Successfully reported this slideshow.
We use your LinkedIn profile and activity data to personalize ads and to show you more relevant ads. You can change your ad preferences anytime.

NIPT inservice talk May 2015

6,066 views

Published on

NIPT inservice talk May 2015

  1. 1. Kathryn Murray, MS, CGC Center for Genetics May 2015 541-349-7600 NIPT The Present and Future of Prenatal Diagnosis
  2. 2. Some slides used with permission from: • Verinata Laboratory • Sequenom Laboratory • Natara Laboratory • Charlotte Clausen, MD
  3. 3. Disclosure  Lecturer for Myriad Genetics regarding Inherited Cancer Syndromes  I have no affiliation with any company mentioned during this presentation
  4. 4. Objectives  Describe the different techniques used to evaluate fetal DNA in the maternal serum.  Identify appropriate candidates for non invasive prenatal testing(NIPT).  Understand the benefits and limitations of NIPT.
  5. 5. PRESENTATION-0029 vB ACOG Committee Opinion on NIPT  “Cell free fetal DNA appears to be the most effective screening test for aneuploidy in high risk women… is one option that can be used as a primary screening test in women at increased risk of aneuploidy”  “[NIPT] should be an informed patient choice after pretest counseling”  “[NIPT] should not be offered to low-risk women or women with multiple gestations”  “A patient with a positive test result should be referred for genetic counseling and should be offered invasive prenatal diagnosis for confirmation of test results.” Also supporting NIPT for high risk pregnancies: 5
  6. 6. PRESENTATION-0029 vB ACOG Practice Advisory on Cell-Free DNA Screening • April 2015: Committee opinion is being re- evaluated based on extending testing to low risk women. • In response to additional publications - Large Meta analysis & large study in low risk women.
  7. 7. PRESENTATION-0029 vB Glossary of Abbreviations Abbreviation Meaning NGS Next Generation Sequencing MPS Massively Parallel Sequencing NCV Normalized Chromosome Value NIPT NIPS Noninvasive Prenatal Testing Noninvasive Prenatal Screening cfDNA Cell Free DNA ART Assisted Reproductive Technology SAFeR™ Selective Algorithm for Fetal Results CPM Confined Placental Mosaicism 7
  8. 8. History of antenatal testing  1966- amniocentesis  1970’s- age alone  1980’s – AFP – Triple screen- 72% detection 5% False positive – Quad screen- 79% detection 5% False positive – Penta screen- 83% detection 5% False positive  1980’s- CVS  1990’s – – First Trimester screen- 80-85% 5% False positive – Sequential screen 90-94% detection 3-5% FP  2010’s- Non-invasive prenatal diagnosis(placental fetal DNA)
  9. 9. PRESENTATION-0029 vB Prenatal Prevalence of Chromosomal Abnormalities 53% 13% 5% 8% 5% 16% Percent of Reported Chromosome Abnormalities T21 T18 T13 45,X Sex trisomy Other rare 9 Data adapted from Wellesley, D, et al., Rare chromosome abnormalities, prevalence and prenatal diagnosis rates from population-based congenital anomaly registers in Europe. Eur J of Hum Gen, 11 January 2012. Four major fetal trisomies
  10. 10. Screening Tests  Definition – a test applied to an asymptomatic population in order to classify them with respect to their likelihood of having a specific condition  The difference between screening and diagnostic tests: 1. Screening tests give a risk for a condition  MSAFP, Multiple Marker Screen, Ultrasound for Down Syndrome 2. Diagnostic tests give a definitive result as to the presence or absence of a condition  Amniocentesis, Ultrasound for spina bifida
  11. 11. PRESENTATION-0029 vB Reference: ACOG Practice Bulletin, Number 77, Jan 2007 Numerous Options with Variable Performance 11 FASTER Trial Malone et al, NEJM, 2005 Modeled predicted performance Cuckle et al, Semin Perinatol, 2005
  12. 12. PRESENTATION-0029 vB What are the Goals of NIPT? 12 Goals of NIPT Reduce exposure of fetus to risk Reduce false positives Enable a high detection rate Testing that can easily be offered to all pregnant women* *When data supports testing in all patients, instead of only high risk patients.
