Molecular biology is the study of biological molecules and their interactions. The central dogma describes the flow of genetic information from DNA to mRNA to protein. DNA contains the genetic code and is made up of nucleotides with a double helix structure. During transcription, RNA polymerase uses one DNA strand as a template to produce mRNA. The mRNA then directs protein synthesis during translation using ribosomes. Techniques like gel electrophoresis and agarose/polyacrylamide gels are used to separate DNA, RNA, and proteins based on size and charge.

1. Molecular Biology-branch of biology that studies the molecular basis of biological activity
There are many kinds of molecules in living organisms,
but molecular biologists focus on nucleic acid (genes)
and proteins
Living organisms composed of various chemicals,
where a molecular biologist examines the interaction
and functions of these molecules with one another
The analysis of structure, function, processing, regulation
and evolution of biological molecules and their interactions
with one another-leads into micro-level insights of life
Proteins perform a huge diversity of functions within
living cells and genes contain the information required
to make more proteins

2. ‘’It states that such information cannot be transferred
back from protein to either protein or nucleic acid”
Francis Crick, 1958
Central Dogma of Molecular Biology
The central dogma of molecular biology deals with the
detailed residue-by-residue transfer of sequential
information
It describes the flow of genetic information
in cells from DNA to messenger RNA
(mRNA) to protein
The genes specify sequence of mRNA
molecules, which in turn specify the
sequence of proteins

3. Genetic information store in form of biological macromolecules, nucleic acids and proteins in a cell
DNA is the universal genetic material except RNA viruses (Riboviruse) e.g. Retroviruse (AIDS)
Retroviruses have both RNA and DNA genome versions during life cycle, where RNA genome
produce some protein products to transform sRNA into dsDNA e.g. reverse transcriptase (RT)
production inside host cell
RT copy viral sRNA into sDNA and then dsDNA using host machinery by producing viral
ds-genome (Provirus)
DNA-double-stranded right-handed helix, the two strands are complementary and antiparallel
Diameter of the helical DNA molecule is 20 A ˚ (2 nm)
The helical form produces the alternate major and minor grooves
Genetic Material-DNA/RNA
The rod–ribbon model of double-helical DNA

4. Nucleic Acids-Hereditary material
Mendel-Factors-Polymer of Nucleotides
Fred Griffith (1928)-Dipplococcus pneumonia
-virulent (S) and avirulent (R)
He postulated that there was
a transforming factor/material
Genetic Material-History

5. Avery, McCarthy and MacLeod (1943) working on Dipplococcus pneumonia
They showed Non-virulent rough (R)
Pneumococcus could be converted into
smooth (S) virulent by mixing heat killed (S)
DNA with live (R)
These fractions were treated with RNAse (no
effect), protease (no effect) and finally DNAse
(No transforming activity)
This time they skipped mouse from their
experiment as it takes long time and expensive
to culture and get the results
They cultured both Smooth (S) and Rough (R)
Dipplococcus pneumonia on petri dishes and
extract various fractions

6. Hershey Chase blender experiment-1952
T2 Bacteriophage can live as parasite on
Bacterial cell (E. Coli)
In case of radioactively labeled DNA
(32P), DNA pellet has radioactivity, while
the Protein coat has no radioactivity
Radioactive label phage DNA (32P) and
Protein (35S)
During infection which part of Virus
enter into Bacterial cell as it has a Protein
coat and Nucleic acid
In case of Radioactive protein (35S), there
was no traces in Protein pellet, but
Suspension has Radioactivity
The offspring of the bacteriophages also
possessed phosphorous-tagged DNA, while
protein lack any trace of radioactivity.

7. The information present in genetic material (DNA/RNA), regulate
cellular and biochemical functions of an organism
Structure-DNA/RNA
The genetic material is a long double stranded DNA polymer and
the sequence of one strand is complementary to the other strand
The complementarity enables new DNA molecules to be
synthesized with the same linear order of deoxyribonucleotides in
each strand as an original DNA molecule during replication
DNA (deoxyribonucleotides) has structural units-nucleotides-which is
composed of a pentose sugar, four nitrogenous bases (A,G,C,T) and Phosphate

8. Nucleoside (Pentose Sugar+NB)
Nucleotide (nucleoside+phosphate)
Structure-DNA/RNA
The deoxyribonucleotide triphosphate (α, β, γ), where the α
phosphate form the phosphodiester linkage and the β and γ
phosphate groups are released as a unit (pyrophosphate)

9. Purines
The Purines (N-9) has covalent bond with pentose
sugar (sugar-N-ß-glycosyl bond)
Adenine, Guanine (DNA, RNA)
Structure-DNA/RNA

10. Thymine (DNA)
Pyrimidines
Cytosine (DNA, RNA) Uracil (RNA)
The pyrimidines(N-1) bond with pentose sugar (5-
C), through covalent bond (sugar-N-ß-glycosyl bond)
Structure-DNA/RNA

11. Conformation of NB can be syn or anti (Favored)
Structure-DNA/RNA

12. Pentoses (5-C)-2 Types
DNA has 2’-deoxy-D-ribose
RNA possesses D-ribose
Pentoses exist in ß-furanose forms
Structure-DNA/RNA

13. The phosphodiester linkages in DNA/RNA have the linear orientation
in nucleic acid and specific polarity i.e. 5’ and 3’
The successive nucleotides in DNA/RNA are covalently
linked-Phosphodiester linkage-where 5’-phosphate of one
nucleotide unit is joined to the 3’-hydroxyl group of the next
The backbones of nucleic acids consist of alternating
phosphate and pentose residues
Backbones of both DNA and RNA are hydrophilic (OH of sugar
residues form H-bonds with water
The P-groups are completely ionized and negatively charged at pH
7 and that why DNA/RNA is -ve
Structure-DNA/RNA

14. In DNA replication-the incoming nucleotide is directed by
DNA polymerase with complementary base of the
template strand
Replication-DNA Synthesis (DNA Polymerase)
The α phosphate of the incoming nucleotide
forms a phosphodiester bond with the 3′
hydroxyl group of the growing strand and
then the next new incoming nucleotide,
which is complementary to the template
strand is positioned by DNA polymerase

15. Arrow indicates the direction of RNA synthesis
Transcription-mRNA Synthesis(RNA Polymerase-II)
Secondary structure of an RNA molecule, where lines
represent hydrogen bonding between complementary
base pairs (The ribose–phosphate backbone not shown)
DNA strand (3’-5’) transcribed into m RNA (5’-3’)
termed as Template/Anti-sense/Non-coding/Minus strand
The 2nd DNA strand-Sense/coding/Plus
strand (same sequence as m RNA with
T replaced by U and Deoxy-ribose
Pentose-C by Ribose)
5-PPP-GUUACUACGUUACGAUGCG-OH-3

16. The primary transcript(Pre-m RNA) is polyadenylated at
the 3′ end and capped with a modified guanine (G)
nucleotide at the 5′ end before Translation
Schematic representation of a prokaryotic structural
gene, Transcription and Translation
Transcription-Prokaryotes and Eukaryotes
The prokaryotic structural gene is transcribed
into mRNA and then directly into protein
The promoter region (p), the site of initiation and
direction of transcription (arrow), and the termination
sequence for RNA polymerase (t/Stop Codon) shown
Schematic representation of a eukaryotic structural gene
The promoter region (p), the site of initiation and direction
of transcription (arrow), and the termination sequence for
RNA polymerase (t/Stop Codon) shown
The numbers 1 to 5 represent exons of the structural gene,
and the letters a to d mark the introns

