hayloronic acid preparation

1. Injectable oxidized hyaluronic acid/adipic acid dihydrazide hydrogel
for nucleus pulposus regeneration
Wen-Yu Su, Yu-Chun Chen, Feng-Huei Lin *
Institute of Biomedical Engineering, National Taiwan University (NTU), No. 1, Sec. 4, Roosevelt Road, Taipei 106, Taiwan, ROC
Division of Medical Engineering Research, National Health Research Institutes, 35 Keyan Road, Zhunan, Miaoli County 350, Taiwan, ROC
a r t i c l e i n f o
Article history:
Received 24 August 2009
Received in revised form 23 February 2010
Accepted 23 February 2010
Available online 1 March 2010
Keywords:
Biocompatibility
Nucleus pulposus
Injectable hydrogel
Hyaluronic acid
a b s t r a c t
Injectable hydrogel allows irregular surgical defects to be completely filled, lessens the risk of implant
migration, and minimizes surgical defects due to the solution–gel state transformation. Here, we first
propose a method for preparing oxidized hyaluronic acid/adipic acid dihydrazide (oxi-HA/ADH) inject-
able hydrogel by chemical cross-linking under physiological conditions. Fourier transform infrared spec-
trometry and trinitrobenzene sulfonate assay were used to confirm the oxidation of hyaluronic acid.
Rheological properties were measured to evaluate the working ability of the hydrogel for further clinical
application. The oxi-HA/ADH in situ forming hydrogel can transform from liquid form into a gel-like
matrix within 3–8 min, depending on the operational temperature. Furthermore, hydrogel degradation
and cell assessment is also a concern for clinical application. Injectable oxi-HA/ADH8 hydrogel can main-
tain its gel-like state for at least 5 weeks with a degradation percentage of 40%. Importantly, oxi-HA/
ADH8 hydrogel can assist in nucleus pulposus cell synthesis of type II collagen and aggrecan mRNA gene
expression according to the results of real-time PCR analysis, and shows good biocompatibility based on
cell viability and cytotoxicity assays. Based on the results of the current study, oxi-HA/ADH hydrogel may
possess several advantages for future application in nucleus pulposus regeneration.
Ó 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
1. Introduction
The intervertebral disc (IVD) is composed of a central glycos-
aminoglycan (GAGs)-rich nucleus pulposus (NP) and an outer col-
lagen-rich annulus fibrosus (AF). GAGs have a unique water
binding ability due to the highly negative charge on the molecular
chain. Loss of GAGs from the NP is the first sign of disc degenera-
tion [1], and the loss of GAGs is hypothesized to result in a loss
of compression pressure absorption ability. Disc degenerative dis-
eases (DDDs) affect the 30–50 year old population and contribute
to acute and chronic disability [2–4]. Because of the native prop-
erty of avascularity, the IVD is unable to perform self-repair when
the degeneration process has begun. Symptoms associated with
DDD include IVD collapse, disc height decrease, alteration in spine
mechanics, and T2-weighted magnetic resonance imaging signal
intensity decrease [5].
The most common therapies and noninvasive treatments are
physical therapy and dosage with painkillers to relieve discogenic
back pain. However, with aging or other genetic/environmental
factors, symptoms may continue to progress, and invasive treat-
ment may be the only way for the patient to overcome chronic
symptomatic discogenic low back pain. Spinal fusion and discec-
tomy are two major clinical surgeries for this condition. Spinal fu-
sion is a surgery that fixes adjacent vertebrae together and leads to
limited mobility of the spine or posterior muscle atrophy. Discec-
tomy is another common treatment that removes the central part,
the nucleus pulposus, of the intervertebral disc. According to Tibre-
wal and Pearcy [6], following surgery, disc height can decrease
compared with a non-operated control after a patient undergoes
discectomy. Therefore, nucleus pulposus replacement is necessary
and has been widely developed to overcome the problem of disc
height reduction. Prosthetic Disc Nucleus (Raymedica Inc., Bloom-
ington, MN) [7], Aquarelle (Stryker Spine, Allendale, NJ) [8] and
NeuDisc (Replication Medical Inc., New Brunswick, NJ) [9] are cur-
rent implants under study. The complications from these pre-
formed implants may include extrusion and endplate fracture.
Recently, more researchers and companies have focused their
studies on injectable hydrogel development, such as that of DAS-
COR Disc Arthroplasty Device (Disc Dynamics Inc., Eden Prairie,
MN) and BioDisc. (Cryolife, Kennesaw, GA) [10]. The injectable
hydrogels can be maintained in the liquid state before injection
and harden after transplantation in vivo. The solution–gel transfor-
mation property allows irregular surgical defects to be completely
filled, lessens the risk of implant migration, and minimizes surgical
defect to the size of a needle. Additionally, the liquid solution can
1742-7061/$ - see front matter Ó 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.actbio.2010.02.037
* Corresponding author. Tel.: +886 37 246166x37126; fax: +886 37 246166.
E-mail address: double@nhri.org.tw (F.-H. Lin).
Acta Biomaterialia 6 (2010) 3044–3055
Contents lists available at ScienceDirect
Acta Biomaterialia
journal homepage: www.elsevier.com/locate/actabiomat

2. also be incorporated with therapeutic factors (e.g., TGF, BMP, EGF)
[11] and cells (e.g., nucleus pulposus, mesenchymal stem cells)
through a microdiscectomy procedure to relieve low back pain or
to reverse disc degeneration.
In this study, we have developed an injectable hydrogel com-
posed of oxidized hyaluronic acid (oxi-HA) and adipic acid dihy-
drazide (ADH) and incorporated it with nucleus pulposus cells to
reverse nucleus pulposus degeneration. The method of oxi-HA
preparation was according to Bulpitt and Aeschlimann with slight
modification [12]. However, the study of Bulpitt focuses on func-
tional hyaluronic acid synthesis, such as hyaluronic acid with ami-
no or aldehyde, and hyaluronic acid based hydrogels with
bifunctional cross-linkers. Sodium periodate was widely used in
the chemical reaction due to its superior property as an oxidizing
agent. We used sodium periodate to create the hyaluronic acid
functional group and, further, to cross-link with adipic acid dihy-
drazide to form an injectable hydrogel. To evaluate the gel for fur-
ther applications, Fourier transform infrared spectrometry (FTIR)
and the trinitrobenzene sulfonate (TNBS) assay were used for
chemical characteristic analysis of oxi-HA and hyaluronic acid/adi-
pic acid dihydrazide (oxi-HA/ADH) hydrogel. Rheological proper-
ties of oxi-HA/ADH hydrogel were evaluated by rheometer. In
addition, the biocompatibility and gene expression of NP cells were
also evaluated. We expected the oxi-HA/ADH hydrogel to not only
play a part in nucleus pulposus replacement, but also have the abil-
ity to lead to de novo synthesis of replacement tissue through
small invasive injection therapy.