  13. 13. Technology Behind NIPT
  14. 14. Circulating Cell Free Fetal DNA  1997 article by Lo in Lancet – Lo YM, Corbetta N, Chamberlin PF et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997;350: 485-487.  Based on previous findings of tumor DNA present in patients with cancer  30 pregnant women with male fetuses  Serum and plasma analyzed  70 – 80% detection rate Lo et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997
  15. 15. PRESENTATION-0029 vB Two Sources of Fetal DNA  Cell-free DNA (cfDNA) – 2–20% of total cfDNA is fetal – Requires DNA isolation and counting – Counting method developed by Dr. Stephen Quake, Stanford University  Fetal cells – 1 in a billion of total cell population – Require isolation via mechanical and/or biochemical means 15
  16. 16. Circulating Cell Free (ccff) Fetal  Source of ccff is thought to be from placental cells through breakdown of fetal cells in circulation  Circulating fetal DNA thought to comprise 3 – 6% of all DNA in circulating maternal plasma. Now it’s known to range from 3 – 40%, with an average of about 10%  Detection starting at as early as 5 weeks. Consistently seen at 10 weeks  Little risk of interference of ccf from previous pregnancies  Half-life of ccff is 15 minutes and is undetectable within 2 hours postpartum Ehrich et al. Noninvasive detection of fetal T21 by sequencing of DNA in maternal blood. AJOG 2011
  17. 17. Noninvasive Aneuploidy Detection  Aneuploidy detection is much more challenging – Single nucleotide polymorphisms – DNA methylation (silencing) – Fetal mRNA
  18. 18. Cell-free fetal DNA  2007 Digital PCR – Lo YM, Lun F, Chan KC, et al. Digital PCR for the molecular detection of fetal chromosomal aneuploidy  2008 detection of Trisomy 21 – Chiu RW, Chan KC, Gao Y, et al. Noninvasive prenatal diagnosis of fetal chromosomal aneuploidy by massively parallel genomic sequencing of DNA in maternal plasma. Proc Natl Acad Sci USA 2008;105:20458-20463 – Fan HC, Blumenfeld YJ, Chitkara U, Hudgins L, Quake SR. Noninvasive diagnosis of fetal aneuploidy by shotgun sequencing DNA from maternal blood. Proc Natl Acad Sci USA 2008;105:16266-16271
  19. 19. PRESENTATION-0029 vB Massively Parallel Sequencing (MPS) Method of analysis for verifi® prenatal test 19 Extract and Prepare cfDNA Next-Gen Sequencing1 2
  20. 20.  ~10% of the DNA fragments in a pregnant woman’s blood are from the fetus ( )  ~90% are from the mother ( ) Schematic of DNA Fragments Isolated From Maternal Plasma Containing Maternal DNA and Euploid Fetal DNA Schematic of DNA Fragments Isolated From Maternal Plasma Containing Maternal DNA, Fetal DNA and Extra Fragments of Chromosome 21 Contributed by a Fetal Trisomy 21 Euploid Fetus Fetus with Trisomy 21 Principles of Fetal Trisomy 21 Testing From a Maternal Blood Sample Using DNA Sequencing
  21. 21. GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 Principles of Fetal Trisomy 21 Testing From a Maternal Blood Sample Using DNA Sequencing GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 Sequencing tells you which chromosome the ccf fragment comes from TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y
  22. 22. Principles of Fetal Trisomy 21 Detection Using DNA Sequencing DNA MPS* does not differentiate which fragments come from the mother and which from the fetus. Unaffected Fetus Fetus with Trisomy 21 The quantitative over-representation of Trisomy 21 fragments in an affected pregnancy is significant and can be measured with high precision. * MPS - Massively Parallel Sequencing
  23. 23. “Counting Method” ofNIPT 23 2 ways to sequence using cfDNA Massively Parallel Sequencing Targeted Sequencing 3 ways to analyze Normalized Chromosome Value (NCV) Estimate risk using combination of sequence data and other factors Z-Score
  24. 24. NIPT Laboratories: Shifting Rapidly  Sequenom MaterniT21plus – launched 10/2011  Illumina (formally known as Verinata) – Verifi - launched 3/2012  Skins: Counsyl Laboratory and Illumina.  LabCorp: developed test based on Verinata bioinfomatics – InfomaSeq.  Ariosa Harmony– launched 6/2012 - To be bought by Roche soon.  Natera- data published in 2015.