17. Ribosomes or palade particles-isolated
by A.Claude (1943) from cell cytoplasm
and the term was used by G.Palade
(1955)-synthesis in Nucleolus
Found in both prokaryotes & eukaryotes
(also Mitochondria & Plastids)
Types based on sedimentation coefficient-
(1) 70S Ribosomes (Prokaryotes)
(2) 80S Ribosomes (Eukaryotes)
Svedberg (S) is the rate of sedimentation in centrifugation
Ribosomes-Nucleo-Protein particles-Protein factories

18. A method by which charged molecules in solution (chiefly proteins and nucleic acids) migrate in
response to an electrical field
Rate of migration, depends on the strength of the field, net charge, size, and shape of the molecules, and
also on the ionic strength, viscosity, and temperature of the medium in which the molecules are moving
It can be used analytically to study the properties of a single charged species or mixtures of molecules
Electrophoresis is usually done with gels formed in tubes, slabs, or on a flat bed
The gel is placed in between two buffer chambers or one buffer containing separate electrodes and
the electrical current flows through the gel
Gel Electrophoresis-Separating Technique

19. In most electrophoresis units, the gel is mounted between two buffer chambers containing separate
electrodes so that the only electrical connection between the two chambers is through the gel
Tube Gel Units
Slab Gel Units
Flat Bed Unit

20. This characteristic restrictive pore size, can be used for separation of various molecular sizes of proteins/DNA/RNA
Agarose and Polyacrylamide
The agarose and polyacrylamide have different physical and chemical structures but both make porous gels
The porous gel acts as a sieve by retarding or, in some cases, by completely obstructing the movement of
macromolecules while allowing smaller molecules to migrate freely
Agarose gel has large pores-(macromolecules-nucleic acids, large proteins and protein complexes), while
Polyacrylamide has small pore-(most proteins and small oligonucleotides)
Both are relatively electrically neutral

21. Agarose-Polysaccharide (Agar)
The concentration of agarose is referred to as a percentage of agarose to volume of buffer (w/v) and
normally the gel are in the range of 0.2% to 4% (Smith, 1993)
The migration and separation of various fragments of nucleic acids across the agarose gel depends
on concentration of gel, buffer and voltage
The agarose gel can be prepared according to the nucleic acid fragment sizes
For example 1 % agarose gel can be prepared by taking 1 gm agarose per 100 ml 1 Tris-acetate buffer
(TAE) supplemented with 2 µl/100 ml ethidium bromide
1.5% Agarose gel=1.5gm agarose/100ml 1TAE buffer, 2% Agarose gel=2 gm agarose/100ml 1TAE
buffer, 3 % Agarose gel= 3 gm agarose/100ml 1TAE buffer and so on)

22. % Agarose Gel DNA fragment size (bp)
0.2 5000-40000
0.4 5000-30000
0.6 3000-10000
0.8 1000-7000
1 500-5000
1.5 300-3000
2 200-1500
3 100-1000
% of agarose gel and resolution of linear DNA molecules fragments sizes (Magdeldin 2012)
Agarose vs Size of Nucleic acid (DNA/RNA)

23. Agarose-Gel preparation
The specific amounts of agarose and 1TAE buffer can be taken in a clean autoclave bottle
The bottle need to be kept in microwave for 10-15 min at power-4 till complete dissolution of agarose (cap-loose)
Then bottle need to be kept in 65 ◦C incubator for sometime to lower temp
2 µl of ethidium bromide (fluorescent tag) would be added per 100ml 1TAE buffer inside the fume hood
The bottle would be labelled and stored in 65 ◦C incubator for future application

24. The gel would be kept inside UVP transilluminator in order to visualise different DNA fragments by comparing
with a standard DNA ladder
Loading of sample on Agarose Gel
The DNA samples would be mixed with 1x gel loading dye (tracking dyes) (10x Gel loading buffer: Orange G
0.5 % (w/v)
2-4 µl samples of DNA wold be loaded into the gel wells inside electrophoresis tank (partially filled with 1TAE buffer)
A specific DNA ladder (marker) need to be loaded into one well of the gel at left side according to the expected
fragments sizes
The electric cables would be connected with electrophoretic tank after loading of DNA samples (specific voltage)
in order to separate the fragments (30 min)

25. 1 2 3 4 5 6 7 8 9
2-Log DNA Ladder
3000
1000
500
MAPKKK19 (LP+RP=1079) To confirm presence of DNA
50-log DNA Ladder
1350
916
500

26. Polyacrylamide-Gel Electrophoresis or SDS-Polyacrylamide
Gel Electrophoresis (SDS-PAGE)
This is useful for protein purification and to determine relative molecular mass
The SDS-PAGE is mostly used for qualitative analysis of protein mixtures based on their sizes
SDS-Sodium dodecyl sulfate (NaC12H25SO4 or CH3(CH2)11SO4Na) is an anionic detergent (negatively
charged substance )-which denatures protein, becomes rod-shaped and gives uniform –ve charge
The β-mercaptoethanol-reduces any disulphide bridge
The protein samples to be run on SDS-PAGE are boiled for 5 min in sample buffer containing
β-mercaptoethanol and SDS

27. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

28. The smaller proteins move easily while large proteins face
more friction across the gel due to sieving effect
All of the ionic samples have to migrate under influence of electric current on separating gel
The current is turned off once the bromoethanol blue dye
reaches bottom and the gel is removed and shaken in an
appropriate stain solution (usually coomassie brilliant
blue-triphenylmethane used to stain protein)
Then washed gel in destain solution (Mix H2O,
methanol, and acetic acid 50:40:10 (v/v/v)-to remove
unbound background dye from gel, leaving proteins
visible as blue band stained
SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

29. DNA/RNA Sequencing Methods
Maxam/Gilbert chemical sequencing
Sanger chain termination sequencing
Pyrosequencing-measuring chain extension by pyrophosphate monitoring
Array sequencing
DNA is inserted into a vector and then individually sequenced
and assembled electronically and Shotgun sequencing
Large-scale sequencing requires DNA to be broken into fragments
through Cutting (with enzymes)/Shearing (with mechanical forces)

30. Maxam/Gilbert chemical cleavage method-A.M.Maxam and W. Gilbert (1970)-to sequence a fragments
500 bp, where a DNA is labelled and then chemically cleaved in a sequence-dependent manner as this
method is tedious
In this method four samples of an end-labeled DNA restriction fragment are chemically cleaved at
different specific nucleotides
The resulting sub-fragments are separated by gel electrophoresis and labeled fragments are detected by
autoradiography
5
5
3
3
5
5
3
3
0
0
Label Ends
Cut with Restriction Enzyme Discard
Denature, only end-labeled strand visible
Expose 4-samples to
different chemical reactions
Maxam-Gilbert Sequencing

31. DMS
G
G
G
G
FA
G
A
G
G
A
G
A
A
H
C
T
T
C
T
C
C
T
H+S
C
C
C
C
Maxam-Gilbert Sequencing
DMS-Dimethyl Sulphate-makes the chain
susceptible to cleavage by Piperidine, which
breaks DNA strand at sites of damaged bases
(alkali-labile lesions)
Formic Acid (FA)-Cleavage of Sugar
Phosphate backbone using Piperidine
The Pyrimidines (C+T) are hydrolyzed using Hydrazines
(H), while the addition of salt (Sodium Chloride(S) to the
hydrazine reaction inhibits the reaction of thymine for the C
The Purines (A+G) are depurinated using Formic
acid (FA), where Guanine (some Adenines) are
methylated by DMS and Piperidine cleaved DNAs at
modified position