2. Materials and methods
2.1. Materials and reagent
All materials and reagents used in this phase of the study were
purchased from Sigma–Aldrich Inc. (St. Louis, MO, USA) unless
otherwise stated. Hyaluronic acid was purchased from Q.P. Corpo-
ration (average molecular weight of 3.2 105
Da, according to
manufacturer’s specification). Diethyleneglycol, potassium bro-
mide, and sodium periodate were obtained from RDH Chemical
Co. (Folex Co.). Trichloroacetic acid was purchased from JTB Corpo-
ration (Tokyo, Japan). Dialysis tubes with a nominal MWCO of
6000–8000 Da were sourced from Membrane Filtration Products
Inc. (Texas, USA).
Antibiotic–antimycotic, trypsin–EDTA, fetal bovine serum, and
the SuperScript™ III first-strand synthesis system were obtained
from Invitrogen (Carlsbad, California). The RNeasy Mini kit was
purchased from QIAGEN (Alabama, USA). Flasks and culture well/
dishes were obtained from Orange Scientific (Braine-l’Alleud, Bel-
gium). TaqManÒ
Universal PCR Master Mix, optical reaction plate,
and optical adhesive covers for real-time PCR were procured from
Applied Biosystems (CA, USA).
2.2. Methods
2.2.1. Preparation of oxidized hyaluronic acid
Hyaluronic acid (HA) with a concentration of 1% (w/v) was dis-
solved in double-distilled water at room temperature and then
15 ml of sodium periodate (NaIO4, 2.67%) in double-distilled water
was gently added under stirring. The molar ratio of NaIO4 to HA
was 1:1. The oxidation reaction proceeded in a dark environment
for 24 h at room temperature. The reaction was stopped by the
addition of ethylene glycol (0.5 ml). In order to obtain a uniformly
oxidized HA, a dialysis tube was used to separate the byproduct
and oxidized HA. Double-distilled water was used as a dialysis buf-
fer solution, and the water was changed three times per day. Silver
nitrate (1%) was used to check the amount of periodate in the outer
dialysis buffer, with water change required until there was no pre-
cipitate shown. The final oxidized HA product was obtained by
freeze-drying (FDU-1200, EYELA Corp., Tokyo, Japan). The average
yield of oxidized hyaluronic acid was about 87%.
2.2.2. Characterization of oxi-hyaluronan (oxi-HA) by Fourier
transform infrared (FTIR) and trinitrobenzene sulfonate (TNBS) assay
An FTIR spectrometer (JASCO Inc., Easton, MD, USA) with ATR
PRO450-S was used to identify the functional group of oxidized
hyaluronic acid. Samples were freeze-dried and ground into pow-
der, then placed in well plates, and gently pressed down with the
pressure tip. The FTIR spectra were obtained by recording 48 scans
between 2200 and 700 cm1
with a resolution of 8 cm1
.
The TNBS assay was used to determinate the oxidation degree
of oxidized HA. The tert-butyl carbazate (t-BC) has the ability to re-
act with aldehydes, forming stable carbazone in a similar manner
to hydrazone formation. Briefly, a volume of 25 ll (0.6%) oxidized
HA and 25 ll (30 mM) t-BC in 1% aqueous trichloroacetic acid were
well mixed and allowed to react in a disposable Eppendorf tube at
room temperature. After 24 h, 0.5 ml of aqueous TNBS solution
(6 mM, 0.1 M borate buffer, pH 8) was transferred into the eppen-
dorf tube to react with the excess t-BC. The t-BC-TNBS reaction was
allowed to react for 60 min at room temperature. A volume of
0.05 ml of the final mixture was transferred into a 96-well plate
and diluted with 0.5N hydrochloric acid. The absorbance of the
solution was measured with a VersaMax™ microplate reader
(Molecular Devices, Toronto, Canada) at 340 nm. A standard cali-
bration curve from the aqueous t-BC solutions (30–5 mM) was
used to determine the amount of unreacted t-BC and further, to
convert the result into dialdehyde content. All experiments were
done in triplicate.
2.2.3. Preparation of oxi-HA/ADH hydrogel
For application in nucleus pulposus regeneration, phosphate
buffer salt (PBS) solution (pH 7.4) was selected as the best choice
as a solvent source. A concentration of 6% (w/v) oxidized HA was
dissolved in PBS overnight at 4 °C and gently mixed with 2% (w/
v), 4% (w/v), and 8% (w/v) concentrations of adipic acid dihydrazide
(ADH) to form oxi-HA/ADH2, oxi-HA/ADH4, and oxi-HA/ADH8
hydrogels, respectively.
2.2.4. Degradation and swelling properties of oxi-HA/ADH hydrogel
Swelling and degradation studies were conducted on oxi-HA/
ADH2, oxi-HA/ADH4, and oxi-HA/ADH8 hydrogels in phosphate
buffered saline (PBS) under 37 °C, 5% CO2. In brief, 0.3 ml of li-
quid-state oxi-HA/ADH solution was introduced into the cylinder
mold and allowed to set for 10 min to form a gel-like matrix. After
transferring the cylinder of oxi-HA/ADH hydrogel into a 24-well
culture plate, 3 ml PBS was added to each well. At a specific time
point, the oxi-HA/ADH hydrogel was removed, blotted gently with
filter paper to remove surface water, and the swollen hydrogel was
weighed (Ws). Lyophilization of the hydrogel was carried out using
a freeze-drying method to obtain the dry weight (Wd). The degra-
dation percentage was calculated using the formula (Wd Wi)/
Wi 100%, where Wi is the initial weight of hydrogel on day 0.
In addition, the swelling ratio was also calculated by (Ws Wd)/
Wd. All experiments were done in tetraplicate.
2.2.5. Evaluation of working ability, yield stress, and visco-elastic
properties of oxi-HA/ADH hydrogel by rheometer
A HAAKE RheoStress 600 (Thermo Fisher Scientific Inc., Wal-
tham, MA, USA) instrument with parallel plate geometry was used
to evaluate the gelling time of oxi-HA/ADH in situ forming hydro-
gel. The temperature was controlled accurately by temperature
control units. Two working temperatures were evaluated in the
study, the preservation temperature (4 °C) and body temperature
W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055 3045

3. (37 °C). About 4 °C was used to evaluate the operation time re-
quired for a surgeon to mix the oxi-HA/ADH hydrogel, and 37 °C
was used to evaluate the gelling time for oxi-HA/ADH hydrogel.