  25. 25. NIPT Laboratories: Shifting Rapidly  Ariosa will be changing their methodology from a counting method of targeted sequencing to a microarray testing method.  December 2014, it was announced that Illumina and Sequenom will pool intellectual property including patents. Illumina will have exclusive worldwide rights to use IP to develop and sell IVD kits for NIPT. Illumina will pay Sequenom 50 million upfront with additional payments.  Two companies outside of USA: PGI & Berry Genomics.
  26. 26. Technology Natera Verinata Natera SNP technology Massively parallel shotgun sequencing (MPSS) SNP technology Sequenom Verinata Ariosa Massively parallel shotgun sequencing (MPSS) Massively parallel shotgun sequencing (MPSS) Digital analysis of selected regions (DANSR) (soon to change to a microarray method)
  27. 27. Data Slides discussing the original published papers of the primary 4 NIPT companies in the US are included in the end of the lecture slide set.
  28. 28. Natera (SNP)  Technology based on Parental SupportTM – Targeted sequencing approach measuring SNP’s, then incorporates high fidelity parental allelic information and crossover frequency data to model a set of hypothesis(monosomy, disomy and trisomy). Gives maximum likelihood estimation.
  29. 29. Addressing Unmet Needs in Prenatal Testing • Develop a method for non-invasive detection of fetal aneuploidy that: – Can test chromosomes 13,18, 21, X, and Y – Performs equally well across all chromosomes – Produces reliable results at low fetal fractions as early as 9 weeks gestation – Sensitivity and specificity >99% 29
  30. 30. How does Natera NIPT work? Maternal blood Buffy coat = Maternal DNA Plasma = Maternal + Fetal DNA SNP Sequencing SNP Sequencing Maternal Genotype Maternal + Fetal Genotype Target Fetal DNA Signal Fetal Genotype A simplification of Natera’s non-invasive prenatal aneuploidy test 30
  31. 31. NATUS – Next Generation Aneuploidy Testing Using SNPs Data from Human Genome Project (HapMap) High Throughput DNA Measurements on Mom & Dad Noisy WGA Single Cell DNA Measurements SNP targeted sequencing data From Mom (buffy coat) +/- Dad + Data from Human Genome Project (HapMap) NATUS Algorithm + SNP targeted sequencing data from Fetal/Mat DNA mixture (plasma) MLE technique selects hypothesis with the highest confidence Multiple hypotheses for each chromosome Compare each sub-hypotheses to Fetal/Maternal DNA data RESULT: •High Accuracyacross chrom 13, 18, 21, X, Y • Calculated accuracy for each result Sub-hypotheses with different crossover points
  32. 32. Differences Panorama – Distinguishes fetal chromosomes from maternal chromosomes. – Can detect triploidy. –Lags significantly behind others regarding published data. – Very excited and very different technology. – Cannot be used with egg donors. – In other applications, they have experience with single gene disorders (i.e. preimplantation genetic diagnosis). 32
  33. 33. Cost
  34. 34. 2012
  35. 35. PRESENTATION-0029 vB Future Directions for NIPT with MPS  Expanding patient eligibility: – Multiple gestations – General population testing  Expanding menu content: – Other whole chromosome aneuploidy – Mosaic conditions (fetus, placenta, patient) – Sub-chromosomal copy number variations – Single gene disorders MPS has potential for expanded use in prenatal testing 35