32. Sequencing gels are read from bottom to top (5′ to 3′).
G G+A T+C C
3′
A
A
A
G
T
C
G
A
T
A
G
C
T
A
G
G
5′
Longer fragments
Shortest fragments
G
A
Gel Electrophoresis

33. These nucleotides are incorporated into a growing daughter DNA chain, while
block further elongation because they lack a 3'-hydroxyl group, which is necessary
for formation of phosphodiester linkage
Chain Termination Method Or Dideoxy Method or
Enzymatic Method (Sanger-1977)
The basic approach involves 1) enzymatic synthesis of a set of specifically labeled (32P-deoxynucleoside
triphosphates) daughter strands from the molecule being sequenced (template) that differ by one nucleotide
in length, and 2) separation of the fragments by electrophoresis
The sequence then is read from the positions of consecutive fragments on the gel
Termination at each base is accomplished using dideoxyribonucleoside triphosphates
(ddNTPs)

34. Small amount of ddGTP + excess dGTP partially terminates
chains at Cs (Complementary of G) in the template (Blue)
Chain Termination occurs due to absence of 3′-OH group in
ddNTPs (phosphodiester bond)
Chain Termination Method (Sanger)
Reaction mixture: Many copies of DNA fragment cloned in a vector (Template to be sequenced), DNA Polymerase
I, d NTPs-100 µM (d ATP, d GTP, d CTP, d TTP), dd NTPs- 1 µM (dd ATP, dd GTP, dd CTP, dd TTP), 5-end
radioactively labeled Primer (M13) and buffers
Illustration of a new (daughter) strand synthesis
using dd GTP by Chain-termination method
To prevent all chains from termination at the first G position,
ddGTP is added at ~1/100th the amount of dGTP

35. In order to achieve termination at each type of base, four
separate reactions can be run in parallel using sequencing
template (Blue) inserted in a vector-500-1000 bases
Chain Termination Method
Fluorescent dyes are multicyclic molecules that absorb and emit
fluorescent light at specific wavelengths e.g. fluorescein and
rhodamine derivatives
Each reaction mixture is supplied with one of the four ddNTPs-
(dd ATP, dd GTP, dd CTP, dd TTP)-each labelled with a tag that
fluoresces a different colour
Separating the mixture products by size reveals the sequence
Sequencing gels are read from bottom to top (5′ to 3′)
3′
G
G
T
A
A
A
T
C
A
T
G
5′

36. Chain Termination Method
A mixture of DNA fragment cloned in a vector, DNA
Polymerase I, d NTPs-100 µM, dd NTPs- 1 µM, 5-
end radioactively labeled Primer (M13) and buffers
The mixture is divided into four equal fractions,
supplemented with specific dd NTPs
First the DNA is denatured (single strand-at 98 °C) and then DNA
synthesis (60-74 °C) in each tube and DNA termination takes place
whenever a dd NTPs (*) is incorporated into the new strand
There are various fragments ending with known specific dd NTPs
The DNA is denatured and the single
stranded DNA fragments are
separated using Gel-Electrophoresis
Sequence of new strand is read from
bottom (5-Prime) to top (3-Prime)
i.e. 5-TCCATGGACCAGAGA-3

37. The DNA is denatured as a single strand
A mixture of four normal (deoxy) nucleotides (dGTP, dATP, dTTP, dCTP)
A mixture of four dideoxynucleotides (each present in limiting
amounts) each labelled with a tag that fluoresces a different colour-
(ddGTP, ddATP, ddTTP, ddCTP)
DNA polymerase-I and suitable buffers
Automating Sanger Sequencing

38. Automating DNA Sequencing
The detection systems relies on laser-induced
fluorescence (helium-neon laser; 633 nm).
These systems employ fluorescent dyes
attached either to the primer or the
ddNTP
The DNA fragments produced by
sequencing reactions are run through
polyacrylamide gels or capillary
electrophoresis
Results can be monitored in real-time on the computer screen
and subsequently subjected to graphically interactive analysis

39. Pal Nyren (20 years after Sanger’s dideoxy sequencing) introduced the pyrosequencing technique, where four
enzymatic reactions taking place in a single tube to monitor DNA synthesis.
Pyrosequencing Technique
This is popularly known as next-generation sequencing or next-gen sequencing (NGS) technology and is used as large-
scale commercialization sequencing technology
Pyrosequencing is based on DNA synthesis principle, where DNA polymerase synthesis the DNA chain
The addition of each nucleotide to the chain release a pyrophosphate group (PPi)
Each released pyrophosphate triggers a series of reactions that generates a detectable quantum of light and
recorded by a detector system in the form of a peak signal, which is proportional to the amount of DNA and
number of incorporated nucleotides.
Hypothetical Pyrogram showing sequence, where the peak
height series of reactions that generates a detectable quantum
of light (enables real-time detection of the sequence of a gene).
A hypothetical pyrogram showing the sequence determination.
The peak height is proportional to the number of adjacent
bases. There are four “G”s, two “A”s and two “T”s in this
sequence. No peak was found at C in the middle and at A at the
far right. The sequence for this window is ATGGGGGAATGTT

40. The deoxyribonucleotide triphosphate (α, β, γ), where the α phosphate form the
phosphodiester linkage and the β and γ phosphate groups are released as a unit
(pyrophosphate-PPi)
Pyrosequencing Technique-Pyrophosphate
The α phosphate of the incoming nucleotide forms a phosphodiester bond with
the 3′ hydroxyl group of the growing strand and then the next new incoming
nucleotide, which is complementary to the template strand is positioned by DNA
polymerase
Pyrosequencing is catalyzed by four kinetically
well-balanced enzymes:
1-DNA polymerase
2-ATP Sulfurylase
3-Firefly Luciferase
4-Apyrase

41. Pyrosequencing Technique-Pyrophosphate
Release of PPi triggers the ATP Sulfurylase reaction
resulting in a quantitative conversion of PPi to ATP
Each nucleotide incorporation event is accompanied by
release of inorganic pyrophosphate (PPi) in a quantity
equimolar to the number of incorporated nucleotides
Nucleotides, including unreacted dNTP and the generated
ATP are degraded by Apyrase by releasing dNTP to the
solution repeatedly for next reaction as a substrate
ATP is readily sensed by firefly luciferase producing light,
which is proportional to the amount of DNA and number of
incorporated nucleotides.