The gap height between the upper (35 mm in diameter) and bot-
tom stainless steel plates was set at 1.05 mm. Oscillation-time
sweep mode was used to evaluate the gelling time of the hydrogel.
The storage modulus (G0
) and loss modulus (G00
) were recorded for
further analysis. All experiments were carried out at low frequency
and fixed stress. The results of gelation time determination were
summarized by Rheo Win3 Data Manager.
Yield stress analysis was also pre-formed on the HAAKE Rheo-
Stress 600 setup, with oxi-HA/ADH hydrogel pre-cured on the par-
allel plate at 37 °C for 45 min to allow for the cross-linking process.
The stress sweep model was used in the test with a 1 Hz frequency.
Results were expressed as G0
versus s (applied force on hydrogel)
and the yield stress was calculated by Rheo Win3 Data Manager.
To study the visco-elastic behavior of the hydrogels, oscillation
frequency sweep test with a controlled strain of c = 0.01 rad was
performed. The hydrogel was pre-cured on the parallel plate at
37 °C for 30 min before testing, and the range of the frequency
was from 1 to 100 rad s1
. The values of complex shear modulus
|G*|, dynamic viscosity |g*|, storage modulus’ G0
, loss modulus G00
and the phase shift angle d, were plotted as a function of frequency.
The formula G*(x) = r(x)/c(x) = G0
+ iG00
represents the relation-
ship among G*, G0
and G00
. Storage modulus (G0
) represents the elas-
tic property of a material whereas the viscous property is
characterized by the loss modulus (G00
). The absolute magnitude
of complex shear modulus |G*|, calculated from (G02
+ G002
)1/2
, rep-
resents the shear stiffness of the material. The phase shift angle
is calculated from the ratio of loss and storage modulus (G00
/
G0
= tan(d)), and the dynamic viscosity |g*| is derived from
|g*| = |G*|/x. For pure elastic material, the phase shift angle should
equal 0° while the phase shift angle equal 90° for pure viscous
fluid. If the characteristic of the material is visco-elastic, the phase
shift angle should between 0° and 90°.
2.2.6. Cell isolation
Six-month-old New Zealand White rabbits were used as a
source for nucleus pulposus (NP) cells. After euthanasia by carbon
dioxide inhalation, the lumbar spine from L2 to L6 was carefully ta-
ken out and washed twice with physiologic saline. Each disc (L2–
L3, L3–L4, L4–L5, and L5–L6) was carefully dissected; the nucleus
pulposus tissue was taken out by blunt dissection and pooled in
PBS containing 10% penicillin/streptomycin under aseptic environ-
ment. Tissue was digested by Dulbecco’s Modified Eagle’s Medium/
Nutrient Mixture F-12 Ham (DMEM/F12) containing 0.01% collage-
nase for 16 h at 37 °C. After brief centrifugation, NP cells were re-
suspended in standard culture medium consisting of DMEM/F12,
1% penicillin/streptomycin, and 10% fetal bovine serum in a T-25
flask until they reach 80–90% confluence. The cells were trypsini-
zed and suspended in a T-75 flask. Cells used in the study were
from passage six.
2.2.7. Biocompatibility studies of oxi-HA/ADH hydrogels
Biocompatibility evaluation of oxi-HA/ADH hydrogel was car-
ried out by testing the extraction medium with a monolayer of rab-
bit NP cells according to ISO standards [13]. The extraction
medium was prepared by incubating the oxi-HA/ADH2, oxi-HA/
ADH4, and oxi-HA/ADH8 hydrogel with standard culture medium
at a 0.75 cm2
ml1
extraction ratio for 72 h at 37 °C. Two hundred
microliters of the extraction medium was tested on a monolayer of
NP cells. NP cells were seeded in 96-well tissue culture plates and
fed with standard culture medium at 37 °C under 5% carbon diox-
ide atmosphere. Groups in the study including control (standard
culture medium), negative control (Al2O3 extraction medium), po-
sitive control (0.1% Triton X-100 contained medium), and experi-
mental hydrogel (oxi-HA/ADH2, oxi-HA/ADH4, and oxi-HA/ADH8
extraction medium) were tested in hexplicate. After incubation at
37 °C for 72 h, cell viability and cytotoxicity evaluations were
quantitatively assessed using the Quick Cell Proliferation Assay
kit II (BioVision Inc., CA, USA) and CytoTox 96Ò
Non-Radioactive
Cytotoxicity Assay (Promega Corporation, WI, USA), separately.
Cells treated with extraction medium were also stained with
Live/Dead staining kit (Molecular Probes # L3224, Eugene, Oregon,
USA) and photoed by NIS Element software.
For cell viability evaluation, we discarded the test medium after
72 h incubation and transferred 0.2 ml water soluble tetrazolium-8
(WST-8) working solution to each well. After 2 h incubation, the
WST-8 working solution should show color change due to cleavage
of the tetrazolium salt to form formazan by cellular mitochondrial
dehydrogenase. NP cell viability was quantitatively assessed by
spectrophotometer readout at 450 nm. The reference wavelength
was 650 nm.
For cytotoxicity evaluation, we transferred 0.05 ml of the incu-
bation medium into 96-well ELSA plates, mixed with 0.05 ml sub-
strate mix, and incubated for 30 min in the dark. The tetrazolium
salt in substrate mix could react with lactate dehydrogenase
(LDH) to give a red formazan product. LDH released in the medium
was quantitatively assessed by spectrophotometer readout at
490 nm. Extraction medium (without incubation with NP cells)
was also evaluated to serve as a culture medium background. All
NP cells were lysed by lysis solution (1% TritonÒ
X-100) and the
OD490 value was read. Percent cytotoxicity was expressed as
follows:
% Cytotoxicity ¼
Medium O:D: Blank O:D:
Total Lysis O:D: Blank O:D:
100
2.2.8. Fluorescence staining of NP cell encapsulated in oxi-HA/ADH
hydrogel
About 6% (w/v) oxi-HA with a volume of 8 ll and 2% (w/v), 4%
(w/v), 8% (w/v) ADH with a volume of 2 ll were sterilized by pas-
sage through a 0.22 lm filter. After NP cells were trypsinized and
centrifuged, an ADH solution was well mixed with cells first, and
then oxi-HA solution was added to form oxi-HA/ADH2, oxi-HA/
ADH4 and oxi-HA/ADH8 hydrogel in the inner well of microscopy
chamber (l-Slide, ibidi GmbH). After 3 days’ cultivation, cells in
hydrogel were stained with Live/Dead staining kit and observed
by fluoresce microscopy.