  36. 36. Meta Analysis of NIPT (Feb 2015; handout)  37 Relevant studies.  5 had data from the general population (i.e. low risk population).  Most were retrospective (stored samples with known outcomes) or prospective (using high risk pregnancies undergoing invasive testing).  Risks of bias thoroughly discussed. Gil M.M. Ultrasound Obstet Gynecol 2015
  37. 37. Meta Analysis of NIPT (Performance of Screening for Aneuploidies)  Trisomy 21 – Unaffected = 21608; Affected = 1051. – Detection rate = 99%. – False Positive rate = 0.1%. – Heterogeneity between studies was low. Gil M.M. Ultrasound Obstet Gynecol 2015
  38. 38. Meta Analysis of NIPT (Performance of Screening for Aneuploidies)  Trisomy 18 & 13 – Unaffected = 21608  Affected + 18 = 389; +13 = 139. – Detection rates  + 18 = 96%; +13 = 91%. – Combined (13 & 18) False Positive rate = 0.26%. – FPR all 3 trisomies (21, 18 13) = 0.35% (4 fold increase). Gil M.M. Ultrasound Obstet Gynecol 2015
  39. 39. Meta Analysis of NIPT (Performance of Screening for Aneuploidies)  Sex Chromosome aneuploidies – Affected 177 monosomy X + other (56) = 233. – Detection rates 90% & 93% respectively. – Combined FPR = 0.37%. – Failure to provide a result – higher FPR. Gil M.M. Ultrasound Obstet Gynecol 2015
  40. 40. Meta Analysis of NIPT (Performance of Screening for Aneuploidies)  Twin pregnancies – Di/di twins: each fetus can contribute different amounts of cfDNA, as much as 2 fold. The aneuploid fetus may have too low of fetal fraction for detection. Gil M.M. Ultrasound Obstet Gynecol 2015
  41. 41. Meta Analysis of NIPT (Clinical implications)  For singleton pregnancies, NIPT is superior to all other methods.  Limitations for wide spread use: – High Cost. – Failure to provide a result. Gil M.M. Ultrasound Obstet Gynecol 2015
  42. 42. Meta Analysis of NIPT (Clinical implications)  Contingent screening: – Very High detection rate. – Very low invasive testing rate. – Considerably lower cost. – For NIPT with a “no result call”, could rely on biochemical screening to make invasive testing decision. – Still have the first trimester ultrasound with NT. Gil M.M. Ultrasound Obstet Gynecol 2015
  43. 43. Meta Analysis of NIPT (Clinical implications)  Trisomy 18 & 13: – Performance may be worse that Sequential screening. – Detection rates are similar. – However, it may be lower if “No Calls” are considered. – Screening for all three aneuploidies increase the FPR. Gil M.M. Ultrasound Obstet Gynecol 2015
  44. 44. Meta Analysis of NIPT (Clinical implications)  Sex Chromosome aneuploidy: – Questions whether it should be included.  Milder phenotype.  Higher failure rate – no result.  Lower detection rate.  Higher FPR.  Higher fetal mosaicism.  Detection of maternal sex chromosome aneuploidy.  Inclusion with DS screening increase FPR 8 fold to 0.72%. Gil M.M. Ultrasound Obstet Gynecol 2015
  45. 45. Nuchal translucency ultrasound  Correct gestation age  Early diagnosis of fetal malformation  Diagnosis of multifetal gestation and chorionicity  Can see cystic hygroma: 50% aneuploidy – Most are T21 or Monosomy X, – but there are rare, yet significant, other chromosome abnormalities  Screening for low risk populations
  46. 46. Microdeletions / Single Gene Test ? Fetal (Placental) karyotype?  Microdeletions: – Several abstract presentations. – Varies between laboratories. – Difficult to evaluate – because rare. – Likely to raise FPR. – Increased cost with 3 of the 4 labs.  Case reports of achondroplasia & thanatophoric Dwarism.  Rh genotype in fetus.
