the fetal specimen. There are 3 peaks, or, one peak is too high. M F * Testing of fathers is not necessary and is not done now. Andrea Puppio- Todos los derechos reservados-
  • 35. Case 3: Prenatal Diagnosis for Junctional Epidermolyis Bullosa 9. We did not test the cultures that were available from the first CVS procedure. They would be contaminated also. We requested they perform another CVS procedure and obtain a larger specimen. 10. Repeat CVS --> Larger sample, uncultured, was free of maternal contamination. 11. The COL17A1 result using the 2nd CVS specimen was: Maternal COL17A1 mutation PRESENT Paternal COL17A1 mutation ABSENT 9. This result is indistinguishable from the maternal genotype but we know that it is the fetus’s genotype and he will be an unaffected carrier. Andrea Puppio- Todos los derechos reservados-
  • 36. Utilización de Identifiler, Powerplex Mínimo de 15 loci + amelogenina Andrea Puppio- Todos los derechos reservados-
  • 37. Andrea Puppio- Todos los derechos reservados-
  • 38.  Preguntas  andreapuppio@gmail.com  +5411-4778-1724  Skype: andreapuppio Andrea Puppio- Todos los derechos reservados-