42. Proteins regulate activities and properties of each cell, while those Proteins are regulated by the
amount of corresponding m RNA translation
Those m RNAs in turn are regulated by the Gene (DNA) transcribed and it rate of transcription
Therefore differential transcription of various Genes determine actions and properties of Cells
The whole process in which encoded information of a particular Gene is decoded into a Protein
Gene Expression and its Control
The most critical and limiting factor in gene expression and its control on cell activities depends on
transcription and its rate
Each cell in an organism contains all the genetic material for growth and development, while some
genes will be expressed all the time and others only at specific time in the life span (switched on/off )

43. In Prokaryotes-Ribosomes and others Translation-initiation factors have
immediate access to newly formed Transcript (Pre-m RNA-act as m
RNA without further modification or processing)
While in Eukaryotes, the newly formed Transcript (Pre-m RNA-
being modified before it acts as m RNA-Capping at 5-end (7-
Methyl-GTP) and Polyadenylation at 3-end/Splicing-removing of
Introns and rejoining of Exons) before transport into Cytoplasm for
Translation
Gene Expression and its Control

44. Operon–A grouped of genes that are
transcribed together–code for
functionally similar proteins
Bacterial Gene Control-The Jacob-Monod Model
Francois Jacob, Jacques Monod and colleagues in 1960s-performed some Genetic and Biochemical
experiments on E.coli
This work led to the discovery that Bacterial Genome has a) Protein-binding regulatory Sequences b) Some
Proteins, whose binding to those regulatory sequences either Activate or Repress it Transcription
The E.coli either use Glucose or other sugars (Lactose) as source of carbon and energy
In presence of Glucose containing medium, the enzymes for Lactose metabolism were very low
While in presence of Lactose-containing medium (but no Glucose), the enzymes for Lactose metabolism
increases
This increase in production of Lactose-enzymes termed as Induction
The production of Lactose-enzymes are
encoded by lac operon-which has these
Gene-lacA, lacZ and lac-Y

45. The clusters of genes, which are transcribed into
one mRNA (Polygennic m RNA or Polycystron
transcript) i.e more than one genes for a
particular metabolic pathways are coordinately
regulated by a common promoter and these genes
are arranged followed by each other
The lac-Y encode Lactose Permease (Pump lactose
into cell), lacZ-ß-galactosidase (Split lactose into
Glucose and Galactose), lacA-thiogalactoside
transacetylas (role in cell detoxification) and lacI-
Repressor protein
Bacterial Gene Control-The Jacob-Monod Model
All of the three enzymes synthesis encoded by lac-
operon, are rapidly induced if E.coli are placed in
Lactose-medium and Repressed if switch from
Lactose to Glucose
The operon (group of genes transcribed at the same time) and usually control an important
biochemical process and mostly found in Prokaryotes

46. When Lactose is absent, E. coli does not produce β-galactosidase
Bacterial Gene Control-The Jacob-Monod Model
PROG-Promoter/Repressor/Operator/Gene
The repressor protein blocks
the Promoter site where the
RNA polymerase settles
before it starts transcription
A repressor protein is continuously formed and binds with DNA sequence
termed, Operator (On/Off switch) located just in front of the lac operon
Regulator
gene lac operon
Operator
site
z y a
DNA
I
O
Repressor
protein
RNA
polymerase
Blocked

47. z y a
DNA
I O
Promotor site
z y a
DNA
I O
When Lactose is present
A small amount of a sugar Allolactose
(Like Lactose) is formed within the
Bacterial cell, which binds with repressor
protein at another active site (allosteric
site)
This causes the repressor protein to
change its shape (a conformational
change) and dissociate from
operator site and RNA polymerase
can transcribe Genes into m RNA

48. When both glucose and lactose are present
This explains how the lac operon is transcribed only when lactose is present but does not explain why the operon is
not transcribed when both glucose and lactose are present
Promotor site
z y a
DNA
I O
Repressor protein
removed
RNA polymerase
In case both are present, then RNA polymerase can bind with the promoter site but it is unstable and it
keeps falling off

49. Lac operon-positive regulation
E. coli uses Glucose directly without induction of new enzymes
This shows that Lac operon is active only, when the activator CAP+cAMP is
attached to promotor, otherwise Repressor will bind with operator
Low levels of Glucose activate an unusual nucleotide named, cyclic
AMP (cAMP from ATP by adenylyl cyclase)
Increase in cAMP means an Alert signal, which shows low level of glucose
The cAMP then binds to the catabolite activator protein (CAP) and
stimulates its binding to regulatory sequences of various operons
concerned with the metabolism of alternative sugars, such as Lactose
CAP interacts with the α subunit of RNA polymerase to activate transcription
In positive regulation, the Activator binding
switch on Gene, while in absence Gene switch off

50. Lac operon-negative regulation
The regulatory gene (lac-I) produces repressor
continuously, which binds to the Operator and
block transcription by RNA Pol
In case the cell has high concentration of Glucose, then
Repressor remains attached with Operator and no
transcription takes place
Lactose induces expression of the operon by binding to the
repressor, which prevents the repressor from binding to the
operator
In Negative regulation, the Repressor binding
switch off Gene, while in absence Gene switch on

51. Tryptophan operon
In absence of Trp, the operon is
active always and synthesis takes
place
While, high concentration of Trp, inhibit
Trp Operon and then transcription process

52. Eukaryotes vs Prokaryotes Genome
Transcription and translation are not coupled (Prokaryotes) and separated in time and space
Each structural gene has its own promoter and transcribed
separately, while Prokaryotes have Operon-means that many
Genes are transcribed by a Common Promoter (e.g. Lac-Operon)
DNA must unwind from the histone proteins before transcription, while Prokaryotes don’t have Histones
Activators (Enhancers/Insulator) are more common in Eukaryotes
Both have some common features of Genome and it regulation, while they differ in many ways
Prokaryotes have single Chromosome with Circular (DNA), while Eukaryotes have various shaped
Chromosomes and DNA is linear
Prokaryotes have extra-Chromosomal DNA (Plasmids), while most Eukaryotes have no Plasmids but
possess extra-chromosomal DNA (Mito/Chloroplast)

53. Eukaryotes vs Prokaryotes Genome
Pro and Euk have different
a) Amount of DNA
b) Number of Genes
c) Genes per Million bases
Genes per Million bases-Most of base sequences are
functional/coding (Exon) in Prokaryotes, therefore
they have less non-coding sequences (Intron)
While Eukaryotes have more non-coding/non-
functional sequences (Intron) along with Exons and
that why have less Genes per million bases

54. The control of gene expression can occur at any step in the pathway
from gene to functional protein:
1-Packaging/unpackaging DNA
2-Transcription
3-mRNA processing
4-mRNA transport
5-Translation
6-Protein processing
7-Protein degradation
Eukaryotic Genes control at different Levels
Why Bacteria or other organisms regulate Genes expression
Energy Savings
Response to Environment
Cell differentiation in Development

55. 1-DNA Packing
How Eukaryotes fit a very long and huge amount of DNA
into small nucleus
DNA double helix to condensed chromosome
Various levels of organizations:
Double helix
Nucleosomes
Chromatin fiber
Looped domains
Chromosome
That is through DNA coiling & folding

56. Nucleosomes
Beads on a string-1st level of DNA packing
Histone proteins-8 protein molecules,
positively charged amino acids and
bind tightly to negatively charged DNA
DAPI-(4′,6-Diamidine-2′-
phenylindole dihydrochloride)
Histone as a Marker in
Molecular and Cell Biology
MGH3:H2B-GFP

57. Heterochromatin-darker DNA (H) = tightly packed
DNA packing as gene control
Euchromatin-lighter DNA (E) = loosely packed
Degree of packing of DNA regulates transcription
The tightly wrapped DNA
around histones means no
transcription (genes switch off),
while unpacked region of DNA
more accessible (switch on)
Histone modification:
Methylation of histone causes Gene silencing, while
acetylation alters chromatin structure and permits some
transcription factors to bind to DNA

58. Chromatin remodeling: Acetylation of
histones enhances access to promoter
region and facilitates transcription
DNA packing as gene control