  47. 47. Low Risk Population NEXT (noninvasive examination of trisomy)  Hypothesis: NIPT better screening tool than biochemical screening. Norton, ME, NEJM 2015
  48. 48. Low Risk Population NEXT (noninvasive examination of trisomy)  Prompted ACOG statement  Prospective, multicentered, blinded study.  35 International centers.  Patients, 10-14 wks gestation, undergoing routine first trimester screening (NT & Biochemical screening).  cfDNA results blinded.  Birth outcome: dx testing or newborn examination. Norton, ME, NEJM 2015
  49. 49. Low Risk Population NEXT (noninvasive examination of trisomy)  18,955 women enrolled.  15,841 results available for analysis.  Mean maternal age: 30.7 yrs.  Compared to standard screening.  Method: targeted sequencing (counting method)  76% less than 35 yrs of age. Norton, ME, NEJM 2015
  50. 50.  NIPT detected 38/38 trisomy 21. – 19 were in the low risk group.  First trimester screening 30/38 (No second trimester test).  FPR 0.06 & 5.4% respectively.  PPV 80.9% vs 3.4%. (4/5 vs 1/30) Norton, ME, NEJM 2015 Low Risk Population NEXT (noninvasive examination of trisomy)
  51. 51.  No results group: – 13 aneuploidies (3 DS, 1 +18, 2 +13, 4 triploidy, 1 +16, 1 del11p, 1 with structurally abnormal chromosome.  Prevalence higher than in the cohort with results: 1/38 (2.7%) vs 1/236 (0.4%).  Among 6 common aneuploidies, each detected with biochemical screening (risk range 1/26-1/2). Norton, ME, NEJM 2015 Low Risk Population NEXT (noninvasive examination of trisomy)
  52. 52.  Higher sensitivity and specificity than biochemical screening.  FPR 100 fold less than std screening.  Regardless of maternal age.  Higher cost. Norton, ME, NEJM 2015 Low Risk Population NEXT (noninvasive examination of trisomy) Conclusions
  53. 53.  3% did not reveal a result. – May be related to increased maternal weight. – May be related to an abnormal karotype. – If these were included, the detection rate would decrease. – No consensus about: repeating NIPT, using biochemical screening or offering diagnostic testing. Norton, ME, NEJM 2015 Low Risk Population NEXT (noninvasive examination of trisomy) Conclusions
  54. 54. Explanations for Discordant Results  Confined placental mosaicism.  Fetal mosaicism.  Vanishing twin.  Maternal Karyotype.  Discordant twin karyotype.  Cancer.
  55. 55. PRESENTATION-0029 vB ACOG Practice Advisory April 2015  Still using 2012 committee opinion.  Positive result requires confirmation with diagnostic test.  “No-call” group is at increased risk of chromosomal abnormality. – Tests that do not return results are typically excluded from companies’ summary statistics leading to an overstatement of the test preformance.
  56. 56. PRESENTATION-0029 vB ACOG Practice Advisory April 2015  Other screening modalities, biochemical and ultrasound, will detect additional important conditions not detected by NIPT.  All of these issues are true in high and low risk populations, but more pronounced in the low risk population (e.g. lower PPV).