2.2.9. Gene expression analysis
Oxi-HA/ADH8 hydrogel contained NP cells with a volume of
0.2 ml were formed in cylinder mold at 37 °C for 10 min, and trans-
ferred into 24-well culture plate with 1.5 ml complete medium.
Moreover, alginate bead cultivation was also evaluated in the
study. Briefly, NP cells were mixed with 1.2% sterile alginate solu-
tion in 0.9% sodium chloride, which was then slowly added to a
102 mM CaCl2 solution drop-by-drop through a 22-gauge 1 ml syr-
inge [14]. Alginate beads were washed twice with 0.9% sodium
chloride solution and transferred into a 24-well culture plate with
1.5 ml complete medium in each well. Cell density for oxi-HA/
ADH8 hydrogel and alginate beads encapsulation was
2 106
cells ml1
and the medium was replaced every 3 days.
After 2 weeks’ cultivation, NP cells were collected for further anal-
ysis. Three repeats of the test groups were conducted.
The NP cells cultured in monolayer, oxi-HA/ADH8 hydrogel and
alginate bead groups were evaluated by real-time PCR for gene
expression analysis. Total RNA was extracted via RNeasy Mini kit
according to the manufacturer’s instructions. The concentration
of total RNA was quantified by a NanoDrop spectrophotometer
(ND-1000, Thermo) at 260 nm. The average OD260/OD280 ratio
3046 W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055

4. was between 1.5 and 2.0. Total RNA were amplified and reverse-
transcribed into cDNA by using the Superscript™ III First-Strand
Synthesis System. For real-time PCR, specific primers and probes
(Table 3) for rabbit Aggrecan, Collagen I, Collagen II, TGF-b,
MMP-3, MMP-9, and GAPDH were used. Relative mRNA quantity
was obtained by normalization of the result with housekeeping
gene GAPDH expression using the DDCt method. NP cells cultured
in three different environments, monolayer, oxi-HA/ADH8 hydro-
gel, and alginate beads, were evaluated using the Applied Biosys-
tems 7900 Real-Time PCR System (Life Technologies Corporation,
California, USA).
2.2.10. Morphology of oxi-HA/ADH hydrogel
The morphology of oxi-HA/ADH8 hydrogel was observed by
scanning electron microscopy (SEM) (Hitachi, Model S-2400, Ja-
pan). Lyophilized hydrogel was cooled in liquid nitrogen to en-
hance brittleness, and then quickly fractured to expose the
internal structure. Fractured samples were placed on double-sided
tape and sputter-coated with palladium and gold to a thickness of
100 Å before observation. SEM images were analyzed by Image J
software (http://rsb.info.nih.gov/ij/index.html).
2.2.11. Statistical analysis
Statistical analysis was conducted at least in triplicate, and the
results are reported as mean ± standard deviation (SD). Analysis of
variance (ANOVA) was used to evaluate the influence of oxi-HA/
ADH hydrogel on biocompatibility and gene expression of the NP
cells. The RQ Min/Max confidence of real-time PCR was set at
95.0%. Differences with P values less than 0.05 were considered
statistically significant.
3. Results
3.1. Characterization of oxi-HA and oxi-HA/ADH hydrogel
Dialdehyde groups were introduced on HA (Fig. 1) by reaction
with NaIO4, by opening the glucuronic acid ring and oxidizing
the proximal AOH groups. The oxidation proceeded in the dark
for 24 h, and the viscosity of oxi-HA solution was obviously de-
creased upon visual inspection. After dialysis and freeze-drying,
the FTIR spectrum (Fig. 2) was used to confirm the dialdehyde
groups; we found that there was a newly formed peak at
1730 cm1
which associates with the C@O stretch of oxi-HA. The
freeze-dried hydrogels of oxi-HA/ADH2, oxi-HA/ADH4, and oxi-
HA/ADH8 were also confirmed by FTIR, as Fig. 2 shows, with the
appearance of a new forming peak at 1584 cm1
associated with
the NAH function group of ADH. At the same time, the peak of
C@O stretch at (1730 cm1
) was seen to disappear due to the con-
sumption of aldehyde to form the imine bond between oxi-HA and
ADH. The overall chemical reaction of oxi-HA and oxi-HA/ADH is
shown in Fig. 1.
The TNBS assay, as described in Section 2, was employed to
determine the oxidation degree of oxi-HA due to the difficulty of
aldehyde group quantification. Series concentrations of t-BC were
used to establish the standard curve. The oxidation degree of
Fig. 1. (A) Chemical schematic of hyaluronic acid oxidation oxidated by sodium periodate; the newly formed aldehyde group is expressed as red color. (B) Chemical cross-
linking mechanism of oxi-HA/ADH hydrogel, with imines binding the formation between oxi-HA and ADH.
W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055 3047

5. oxi-HA was calculated by the amount of dialdehyde groups divided
into the repeating unit of HA. The degree of oxidation was about
44% and the yield of oxi-HA was approximately 80%.
3.2. Degradation and swelling ratio of oxi-HA/ADH hydrogel
On day 2, degradation percentages for oxi-HA/ADH2, oxi-HA/
ADH4, and oxi-HA/ADH8 hydrogel were 75 ± 4%, 7.5 ± 3%, and
13.9 ± 3%, respectively. Moreover, the swelling ratios (SR) of the
hydrogels on day 2 were 18.92 ± 0.22 (oxi-HA/ADH2), 12.28 ± 0.02
(oxi-HA/ADH4), and 12.90 ± 0.05 (oxi-HA/ADH8), as shown in
Fig. 3. Within 3 days, oxi-HA/ADH2 hydrogel was completely dis-
solved, and the swelling ratio was increased 2.6-fold as compared
with day 0. For oxi-HA/ADH4 hydrogel, the swelling ratio was in-
crease by 1.2-fold at day 10 and totally dissolved at day 14. The
swelling ratio of oxi-HA/ADH8 hydrogel was slightly increased at
week 5, and then maintained its gel-like state. However, the degra-
dation time of oxi-HA/ADH8 hydrogel was long enough for NP cells
to regenerate ECM. The oxi-HA/ADH8 hydrogel degraded slowly
after 4 weeks of incubation and achieved 40% degradation at
5 weeks.