59. DNA methylation and Transcriptional Control
Methylation (CH3) occurs most often in symmetrical CG
sequences, while transcriptionally active genes possess
significantly lower levels of methylated DNA than inactive
genes
Some gene methylation is essential for development, while
sometimes is lethal-Methylation of H19 inactivates transcription
(involved in expression of insulin like growth factor)
Methylation of DNA blocks transcription-(genes turned off)-most often Cytosine is Methylated

60. DNA methylation and Transcriptional Control
DNA Methyltransferase recognizes partially methylated sequences and adds CH3 to the complementary
strand during DNA Replication
While the un-methylated sequences will express and work as housekeeping genes

61. Acetylation and Transcriptional Control

62. Transcription and translation overlap in prokaryotes
Prokaryotes Eukaryotes
transcription
translation
DNA
RNA
Protein
DNA
RNA
Protein
Transcription-DNA  RNA

63. RNA is synthesized as a complementary strand using DNA-dependent RNA polymerases
Transcription-DNA  RNA
The Bacterial cells have one type of RNA polymerase
Eukaryotic cells have three major types of RNA polymerase-RNA polymerase-I (r RNA),
RNA polymerase-II (m RNA) and RNA polymerase-III (t RNA)
One of the DNA strand (Template-3’  5’ ) is transcribed, with
RNA polymerase using ribonucleotide triphosphates (NTPs) to
form an RNA strand (5’3’)
Transcription has three stages: Initiation, Elongation, Termination

64. Expression at different developmental stages based on Microarray analysis
Name
AG1 Agronomics(2010) ATH(2010) ATH1 ATH1
UNM BCP TCP MPG UNM BCP TCP MPG
SPC MPG4
MBD10 AT1G15340 53.7 45.4 11.5 14.7 125.2 102.2 12.5 11.3 120.43 125.35
MAC5C AT5G07060 127.7 91.4 10.2 10.6 129.0 112.2 9.8 7.6 160.86 127.16
HTA13 AT3G20670 257.8 478.6 28.2 102.7 247.7 442.3 27.6 160.1 569.3 555.08
SDS AT1G14750 24.7 19.1 14.1 17.6 34.2 24.2 9.2 17.1 130 95.43

65. This requires a promoter (site where
RNA polymerase binds to DNA) and is
upstream of ATG (start codon and CDS)
Transcription-DNA  RNA
Transcription factors, may be activators or repressors bind to Enhancer or Silencer
sequences of DNA respectively and coordinate control of genes, rather than operons
Upstream-5’
3’
Promoter Transcribed DNA sense strand
mRNA transcript
5’
Downstream-3’
Initiation
Promoters has upstream some regulatory sequences known as Enhancer, Silencer, TATA Box, CAAT Box, GC Box
The position of these regulatory sequences does not affect rate of Transcription

66. Some of the regulatory sequences of DNA (Enhancer)
interact with transcription regulation factors/proteins
(Activators) and up regulate Transcription
The proteins which mediate RNA Poly are known as
Transcription Factors (TF)
The association of Activators with Enhancer promote binding
of TF with Promoter
Transcription-DNA  RNA
Elongation:
The Transcription Factors (TF) mediate binding of RNA Poly,
which read Template strand (DNA 3’-5’) from ATG till stop Codon
Termination:
The RNA Ploy stop reading of DNA Template strand on
approach of Stop Codon (TGA/TAA/TAG) and Pre-m RNA
5’-3’) is released

67. Pre-Transcriptional mRNA control
The binding of Repressor with
Silencer will make an obstacle for
RNA Poly to bind and hence no
Transcription and m RNA synthesis
This may be a) binding of Repressor
with DNA Promoter sequences,
which block RNA Poly to bind and
hence no Transcription and m RNA
synthesis
b) Binding of Repressor with DNA
regulatory sequences and Activators
unable to bind and block Transcription

68. During embryonic development, random division of various
determinants/factors (activators) into cells determine differential
genes expression and specify cell to perform various functions
Specialized cells induce neighboring cells to differentiate in
the same way
Differential Transcription Control
This means that each cell has the same Genome but different
amount of cytoplasm contents

69. Three major modifications of Pre-m RNA take place during export into Cytoplasm from Nucleus
Two of them are:
a) Capping of 5’ of Pre-m RNA
b) Polyadenylation of 3’
Third one is Pre-m RNA splicing
Removing of Intron from Exon
Rejoing of Exon into function m RNA
Post-Transcriptional modification of Pre-m RNA

70. Methylation occurs after 20-40 nucleotides have been transcribed
7-Methylguanosin triphosphate (G-Nucleotide) binds to the 5’
carbon of first nucleotide of Pre-m RNA
A series of repeated Adenine (A) nucleotides (150-250) binds to the 3’ of Pre-m RNA
5’-Cap-modification
3’-PolyA Tail
5’ of Pre-m RNA assocites with 5’- of Methylguanosin triphosphate
The first two nucleotides of Pre-m RNA are also Methylated at 2’
5’
3’
Post-Transcriptional modification of Pre-m RNA

71. Significance of Post-Transcriptional modification of Pre-m RNA
Increase stability by protecting both ends from enzymatic (nucleases) degradation
Help in transfer from nucleus into cytoplasm
Drive the process of Translation as the 5’-cap is used as recognition site
An intact RNA having 5 & 3-UTRs and Exons is critical
for translation
These various RNA modifications take place inside Nucleus
(Eukaryotes) before export into Cytoplasm-two different
conditions or environments i.e. Nucleoplasm and
Cytoplasm-as both having different chemical compositions
Help in transcription termination

72. Modified/Processed Pre-m RNA
5’-Cap (7-m-G)
5’-UTR (Untraslated Region)-Non-Coding Sequence
Exones-Coding Sequences
3’-UTR (Untraslated Region)-Non-Coding Sequence
Poly-A Tail-3’
Structure of a typical processed Pre-m RNA
UTR (Untranslated Region)-are
involved in regulating m RNA
Translation

73. Modified/Processed Pre-m RNA

74. 3rd modification of Pre-m RNA-splicing-Removing of
Introns (Intervening Regions-Non-Coding Region)
and Re-joining of Exon-(Expressed Regions-Coding
Region)
Splicing
Most of the Introns (Non-Coding Regions of
DNA) are spliced by Spliceosome from Pre-m
RNA (AT3G60500-this Gene has many Introns)
While not all Exons are included in final m RNA
Pre-m RNA or Primary m RNA can undergo
Alternative Splicing i.e. selective Inclusion or
Exclusion of Exons
That why one Pre-m RNA can make many
different m RNA (different Proteins)
A B
5’ 3’
5’ B C 3’
5’ A B C 3’
Some Genes have no Introns and only one exon
(AT3G60490)
B
A C
5’ 3’
Pre-m RNA
5’ A C 3’

75. Splicing

76. Splicing Sites

77. Splicing Mechanism
Splice Donor
Splice Acceptor
Lariat/Loop Intermediate
At 3’, 2-OH group at Splice Acceptor (A) of Intron
associates with Phosphorus (5’) at Splice Donor and
forms an Intermediate Loop/Lariat and Exon is released
The 3’ OH of free Exon interact with Phosphate group of
Intermediate Loop/Lariat at Splice Site and release it.
Exons are ligated