  57. 57. PRESENTATION-0029 vB ACOG Committee Opinion on NIPT  “Cell free fetal DNA appears to be the most effective screening test for aneuploidy in high risk women… is one option that can be used as a primary screening test in women at increased risk of aneuploidy”  “[NIPT] should be an informed patient choice after pretest counseling”  “[NIPT] should not be offered to low-risk women or women with multiple gestations”  “A patient with a positive test result should be referred for genetic counseling and should be offered invasive prenatal diagnosis for confirmation of test results.” Also supporting NIPT for high risk pregnancies: 57
  58. 58. Explaining test to Patients Data (Age, Blood) = Modified (Personal) risk assessment 1 _____ X 1 _____ 2 > 1 _____ 10,000 < 1 _____ 200 Seq vs NIPT 5% 1% 90% 99% Positive rate: Detection rate:
  59. 59. Pre-lecture Questions: True or False  NIPT stands for NonInvasive Prenatal test. T  Considering current guidelines, all women should be offered NIPT screening. F  All NIPT techniques preform similarly. T  The primary source of “fetal DNA” is from the fetus. F  The introduction of the NIPT test has reduced the number if invasive tests. T  NIPT is the quickest test to go from publication to use to insurance coverage in the history of medicine. T  The primary purpose of NIPT testing is to determine the gender of the baby. F  A twin demise that appears to have died 4+ weeks earlier, will not interfere with the NIPT analysis. F
  60. 60. Kathryn Murray, MS, CGC
  61. 61. FORTE vs. Z-score Comparison  Provides individualized risk score  Accounts for fetal fraction  Can incorporate other clinical risk factors FORTE Z-Score • Groups all trisomies into one category • Does not factor in fetal fraction FORTETM (Fetal-fraction Optimized Risk of Trisomy Evaluation) – refers to the algorithm that incorporates DANSR assay results (chromosome counts, fetal fraction), and other clinical information to provide a individualized risk score
  62. 62. Normalized chromosomal value vs. Z-score method  NCV – #counts Chr 21/Counts on Custom reference Chr – High precision, removes variation – Maximizes dynamic range  Z-score – # counts Chr 21/# counts all Chr – GC correction – Z-score result – Sample to sample variability – Reduces dynamic range
  63. 63. Risk Calculation  Z-score(Sequenom) – Total maternal and fetal/total reference – Mean chromosomal amount + 3 SD – >3 is positive, <3 is negative  Normalized chromosomal value(Verinata) – Total maternal and fetal/custom reference – >4SD is positive, 2.5-4 is no-call, <2.5 is negative  FORTE(Fetal-fraction optimized risk of Trisomy Evaluation) (Ariosa) – LR = cfDNA of specific chr/total cffDNA – Provides individualized risk score – Maternal age + GA x LR of result – Accounts for fetal fraction
  64. 64. Initial Study Data Sequenom Verinata Ariosa total n= 2,437 651 4097 # of published studies 4 3 4 T21 249 102 205 T18 62 44 113 T13 12 15 - XO ? 19 - 20 - 2013 Publication Clinical experience (>6,000 spls) within expected performance parameters 2013 Poster presentation Clinical experience (>60,000 spls) within expected performance parameters Update
  65. 65. Sensitivity/Specificity - Totals Sequenom Verinata Ariosa T21 detection 249/251 (99.2%) 102/102 (100%) 205/205 (100%) FPR 4/1880 (0.2%) 0/438 3/3547 (0.08%) T18 detection 59/59 (>99.9%) 43/44 (97.7%) 111/113 (98.2%) FPR 5/1688 (0.3%) 0/499 2/3547 (0.05%) T13 detection 11/12 (91.7%) 11/15 (73.3%) - FPR 16/1688 (0.9%) 0/531 - XO detection NA 15/16 (93.8%) NA FPR NA 0/464 NA
  66. 66. MaterniT21plus (Sequenom)  Results: “Positive” vs. “Negative” based on z-score.  1% chance for no result  Determines whether or not a Y chromosome is present.  Will accept samples on twins and IVF/egg donor  Long term potential for genome wide studies