3.3. Working ability, yield stress, and visco-elastic properties of oxi-
HA/ADH hydrogel
Evaluation of the working ability of oxi-HA/ADH hydrogel was
carried out using a HAAKE RheoStress 600 dynamic rheometer. All
measurements were taken under fixed frequency (1.0 Hz) and stress
(10 Pa). The results of gelling time were considered as the time
elapsed from liquid state to gel state, and the crossover point (called
the gel point) of G0
and G00
was defined as gel formation, as shown in
Fig. 4A. The gelling time of oxi-HA/ADH2, oxi-HA/ADH4, and oxi-HA/
ADH8 hydrogel are summarized in Table 1. The results suggest that
all types of oxi-HA/ADH hydrogel have the ability to maintain the li-
quid state at 4 °C for 3–8 min, depending on the concentration of
ADH in the hydrogel. Besides, the gelation time of oxi-HA/ADH
hydrogels at 37 °C were from 143 to 175 s, which means the oxi-
HA/ADH hydrogel will transform from liquid state into a gel-like ma-
trix within 3 min after injection into the human body.
The stress sweep model was used to evaluate the mechanical
properties of oxi-HA/ADH hydrogel. The yield stress of a material
is defined as a critical value of shear stress. The material is able re-
turn to its original shape if the applied force is smaller than the
yield stress (elastic deformation); otherwise, the deformation is
non-reversible when the applied force is larger than the yield
stress (plastic deformation). The turning point in Fig. 4B indicates
the yield stress of hydrogel. According to the results shown in Ta-
ble 1, we found that the yield stress was correlated with ADH con-
centration. The yield stress increase as the concentration of ADH in
oxi-HA/ADH hydrogel increases, especially in oxi-HA/ADH8 hydro-
gel (3732 Pa).
Fig. 2. FTIR Spectra of (A) hyaluronic acid, (B) oxidated hyaluronic acid, (C) ADH, (D)
oxi-HA/ADH2, (E) oxi-HA/ADH4, and (F) oxi-HA/ADH8.
Fig. 3. (A) Degradation percentage and (B) swelling ratio of oxi-HA/ADH2, oxi-HA/
ADH4, and oxi-HA/ADH8 hydrogels.
3048 W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055

6. Fig. 5 shows the visco-elastic properties of oxi-HA/ADH hydrogel
pre-cured at 37 °C for 30 min, and the results were expressed as G0
,
G00
, |G*|, |g*| and the d versus frequency (rad s1
). Raising the concen-
tration of ADH results in a 5-fold increase in the magnitude of com-
plex shear modulus |G*|, indicating the stiffer hydrogel forms at
higher concentration of ADH, and the frequency-dependent behav-
ior of |G*| and G0
of oxi-HA/ADH8 hydrogel is also observed in
Fig. 5A and B. Moreover, the storage modulus G0
is always larger than
the loss modulus G00
, suggesting the present hydrogels display a pre-
dominantly elastic-like behavior. The phase shift angle was smaller
than 45°, which indicated that the behavior of hydrogel is more elas-
tic-like than fluid-like. To compare the characteristic of oxi-HA/ADH
hydrogel with native nucleus pulposus tissue, the results of fre-
quency at 10 rad s1
are summarized in Table 1. The magnitudes of
|G*| of oxi-HA/ADH2, oxi-HA/ADH4 and oxi-HA/ADH8 hydrogel
were 5.16, 6.42, and 30.2 kPa, while 1.02°, 1.2°, and 17.32° repre-
sents the d results. According to Iatridis’s study [25], the |G*| and d
of native NP tissue were 11.3 kPa and 24° at fixed frequency
(10 rad s1
), comparing the present result with native NP tissue,
we found oxi-HA/ADH8 hydrogel was stiffer and more elastic. Be-
sides, the dynamic viscosities |g*| of oxi-HA/ADH2, oxi-HA/ADH4
and oxi-HA/ADH8 hydrogel were 0.52, 0.64, and 3.02 cP,
respectively.
3.4. Biocompatibility of oxi-HA/ADH hydrogel
Three days after cultivation of NP cells with extraction medium,
cell viability and cytotoxicity were evaluated by WST-8 and LDH
assay (Fig. 6). The WST-8 OD450nm of oxi-HA/ADH2, oxi-HA/
ADH4, and oxi-HA/ADH8 were 0.58 ± 0.03, 1.26 ± 0.07 and
1.17 ± 0.07, respectively. The extraction medium from oxi-HA/
ADH4 did not affect NP cell viability as compared with the control
or negative control, while oxi-HA/ADH2 and oxi-HA/ADH8 hydro-
gel extraction medium had a large (P = 2.76 106
) and slight
(P = 0.02) influence on the NP cell viability. Additionally, the cyto-
toxicity percentages of oxi-HA/ADH2, oxi-HA/ADH4, and oxi-HA/
ADH8 extraction medium were 43 ± 8%, 20 ± 7% and 7 ± 1%, indi-
vidually. Compared with the control and negative control group,
the cytotoxicity of NP cells cultured in oxi-HA/ADH2 extraction
medium was significantly increased (P = 0.008), while the cytotox-
icity of NP cells cultured in oxi-HA/ADH8 extraction medium was
significantly decreased (P = 0.001); there was no significant differ-
ence between oxi-HA/ADH4 extraction medium and the control/
negative control group (P = 0.89). From the cell viability and cyto-
toxicity results of oxi-HA/ADH2 hydrogel, we speculate the unre-
acted aldehydes of oxidized hyaluronic acid will release into the
extraction medium resulting in cytotoxicity to NP cell.
The Live/Dead staining kit utilizes two fluorescent dyes, calcein-
AM and ethidium homodimer (EthD-1). Calcein AM (a non-fluores-
cent molecule) can be hydrolyzed by intracellular esterases into
the highly negatively charged green fluorescent calcein in live cells.
EthD-1 is a high-affinity nucleic acid stain that is weakly fluorescent
until bound to DNA, yielding a bright red fluorescence in dead cells.
Nearly all the NP cells were viable in the oxi-HA/ADH4 and oxi-HA/
ADH8 groups, whereas lots of NP cells cultured with oxi-HA/ADH2
extraction medium were dead after 3 days’ cultivation (Fig. 7).
3.5. Fluorescence staining of NP cell encapsulated in oxi-HA/ADH
hydrogel
Cells encapsulated in oxi-HA/ADH hydrogel were also stained
with Live/Dead staining kit to qualitatively determinate the cell
Fig. 4. (A) Plot of G0
(elastic modulus) and G00
(loss modulus) versus time, with
gelling time determined by the crossover point of G0
and G00
(arrow). (B) Plot of G0
versus s (applied force) on oxi-HA/ADH2, oxi-HA/ADH4, and oxi-HA/ADH8
hydrogels.