78. Group-I-Intron Splicing is by Self-Splicing-which
does not need Spliceosomes to remove Introns and
re-join Exons
A free Guanosine acts as a co-factor and its 3-
Prime can associate with 5-Prime of Intron (Red
arrows) through Transesterification.
Transesterification reaction (Hydrolysis of ester linkage
between Intron and Exon, while Condensation reaction
between Co-factor (G) and free Intron. The release of
ATP during hydrolysis is used in condensation reaction.
Splicing-Group-I Intron Splicing

79. The junctions between Intron and Exon play
an important role during Splicing
The 5-Prime of Intron always has conserved
sequence of GU nucleotide, while 3-Prime
has AG and also has A (Branch Point-15-45
nucleotides Upstream of 3-Prime) in the
middle
The cellular machinery which involves in
splicing known as Spliceosome, which
recognizes the conserved sequences of Intron
at Splice junctions
Spliceosome composed of Small Nuclear
RNA and Protein termed as snRNP (Small
Nuclear RibonucleoProtiens)
The main snRNP, which constitutes the
Spliceosome are U1, U2, U4, U5 and U6
Splicing-Group-II Intron Splicing
Structure of Intron

80. During splicing the U1 bind with 5-Prime and U2
associates with Branch site’s A
Mechanism of Splicing
In 2nd phase the remaining snRNP (U5, U4, U6)
join the U1 and U2 and assembly of Spliceosome
is complete. Spliceosome loops out Intron and
bring close Exons
This binding is due to some Consensus Sequence
between U-1 5-Prime Splice Site (Splice Donor),

81. Mechanism of Splicing
In 3rd phase U1 and U4 are released and U6 pair both 5-
Prime splice site and U2
In 4th phase the 5-Prime end of Intron disassociate from
Exon and attach to Branch point A

82. Mechanism of Splicing
In final phase, the 3-Prime end of Intron cleave and
Intron is released as LARIAT (Loop) and is
degraded and Exons join together
The snRNP are reused in the process of Splicing
again and again

84. RNA Interference (RNA i)
The small interfering RNAs (si RNA) or Micro RNA (mi RNA) molecules can bind with m RNA and
stop Translation or Gene Expression
The m RNA can bend on itself and form double strand structure (Hairpin), which bind with Dicer protein
The ds Small or Micro RNA
associates with RNA-Induced
Silencing Complex (RISC)
Dicer cuts the ds RNA
One of the RNA strand is removed
The 2nd strand can bind with cellular
m RNA and cause Gene silencing
Importance: Gene Regulation during
Differential development
Silencing of pathogens genes to
prevent host cell infection
Silencing of Transposable elements

85. Genetic Code-Universal Code
The actual information for making proteins is called the genetic code
Genetic code is based on codons i.e. sequences of three bases that instruct for the addition of a
particular amino acid (or a stop)
Codons are thus read in sequences of 3 bases on m RNA (Triplet code) 5’3’
How many bases are required for each amino acid
This was worked by Nirenberg using Poly-Uracil RNA
(4 N.B) N.B/aa = 4 amino acids—not enough
(4 N.B) 2N.B/aa = 16 amino acids—not enough
(4 N.B) 3 N.B/aa = 64 amino acid possibilities
(Minimum of 3 bases/aa required)

86. The actual information for making proteins is called the genetic
code. The code is degenerate or redundant i.e. some amino acids
are coded by more than one codon (some have only one, some as
many as 6)
AUG is the “start” codon i.e. all proteins will begin with
methionine (Met)
The stop codons do not code for an amino acid but instead
will end the protein chain
Genetic Code-Universal Code
Genetic code is based on codons i.e. sequences of 3-bases on m
RNA (Triplet code) that instruct the addition of a particular
amino acid (or a stop) and can be read as 5’3’
How many bases are required for each amino acid
(4 N.B) N.B/aa=4 amino acids—not enough
(4 N.B) 2N.B/aa = 16 amino acids-not enough
(4 N.B) 3 N.B/aa = 64 amino acid possibilities
(Minimum of 3 bases/aa required).
This was worked by Nirenberg using Poly-Uracil
RNA

87. The process can be blocked at initiation of translation stage, in which Regulatory proteins attach to
the 5' end of mRNA and prevent attachment of ribosomal subunits & further block large subunit
(tRNA) association for translation
Translation and its Regulation
Ribosomes-Nucleo-Protein particles-Protein factories
The process of translation (protein synthesis) involves decoding an mRNA message by a ribosome
into a polypeptide (Protein) product and is the second part of gene expression

88. mRNA-small subunit-tRNA complex recruits the large subunit-Initiation Complex-which is facilitated by
Initiation Factors by binding of ribosomal subunits and tRNA to the mRNA chain
Initiation, Elongation and Termination
Translation-DNA-m RNA-Protein
Initiation-Ribosome small subunit binds to mRNA
Charged tRNA (bounded to Ribosome Large subunit) anticodon forms base pairs with the mRNA codon
Small subunit interacts with initiation factors and special initiator tRNA that is charged with methionine
At initiation-the tRNA fMet (a special tRNA molecule, termed N-formyl
methionine) recognizes and binds to the initiator codon at P site
A second, charged tRNA complementary to the next codon binds the A site
The large subunit of the ribosome contains three binding sites-Amino acyl
(A site), Peptidyl (P site) and Exit (E site)
In the formation of initiation complex, the fMet-tRNA occupies the P site of
ribosome, while A site is left empty

89. Peptide bond is formed between amino acids in A and P sites by
Peptidyl transferase
Ribosome translocates by three more bases
The processed tRNA at P site, is moved to the E site
Translation: Elongation
Elongation: Ribosome translocate by three bases after peptide bond formed
New charged tRNA aligns in the A site
Termination: Elongation proceeds until STOP
codon reached (UAA, UAG, UGA) and
recognized by a release factor
tRNA charged with last amino acid will remain at P site
Release factors cleave the amino acid from the tRNA
Ribosome subunits dissociate from each other
Ribosome subunits dissociate from each other

90. Amino acids differ in their properties due to differing side chains, called R groups
Amino acids-Structure-Amino acids are organic molecules with
carboxyl and amino groups
 carbon
Proteins-Polymers or polypeptide of Amino acids (200-60,000)-C H O N S
About 10,000 different proteins are part of our body.

91. Hydrophilic Hydrophobic
Amino Acids-Classification-(9 A.A-histidine, isoleucine, leucine, lysine, methionine,
phenylalanine, threonine, tryptophan, and valine Termed essential A.A (come from food)

92. Glycine
(Gly or G)
Alanine
(Ala or A)
Valine
(Val or V)
Leucine
(Leu or L)
Isoleucine
(Ile or I)
Methionine
(Met or M)
Phenylalanine
(Phe or F)
Tryptophan
(Trp or W)
Proline
(Pro or P)
Nonpolar Side Chains (R)-Hydrophobic

93. Polar Side Chain (R)-Hydrophilic-attracted to water
The R groups look non-polar but there are unpaired electrons and each N, O or
S atom has unshared electron pairs that make them polar and water soluble

94. Hydrophilic-Electrically Charged either +ve or -ve

96. Peptide Bond-Condensation and Hydrolytic Reactions
A protein is a biologically functional molecule that
consists of one or more polypeptides
Condensation: Polypeptides are unbranched
polymers synthesized from the same set of 20 amino
acids through condensation reaction, where OH of
Carboxyl and H from Amino groups are released in
the form of Water and associate in the form of
Peptide Bond (a)
Hydrolysis: In hydrolysis the Peptide bond
between Amino Acids is broken, while OH and H
(water) addition occur to Carboxyl and Amino
groups respectively (b)