  67. 67. MaterniT21 (Sequenom)
  68. 68. PRESENTATION-0029 vB Verinata Health MELISSA Study • Large-scale, prospective and blinded clinical validation – High-risk patient population – Singleton gestations analyzed – Over 60 U.S. centers enrolled • All samples with any abnormal karyotype analyzed – Emulates real-world testing, fetal karyotype not known beforehand • Samples analyzed for aneuploidy across the genome – Demonstrates the true potential of verifi® test MPS technology MatErnal BLood IS Source to Accurately Diagnose Fetal Aneuploidy 68
  69. 69. PRESENTATION-0029 vB MELISSA Study • 2,882 samples collected • 534 selected for analysis – Including all abnormal karyotypes (N=221) – Gestational age: 10 – 23 weeks – BMI (kg/m2): 17 – 59 – Includes 38 ART pregnancies – Diverse (27.3% non-white) Study Design, Demographics 69
  70. 70. PRESENTATION-0029 vB MELISSA Study MPS Performance 70 Classified Sensitivity (%) 95% CI Specificity (%) 95% CI Chromosome 21 100·0 (89/89) 95·9 - 100·0 100·0 (404/404) 99·1 - 100·0 Chromosome 18 97·2 (35/36) 85·5 - 99·9 100·0 (460/460) 99·2 - 100·0 Chromosome 13 78·6 (11/14) 49·2 - 95.3 100·0 (485/485) 99·2 - 100·0 Monosomy X 93·8 (15/16) 69·8 - 99·8 99·8 (416/417) 98·7 - >99.9 Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012
  71. 71. PRESENTATION-0029 vB Other Abnormal Karyotypes in MELISSA Complex Karyotypes Detection Mosaics (T21, T18) Demonstrated blinded detection (4/4)1 Robertsonian Translocations (T21, T13) Demonstrated blinded detection (3/3)1 Rare autosomal aneuploidies Demonstrated blinded detection (T16, T20)1 Sub-chromosomal Duplication Demonstrated blinded detection (38MB duplication on chromosome 6)2 Demonstrated Detection of Complex Karyotypes 71 1 Bianchi DW, et al. Obstet Gynecol. 2012 Mar;119(5):890-901. 2 Srinivasan et al., ASHG 2012 Abstract. Note: verifi® test does not distinguish between full chromosome, mosaic, or translocation trisomy
  72. 72. PRESENTATION-0029 vB Product Profile 72 Chromosomes Analyzed 21, 18, 13, and (Optional) X and Y Blood draw requirement 1 blood tube (7-10mL) Patient Eligibility Validated in high risk pregnancies Singletons at ≥10 weeks gestation Egg donors accepted Sample collection On-site collection kits, ambient shipping Turn-around time 8 to 10 days Clinical Support In-house genetic counselors for consultation with healthcare providers
  73. 73. PRESENTATION-0029 vB verifi® prenatal test Results  verifi® test uses a unique dual threshold classification system  Borderline results classified as “Aneuploidy Suspected” – Indicates borderline results where false positive is more likely than “detected” results – Occur in approximately 0.2-0.6% of results per chromosome* UPDATE 6/13 They have adjusted their algorithm with more narrow “aneuploidy suspected” range. A Safe and Effective Classification System 73 * Verinata Health, Inc - data on file. Original Publication: Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012
  74. 74. PRESENTATION-0029 vB Dual Threshold Classification Indicates Borderline Results 74 VS. Single Threshold Method verifi® prenatal test Dual Threshold Trisomy Diploid
  75. 75. PRESENTATION-0029 vB verifi® prenatal test • Red alert at top to highlight abnormal results • Abnormal results in table are highlighted in red • Comments included to provide additional guidance • Test claims restated as reference Test Report 75