Table 1
Rheological properties of oxi-HA/ADH hydrogel.
Sample Gelling timea
(s) G0
= G00b
(Pa) Yield stressc
(Pa) Visco-elastic propertiesd
4 °C 37 °C 4 °C 37 °C |G*| (kPa) G0
(kPa) G00
(kPa) d (°) |g*| (cP)
Oxi-HA/ADH2 180 175 580.9 410.3 436.3 5.16 5.16 0.09 1.02 0.52
Oxi-HA/ADH4 202 159 827.9 508.2 582.1 6.42 6.41 0.13 1.2 0.64
Oxi-HA/ADH8 492 143 534.6 387.9 3732 30.2 28.84 8.99 17.32 3.02
a
Gelling time of oxi-HA/ADH hydrogel was calculated by Rheo Win3 Data Manager at different temperature.
b
The value of elastic and viscous modulus at phase transition point.
c
The hydrogel was pre-cured at 37 °C for 45 min and the results were calculated by Rheo Win3 Data Manager.
d
Values are determined at 10 rad s1
with a controlled strain of c = 0.01 rad.
W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055 3049

7. viability. Most of the NP cells encapsulated in oxi-HA/ADH4 and
oxi-HA/ADH8 hydrogel were viable (Fig. 7B). However, a few NP
cells died due to the chemical reactivity of C@O functional group,
producing red fluorescence.
3.6. mRNA gene expression of NP cells
In order to further evaluate the metabolism and catabolism of NP
cells cultured in oxi-HA/ADH hydrogel, a real-time PCR analysis was
performed following 14 days of cultivation. Because the degradation
time of oxi-HA/ADH2 and oxi-HA/ADH4 is not long enough for fur-
ther clinical application (oxi-HA/ADH2 hydrogel was totally de-
graded within 3 days and oxi-HA/ADH4 hydrogel was totally
degradedwithin10 days),weonly evaluatedthe mRNAgene expres-
sion of NP cells on oxi-HA/ADH8 hydrogel. The alginate bead culture
system was chose as a control group for the 3D culture system due to
its diversity of research applications, and a 2D culture system
(monolayer) was also included in the evaluation. Aggrecan
(2.138 ± 0.17) and type II collagen (2.685 ± 0.22) gene expression
of NP cells cultivated in oxi-HA/ADH8 hydrogel were significant in-
creased as compared with those cultivated in alginate beads
(Fig. 8A), and MMP-9 (0.160 ± 0.10) (Fig. 8C) gene expression was
also up-regulated in oxi-HA/ADH8 hydrogel. However, there was
no significant difference between the oxi-HA/ADH8 hydrogel and
alginate bead groups for type I collagen (oxi-HA/ADH hydrogel:
1.330 ± 0.38; alginate beads: 1.520 ± 0.19, P 0.05) (Fig. 8A),
TGF-b (oxi-HA/ADH hydrogel: 0.615 ± 0.12; alginate beads:
0.772 ± 0.11, P 0.05) (Fig. 8B), and MMP-3 (oxi-HA/ADH hydrogel:
0.447 ± 0.13; alginate beads: 0.571 ± 0.06, P 0.05) (Fig. 8C) mRNA
gene expression. Importantly, the cultivation environment had
an influence on mRNA gene expression of cells. A 3D culture
environment was observed to increase aggrecan (1.613–2.138
log(relative quantity)) and type II (2.212–2.685 log(relative quantity)), and
decrease type I collagen (1.520 to 1.330 log(relative quantity)) gene
expression of rabbit NP cells. The gene expression of TGF-b (0.615–
0.772 log(relative quantity)), MMP-3 (0.447–0.571 log(relative quantity)),
and MMP-9 (0.391–0.610 log(relative quantity)) was also enhanced in
3D culture conditions. GAPDH was used as an mRNA endogenous
control.
3.7. SEM morphology
The oxi-HA/ADH8 hydrogels were pre-formed, freeze-dried,
and then fractured to observe the cross-section after liquid nitro-
gen immersion. However, the morphology under SEM observation
is not the real structure of the hydrogel because of the freeze-dry-
ing process. The freezing temperature will greatly influence the
pore numbers and the pore size of the hydrogel because of the
ice nuclei formation [15]. In order to preserve better morphology,
the hydrogel were frozen under 80 °C before freeze-drying.
Fig. 9A and B shows the SEM morphology of oxi-HA/ADH8 hydro-
gel on different scales. Oxi-HA and ADH were able to cross-link
with each other and form porous structures inside the hydrogel.
Interconnecting pores were conspicuously observed in the hydro-
gel matrix with an average pore size of 31.5 lm. NP cells were
encapsulated in the inter-pores of oxi-HA/ADH8 hydrogel, as
0
10
20
30
40
50
60
100
10
1
|G*|
(kPa)
Frequency (rad/s)
oxi-HA/ADH2
oxi-HA/ADH4
oxi-HA/ADH8
0
10
20
30
40
50
60
100
10
1
G',
G
(kPa)
Frequency (rad/s)
oxi-HA/ADH2, G' oxi-HA/ADH4, G' oxi-HA/ADH8, G'
oxi-HA/ADH2, G oxi-HA/ADH4, G oxi-HA/ADH8, G
0
4
8
12
16
20
24
100
10
1
(degrees
)
Frequency (rad/s)
oxi-HA/ADH2
oxi-HA/ADH4
oxi-HA/ADH8
0
2
4
6
8
10
12
14
16
100
10
1
|
*|
(cP)
Frequency (rad/s)
oxi-HA/ADH2
oxi-HA/ADH4
oxi-HA/ADH8
A C
B D
Fig. 5. (A) Plot of |G*| (complex shear modulus) versus frequency (x = 1–100 rad s1
). (B) Plot of G0
(storage modulus) and G00
(loss modulus) versus frequency (x = 1–
100 rad s1
). (C) Plot of d (phase shift angle) versus frequency (x = 1–100 rad s1
). (D) Plot of |g*| (complex viscosity) versus frequency (x = 1–100 rad s1
).
3050 W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055

8. Fig. 9C shows. The interconnecting pores are suitable for cell sur-
vival in a 3D environment and are beneficial for nutrient and
waste transportation.