97. Polypeptide-Protein
Peptide bond formation occurs during Translation, where
small subunit of ribosome attached with-mRNA (Codon)
and large subunit with-tRNA (Anticodon)

98. Protein Synthesis
The processes of transcription and translation,
where information from gene is transferred
into m-RNA (Transcription) and then
association of m-RNA and t-RNA (Translation)
on the surface of Ribosomes takes place to
make proteins

99. TET11 (AT1G18520)-Tetraspanin11 Germline Plasma Membrane Integral Protein-(Boavida et al., 2013)
5ATGTTTCGAGTTAGCAATTTCATGGTTGGTCTAGCAAACACATTGGTGATTTAGTGGGCGCTTCGGCCATTGGTTATTCGATTTACATGTTCGTTCAC
CAAGGCGTCACTGATTGTGAATCTGCCATTCGGATACCACTTCTCACGACCGGACTCATCCTCTTCTTGGTGTCTTTGCTCGGAGTGATTGGAT
CTTGTTTCAAGGAGAATTTGGCAATGGTTTCCTACTTGATCATATTGTTTGGGGGCATTGTTGCATTGATGATTTTCTCCATATTTCTCTTCTTTG
TGACCAACAAAGGAGCCGGTCGTGTGGTGTCCGGTCGAGGGTATAAAGAGTACCGGACGGTGGATTTCTCGACGTGGCTTAATGGGTTCGTT
GGTGGGAAGAGATGGGTTGGGATAAGGTCTTGTTTGGCTGAGGCTAACGTTTGTGATGATTTGAGTGATGGTCGTGTTAGTCAGATCGCTGAT
GCGTTTTATCACAAGAACTTGTCTCCCATCCAGgtattgttttggatcgattttctgtatgaacatatttctttgttgatatttttgtataaatatagtaaagggaagaccaatcaaagcttttgctttcttta
gtatatatatatgtaaagacaaatcaataaaaaatagtctaggttcatttcatcgttcttagtatgattaaatttcattgttaagtttttgcatatagtaacaaaagcaagacaatttttagccgaactaagataacacttatat
gttaagccgttaaatttattgttcataatgggttgtgtaactcaagtattgattgtgtatgagcagTCAGGTTGTTGTAAGCCACCATCGGATTGCAACTTCGAGTTCAGAAACGCGA
CGTTCTGGATACCGCCGAGCAAAAACGAAACGGCAGTTGCGGAAAACGGGGACTGTGGTACGTGGAGCAACGTGCAAACAGAGTTATGTTTC
AACTGCAACGCATGCAAAGCGGGTGTGTTAGCGAACATAAGAGAGAAGTGGAGGAATCTTCTTGTTTTCAACATTTGTCTCCTCATTCTCCTCA
TAACCGTCTATTCCTGCGGTTGCTGTGCTCGTCGTAACAATCGGACGGCTAGGAAAAGTGATTCTGTCTGA-3
AT1G18520-Gene Detail-CDS having Intron, Exon plus Stop Codon-1124+3=1127bp
5TCAGACAGAATCACTTTTCCTAGCCGTCCGATTGTTACGACGAGCACAGCAACCGCAGGAATAGACGGTTATGAGGAGAATGAGGAGACAAA
TGTTGAAAACAAGAAGATTCCTCCACTTCTCTCTTATGTTCGCTAACACACCCGCTTTGCATGCGTTGCAGTTGAAACATAACTCTGTTTGCAC
GTTGCTCCACGTACCACAGTCCCCGTTTTCCGCAACTGCCGTTTCGTTTTTGCTCGGCGGTATCCAGAACGTCGCGTTTCTGAACTCGAAGTT
GCAATCCGATGGTGGCTTACAACAACCTGActgctcatacacaatcaatacttgagttacacaacccattatgaacaataaatttaacggcttaacatataagtgttatcttagttcggctaaaa
attgtcttgcttttgttactatatgcaaaaacttaacaatgaaatttaatcatactaagaacgatgaaatgaacctagactattttttattgatttgtctttacatatatatatactaaagaaagcaaaagctttgattggtcttcc
ctttactatatttatacaaaaatatcaacaaagaaatatgttcatacagaaaatcgatccaaaacaatacCTGGATGGGAGACAAGTTCTTGTGATAAAACGCATCAGCGATCTGA
CTAACACGACCATCACTCAAATCATCACAAACGTTAGCCTCAGCCAAACAAGACCTTATCCCAACCCATCTCTTCCCACCAACGAACCCATTAA
GCCACGTCGAGAAATCCACCGTCCGGTACTCTTTATACCCTCGACCGGACACCACACGACCGGCTCCTTTGTTGGTCACAAAGAAGAGAAAT
ATGGAGAAAATCATCAATGCAACAATGCCCCCAAACAATATGATCAAGTAGGAAACCATTGCCAAATTCTCCTTGAAACAAGATCCAATCACTC
CGAGCAAAGACACCAAGAAGAGGATGAGTCCGGTCGTGAGAAGTGGTATCCGAATGGCAGATTCACAATCAGTGACGCCTTGGTGAACGAAC
ATGTAAATCGAATAACCAATGGCCGAAGCGCCCACTAACATCACCAATGTGTTTGCTAGACCAACCATGAAATTGCTAACTCGAAACAT
-3
Forward strand of DNA
Reverse strand of DNA

100. ATGTTTCGAGTTAGCAATTTC (TET11 CDS Primer Forward (F)
(1) ATGTTTCGAGTTAGCAATTTC (21) (Genomic DNA from ATG TAIR)
CCGATCCTTTTTCACTAAGACAG (TET11 CDS Primer Reverse (R)
CTCGTCGTAACAATCGGAC(1104) GGCTAGGAAAAGTGATTCTGTC (1125) TGA (Genomic DNA with
no stop codon from TAIR)
GACAGAATCACTTTTCCTAGCC (TET11 CDS Reverse primer)
1124 bp without Stop Codon (TGA)
TET11 Gene Cloning
1 ATGTTTCGAG TTAGCAATTT CATGGTTGGT CTAGCAAACA CATTGGTGAT
51 GTTAGTGGGC GCTTCGGCCA TTGGTTATTC GATTTACATG TTCGTTCACC
101 AAGGCGTCAC TGATTGTGAA TCTGCCATTC GGATACCACT TCTCACGACC
151 GGACTCATCC TCTTCTTGGT GTCTTTGCTC GGAGTGATTG GATCTTGTTT
201 CAAGGAGAAT TTGGCAATGG TTTCCTACTT GATCATATTG TTTGGGGGCA
251 TTGTTGCATT GATGATTTTC TCCATATTTC TCTTCTTTGT GACCAACAAA
301 GGAGCCGGTC GTGTGGTGTC CGGTCGAGGG TATAAAGAGT ACCGGACGGT
351 GGATTTCTCG ACGTGGCTTA ATGGGTTCGT TGGTGGGAAG AGATGGGTTG
401 GGATAAGGTC TTGTTTGGCT GAGGCTAACG TTTGTGATGA TTTGAGTGAT
451 GGTCGTGTTA GTCAGATCGC TGATGCGTTT TATCACAAGA ACTTGTCTCC
501 CATCCAGTCA GGTTGTTGTA AGCCACCATC GGATTGCAAC TTCGAGTTCA
551 GAAACGCGAC GTTCTGGATA CCGCCGAGCA AAAACGAAAC GGCAGTTGCG
601 GAAAACGGGG ACTGTGGTAC GTGGAGCAAC GTGCAAACAG AGTTATGTTT
651 CAACTGCAAC GCATGCAAAG CGGGTGTGTT AGCGAACATA AGAGAGAAGT
701 GGAGGAATCT TCTTGTTTTC AACATTTGTC TCCTCATTCT CCTCATAACC
751 GTCTATTCCT GCGGTTGCTG TGCTCGTCGT AACAATCGGA CGGCTAGGAA
816 AAGTGATTCT GTCTGA
Amino Acids (261)
1 MFRVSNFMVG LANTLVMLVG ASAIGYSIYM FVHQGVTDCE SAIRIPLLTT
51 GLILFLVSLL GVIGSCFKEN LAMVSYLIIL FGGIVALMIF SIFLFFVTNK
101 GAGRVVSGRG YKEYRTVDFS TWLNGFVGGK RWVGIRSCLA EANVCDDLSD
151 GRVSQIADAF YHKNLSPIQS GCCKPPSDCN FEFRNATFWI PPSKNETAVA
201 ENGDCGTWSN VQTELCFNCN ACKAGVLANI REKWRNLLVF NICLLILLIT
251 VYSCGCCARR NNRTARKSDS V
AT1G18520-CDS having Exon plus Stop Codon-813+3=816bp
AT1G18520-m RNA length will be 813bp while Gene length is
1124 bp