  76. 76. PRESENTATION-0029 vB Sex Chromosome Aneuploidy (SCA) High incidence • Affects 1 in 300-400 live births • Monosomy X associated with high rate of spontaneous loss • Mosaic forms common Prenatal diagnosis difficult • Not screened by current serum screens • Ultrasound usually normal (except in monosomy X) • Only diagnosed by invasive procedures Detection of SCA has clinical utility • Delivery management when ultrasound abnormalities present • E.G. Monosomy X with cystic hygroma • Early detection may help in early childhood intervention in SCA cases 76
  77. 77. PRESENTATION-0029 vB * False Positive Rate Verinata Health publication “Analytical Validation of the verifi® prenatal test: Enhanced Test Performance for Detecting Trisomies 21, 18, and 13 and the Option for Classification of Sex Chromosome Status”, Data on File. Original Publication: *Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012 Sex Chromosome Option 77 (19/20 ) (243/249 ) (227/229 ) - 98.4% 99.0% AccuracySensitivity 99.1% 97.6% 95.0% XXX, XXY, XYY XY XX Monosomy X 1.0% 0.8% 1.1% FPR * Limited prevalence in clinical data precludes performance calculations verifi® prenatal test Performance
  78. 78. PRESENTATION-0029 vB Fetal Sex Chromosome determination • Both Verinata and Sequenom give results regarding sex chromosomes: • Verinata: with every report. • Sequenom: reports whether Y is present or not and only if they have evidence of SC aneuploidy. • Sequenom Published paper: • 6% not reportable rate. • Lower accuracy than trisomies. • Assumes mom is normal for sex chromosomes. • CG composition of CG of X and Y is similar. • Homology of Y chromosome and other chromosome (i.e. decreased signal noise relationship) • Y chromosome is small and there is wide variation in measured representation.
  79. 79. Harmony (Ariosa)  Prospective, blinded – NICE trial  81/81 T21 1/2888 FP 0.03%  37/38 T18 2/2888 FP 0.07% – 4.5% failure rate – 39% of abnormal karyotypes were other than T21/T18 Norton ME, Brar H, Weiss J, et al. Non- Invasive Chromosomal Evaluation(NICE) Study: results of a multicenter prospective cohort study for detection of fetal trisomy
  80. 80. Harmony (Ariosa)  Up to 4.6% chance for no result  Can’t do on twins or IVF with egg donor at this time  Technology may be limiting in the future  Offering to the general population  Results predict PPV and NPV allowing providers to counsel patients appropriately  Largest published data set  Inclusion of clinical information in risk assessment  Targeted sequencing means decreased cost  Future studies – T13 validation – NITE- 500 subjects. European eval of T21 and T18 – NEXT- 25,000 subjects comparing Harmony to current 1st trimester screening for T21
  81. 81. Harmony (Ariosa)
  82. 82. DANSR vs Massively Parallel Shotgun Sequencing Assay Comparison Chr 18 and 21 cfDNA Other Chr cfDNA Unmapped cfDNA cfDNA in blood DANSR (Directed analysis) MPSS (Random analysis) Same cfDNA fragments from select chromosomes analyzed every time Only relevant cfDNA fragments go onto DNA sequencing 96 patient samples analyzed simultaneously Random cfDNA fragments from all chromosomes analyzed every time All cfDNA fragments go onto DNA sequencing regardless of relevance 4-8 patient samples analyzed simultaneously 82
  83. 83. Previous NIPT Results – Proof of Concept Study 83 •166 Maternal blood samples, 9+ weeks •Confirmed by amnio/CVS or cord blood •145 euploid / 21 aneuploid •Includes T13, T18, T21, 45X, 47XXY • 145 have high confidence at all 5 chrom • >99% average confidence for all high confidence call chromosomes • Nicolaides Paper 2013: • 242 blinded high risk CVS. • 229/242 results. • 32/229 abnormal (+21, +18, +13, -X, triploidy) • No false positive. • No false negatives. 0 5 10 15 20 25 30 35 40 Fetal Fraction All Correctly Called Failed Quality Test Zimmermann et al. Prenat Diag. 2012

×