4. Discussion
Cell-based therapy for nucleus pulposus regeneration is cur-
rently considered one of the most promising approaches to restore
disc degeneration. Because nucleus pulposus cells could change
their phenotype after 2D environment cultivation [16,17], such re-
search in cell-based therapy is concentrated on the development of
natural or synthetic 3D polymeric scaffolds [18–21].
Some research [4,20,22] has demonstrated the merits of pre-
formed scaffold application in vitro. However, the operation is
very complicated in clinical surgery, and the implanted scaffold
may migrate. An injectable hydrogel could overcome these prob-
lems. A surgeon could mix therapeutic agents with the liquid
state solution and inject it through a small surgery called micro-
discectomy. The hydrogels with a solution–gel transformation
property could completely fill the degeneration area, decrease
the risk of migration, and lessen the infection opportunity in
the wound site. In the present study, we successfully developed
an in situ cross-linking oxi-HA/ADH hydrogel by simply mixing
oxidized hyaluronic acid with adipic acid dihydrazide solution.
The aldehyde functional group on hyaluronic acid was created
by sodium peroxidate, which is well known in its role as an oxi-
dizing agent, cleaving the C2AC3 hydroxyl groups of vicinal diol
to form a dialdehyde which was analyzed by FTIR (peak at
1730 cm1
), as shown in Fig 2. The dialdehyde of oxidized hyalu-
ronic acid could react with the hydrazide group of adipic acid
dihydrazide to form intermolecular networks in oxi-HA/ADH
hydrogel.
The concentration of adipic acid dihydrazide in oxi-HA/ADH
hydrogel may influence the cross-linking density (hydrazone
bonds), and further affect the degradation time of hydrogel. Hydro-
gels with a higher concentration of ADH tend to hydrolyze slower
than those with lower concentrations. According to mass remain-
ing results, the oxi-HA/ADH8 hydrogel can maintain the gel-like
matrix for at least 5 weeks, with the hydrogel degrading gradually
from week 4. In addition, the swelling ratio can increase approxi-
mately 1.5–2.6 times during the period of hydrogel degradation.
For clinical applications, the working ability is very important
to the surgeon and patient. The operation time should be long
enough for the surgeon to inject the liquid form solution into
the human body. Additionally, the time for gel transformation
should be as short as possible in order to shorten the waiting
time for the patient and prevent extrusion of hydrogel. We
accomplished the working ability evaluation using a dynamic
rheometer. The parameters of frequency (1.0 Hz) and stress
(10 Pa) were fixed, both of which were within the linear visco-
elastic range of oxi-HA/ADH hydrogels. G0
(storage modulus)
and G00
(loss modulus) were two mathematical descriptions of
the behavior of material. In the liquid state, the value of G00
was higher than G0
, and as the formation of intermolecular net-
works increased, the value of G0
also increased. The crossover
point of G0
and G00
, where G0
is equal to G00
, is defined as the state
of gel formation [23,24]. Therefore, the gelation time of the
material was measured accurately by the software. In the re-
search of Vervoort et al. [24], the gelling time for inulin acrylate
derivatives was about 16 min, and a faster gelling time could be
accomplished by increasing the concentrations of free radical ini-
tiators. In addition, in the research of De Smedt et al. [23], the
gelling time of dextran-acrylate derivatives was about 5 min. In
our study, the oxi-HA/ADH in situ cross-linking hydrogel could
be maintained in the liquid state for 8 min, and immediately
transformed into a gel-like matrix within 3 min, as Table 1
shows. The magnitudes of complex shear modulus |G*| and
phase shift angle d of various native tissues and polymers were
summarized in Table 2 [25–36]. The |G*| of native NP, annulus
fibrosus, and articular cartilage are 11.3, 540, and 440 kPa,
respectively. The complex shear modulus |G*| of hyaluronan
[31], Hyal50% [28], cross-linked HA developed by the Leach
group (GMHA) [32], and the Dana group [33] (HA-MA) are much
smaller than native nucleus pulposus tissue, and the values of
|G*| are 0.09, 0.019, 0.16, and 0.3 kPa, respectively. The complex
shear modulus of amidic alginate hydrogel (16 kPa) developed by
the Gemma group [36] is quite close to the native nucleus pul-
posus tissue (11.3 kPa). The values of complex shear modulus
|G*| in the current study were from 5 to 30 kPa depending on
ADH concentration. Although the developed hydrogel oxi-HA/
ADH8 is slightly stiffer than native NP, we speculate that the
high elasticity and stiffness are of benefit for NP tissue to resist
the pressure and tolerance of the twisting of the spine.
An appropriate material sterilization method is another consid-
eration for future clinical application. Among the various steriliza-
tion methods, the simplest method is passage through a 0.22 lm
filter. It is not easy for native hyaluronic acid (HA) to pass through
a 0.22 lm filter due its high viscosity, but the viscosity significantly
decreases after the oxidation process. For the developed oxi-HA/
Fig. 6. Cell viability evaluated by (A) WST-8 and cytotoxicity measured by (B) LDH
assay of NP cells cultivated with various extraction media including control,
positive control (containing 0.1% Triton-X), negative control (extracted by Al2O3
beads), oxi-HA/ADH2, oxi-HA/ADH4, and oxi-HA/ADH8 hydrogel.
W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055 3051

9. ADH hydrogel, we were able to sterilize oxi-HA and ADH solutions
by passage through the 0.22 lm filter separately.
Nucleus pulpous (NP) were taken from the spines of 6-month-
old rabbits; the rabbit NP at this age contains both notochoral
and NP cells [37]. According to the study of Preradovic, human
NP tissue passages for 2–4 times, and no functional changes occur
in monolayer cultured (no further reduction of mRNA levels for CII
and AGG) [38]. Because of the number limitation of rabbit NP cell,
we passage cells for six times to obtain the sufficient cell number
for further analysis. In the present study of gene expression, the re-
sults show that the NP cell still has its function to express extracel-
lular matrix (ECM) related gene. Biocompatibility was evaluated on
two aspects, cell viability and cytotoxicity, according to ISO stan-
dard. Some toxicity was observed for the oxi-HA/ADH2 hydrogel,
and this may be due to unreacted aldehyde. The ratio of aldehyde
on oxi-HA to ANH2 groups on ADH is about 2–1. All of the func-
tional groups of ADH react with oxi-HA, and the rest of the alde-
hydes on oxi-HA might react with NP cells, leading to the
reduction of cell viability and the enhancement of cytotoxicity.