101. Four Levels of Organizations
Quaternary-Interaction between
2 polypeptide chains
Primary-The primary Amino acid sequence of the protein
Secondary-folding of alpha or
beta sheet or coiling (H bonds)
Tertiary-the Secondary form fold on
themselves and result into tertiary
structure (Non-covalent bond b/w R
groups within the protein)

102. Primary structure-the sequence of amino acids in a
protein which is like the order of letters in a long word
Primary structure is determined by inherited genetic
information
Primary Structure

103. Typical secondary structures are a coil called
an  helix and a folded structure called a 
pleated sheet
Secondary Structure
The coiling and folding of secondary structure
result from Hydrogen bonds between repeating
constituents of the polypeptide backbone

104. These interactions between R groups
include actual ionic bonds and strong
covalent bonds called disulfide bridges
which may reinforce the protein’s structure
Tertiary structure is determined by
interactions between R groups, rather than
interactions between backbone
constituents
Tertiary structure

105. Collagen is a fibrous protein consisting
of three polypeptides coiled like a rope
Quaternary structure
Quaternary structure results when two
or more polypeptide chains form one
macromolecule
Hemoglobin is a globular protein consisting of four
polypeptides chains-2 alpha and 2 beta chains

106. Protein Folding-polypeptide can fold into 2-forms
at backbone
-helix-protein turns like a spiral-fibrous proteins
(hair, nails, horns)
-sheet-protein folds back on itself as in a
ribbon-globular protein

107. Stabilizing Cross-Links
Cross linkages can be between 2 parts of a protein or between 2 subunits e.g.
Disulfide bonds (S-S) form between adjacent -SH groups on the amino acid cysteine

108. Types of Proteins
Fibrous Proteins-usually span a long distance in the cell-long and rod shaped
e.g. Collagen and Elastin
Globular or Spheroproteins-Compact shape like a ball with irregular surfaces-
Enzymes, Albumen, Hemoglobin and Immunoglobulins (A, D, E, G, M)
Classification Proteins
Simple Protein Conjugated Protein Derived Protein

109. Simple proteins-are those which are made of amino acid units only, joined by peptide bond
and yield mixture of amino acids on hydrolysis Albumins (Egg albumin, serum albumin)
Conjugated proteins-are composed of simple proteins combined with a non-proteinous
substance termed prosthetic group or cofactor e.g. Chromo-proteins: Haemoglobin in which
prosthetic group is iron and Phospho-proteins (Casein in milk) in which prosthetic group is
phosphoric acid
Types of Proteins
Derived Proteins-These are not naturally occurring proteins and are obtained from simple proteins
by the action of enzymes and chemical agents e.g. Peptones (water-soluble mixtures of polypeptides,
oligopeptides and single amino acids, together with the other water-soluble compounds present in the
original proteinaceous substrate), Peptides , Proteases (are produced during digestion by the hydrolytic
(gastric pepsin) breakdown of proteins).

110. Conjugated Proteins

111. Globular Proteins
The side chains determine conformation in an aqueous solution

112. Collagen and Elastin

113. Proteins-Functions
Antibodies: bind to specific foreign particles, such as viruses and bacteria, to help protect the body e.g. IgG
Proteins make up about 18% of the cell and 60% of Cell membrane
Enzymes: carry out almost all of the thousands of chemical reactions that take place in cells. They also assist
with the formation of new molecules by reading the genetic information stored in DNA i.e. DNA-Polymerase
(DNA-Replication), RNA-Polymerase (Transcription)
Messenger proteins: some types of hormones, which transmit signals to coordinate biological processes
between different cells, tissues, and organs i.e. Gibberellins-Breaking of seed dormancy (Amylase production
and hydrolysis of starch into Glucose) and Stem elongation/Auxin-Cell elongation, Growth hormones)
Structural component: These proteins provide structure, support cells and on a larger scale, they also allow
the body to move (Actin/Myosin)
Transport/storage: These proteins bind and carry atoms and small molecules within cells and throughout the
body. 1 gram protein provides 4 calories of energy

114. Post-Translation modification of Protein
1) Phosphorylation-Addition of Phosphorus groups by
Protein Kinases which plays an important role in Cell
cycle (Growth), Signaling transduction and increases
hydrophilic character of that protein
2) Methylation-Addition of Methyl (CH3) groups by
Methyl Transferase which increases hydrophobic
character of Amino acids and this regulate gene
expression during Transcription
3) Glycosylation-Addition of Sugar components to
Proteins and this is mostly occur plasma membrane of
cell and those proteins mostly act as Receptors
4) Proteolysis-is the breakdown of long inactive (zymogen)
polypeptide chain into small active polypeptide by an
enzyme known as Proteases and this post-translation
modification mostly occurs in the digestive tract
5) N-Acetylation-is the addition of an Acetyl group at N-
terminal Nitrogen during Translation elongation stage e.g.
Histone is acetylated, which help in gene expression as
Non-Acetylated Histone keep DNA in folded form and
Genes are switch off, while Acetylated Histones keep
Chromatin DNA loose and activate Transcription
The Polypeptide chain or Protein undergoes various
modification or processing
6) Lipidation-is the addition of Lipid components to
Polypeptide chain and this help in hydrophobic character
and those proteins have to be functional parts of various
endo-membranes systems (ER/Mitochondrial/Plasma)

115. Protein degradation-ubiquitin
tagging and then proteasome
degradation-this process
regulate both Transcription and
Translation processes
The 2nd major type of Protein modification is structural
changes in the polypeptide chain
Post-Translation modification of Protein
Primary linear polypeptide structure either changes a)
Secondary b) Tertiary c) Quaternary Proteins
Quaternary-Interaction between 2 polypeptide chains
Secondary-folding of alpha or beta sheet or coiling (H
bonds)
Tertiary-the Secondary form fold on themselves and
result into tertiary structure (Non-covalent bond b/w R
groups within the protein)

116. Protein processing & degradation
Protein processing: Folding, cleaving, adding sugar groups, targeting for
transport
Protein degradation-ubiquitin tagging and then proteasome degradation