However, we did not find any toxicity evidence for oxi-HA/ADH4
and oxi-HA/ADH8 hydrogel, according to WST-8 (Fig. 6A) and
LDH (Fig. 6B) assays and fluorescence image (Fig. 7A). From fluo-
rescence staining of 3D oxi-HA/ADH hydrogel contained cell, only
few cells died during the gelation process because of the chemical
Fig. 7. Live/Dead staining of NP cells on day 3 observed by fluoresce microscopy. (A) Cells were treated with different extraction media including Al2O3 extraction medium
(negative control), 0.1% Triton-XÒ
contained medium (positive control), oxi-HA/ADH2 extraction medium, oxi-HA/ADH4 extraction medium, and oxi-HA/ADH8 extraction
medium. (B) Cells were encapsulated in oxi-HA/ADH4 and oxi-HA/ADH8 hydrogel.
Fig. 8. Gene expression of rabbit NP cells cultivated in monolayer, oxi-HA/ADH8 hydrogel, and alginate beads including: (A) anabolism-related genes: COL I, COL II, and AGG;
(B) TGF-b; (C) catabolism-related genes: MMP-3 and MMP-9.
3052 W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055

10. reactivity of aldehyde on oxi-HA. Most of cells were viable in oxi-
HA/ADH hydrogel (Fig. 7B).
For further understanding of the molecular mechanism of
mRNA expression of NP cells cultured in oxi-HA/ADH8 hydrogel,
we used real-time PCR to quantify a series of gene expression.
Aggrecan and type II collagen are the major extracellular matrix
(ECM) components of the nucleus pulposus. Aggrecan can aid the
nucleus in resisting compressive loads due to its highly negatively
charge nature, and collagen is believed to help the nucleus pulpo-
sus to resist swelling. The types of collagen in nucleus pulposus
change from type II to type I when disc degeneration occurs [39].
Monolayer culture for expansion also influences the collagen and
aggrecan mRNA expressions of NP cell, as shown in Torsten Kluba’s
research [17].
In the present study, type II collagen and aggrecan gene expres-
sion were significantly up-regulated in a 3D culture system (algi-
nate beads and oxi-HA/ADH8) as compared with monolayer
cultivation after 2 weeks cultivation. NP cells cultured in oxi-HA/
ADH8 hydrogel were able to synthesize more type II collagen and
aggrecan mRNA (P 0.05) as compared with those in alginate
beads. The degradation time of oxi-HA/ADH8 hydrogel is longer
than 5 weeks, as shown in Fig. 3A; the time is sufficient for NP cell
to restore specific function in in vitro study. The matrix metallo-
proteinase (MMP) group is another group of genes that was inves-
tigated. MMP plays a major role in catabolism, which could
degrade the ECM into small fragments, or degrade the denatured
molecules. MMP-3 is involved in the destruction of non-collage-
neous proteins (such as proteoglycans) and degraded denatured
collagen [40]. MMP-9 could break down basement membrane col-
lagen and also denatured collagen molecules [41]. RT-PCR results
showed that a 3D environment may enhance MMP-3 and MMP-9
synthesis of NP cells. We speculate that this might be associated
with anabolism of the extracellular matrix (ECM). In addition, the
MMP-9 expression is slightly higher in oxi-HA/ADH8 as compared
with alginate beads. This upregulation of MMP-9 expression might
contribute to the collagen synthesis of NP cells cultured in oxi-HA/
ADH8 hydrogel. Some researches suggest that small molecular
weight HA fragments (six saccharides) could induce NO and MMPs
production in chondrocytes [42,43]. According to Robert Stern’s re-
view [44], high-molecular-mass hyaluronan (HA) (4 102
–
2 104
kDa) can exclude other molecules and cells, and have abil-
ity to achieve anti-inflammatory and immunosuppressive effect.
Fig. 9. SEM morphology of lyophilized oxi-HA/ADH8 hydrogel after brief fixation and serial dehydration; the connective pores are clearly shown in (A) at 200 and (B) at
500. (C) Rabbit NP cells were encapsulated in the pores within oxi-HA/ADH8 hydrogel.
Table 2
Complex shear modulus of native tissues and polymers.
Component |G*| (kPa)a
d (°) Reference
Nucleus pulposus NA 11.3 24 25
Anulus fibrosusb
NA 540 NA 26
Articular cartilage NA 440 13 27
Hyal50% 10 mg ml1
0.019 20.56 28
Collagen–proteoglycan mixture Coll:PG = 28:9 0.04 60 29
Elastin-like polypeptide (ELP) 324 mg ml1
0.08 NA 30
Hyaluronan 20 mg ml1
in PBS 0.09 NA 31
GMHA 1% w/v 0.109–0.154 NA 32
HA-MA 1.5% w/v 0.3 1.1 33
Alginate 2% in 0.15 M NaCl and 1.8 mM CaCl2 2.31 3 34
Cross-linked ELP 50 mg ml1
(ELP[KV6-112]), 37 °C 3 6.5 35
Amidic alginate hydrogel 1% in distilled water 16 19.7 36
Oxi-HA/ADH8 hydrogel 6% (w/v) HA with 8% (w/v) ADH 30 17.3 Present study
a
Values are determined at 10 rad s1
.
b
Tissue was tested at a frequency of 628 rad s1
.
Table 3
Specific primer sequences of rabbit used in real-time PCR.
Assay ID Forward primer
Reverse primer
GeneBank Accession No.
AGGRECAN GCCTGCGCTCCAATGACT
CTCAAGGCCGTGCATCAC
D49399
COLLAGENI GGAGCACCTGGTCCTCAAG
AGCAGGGCCAGGTTCAC
AF027122
COLLAGENII CGAGATCCCCTTCGGAGAGT
GCAGTGGCGAGGTCAGT
L38480
TGF-b1 AGGACCTGGGCTGGAAGT
GGCAGAAGTTGGCGTGGTA
AF000133
MMP-3 AAACTCTTCCAACCCTGCTACTG
TCCCTTGAGGCTCCATCCA
M25664
MMP-9 CTCGTGCTGGGCTGTTG
TCTCAGCTCTCCTGGGAAGAC
R86523
GAPDH GCGTCTTCACCACCATGGA
GGCTGAGATGATGACCCTTTTGG
L23961
W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055 3053

11. Medium molecular weight HA fragments in the range of 1000–
1250 (200–250 kDa) are potent stimulators of inflammatory cyto-
kine and associated with inflammatory reaction [45]. In the pres-
ent study, the average molecular weight of HA we used is about
300 kDa, such type of HA might have the chance to induce inflam-
matory response, although there is no research to indicate that
300 kDa HA could induce inflammatory response in NP culture.
Based on cellular metabolism results, we suggest that the in situ
cross-linking oxi-HA/ADH hydrogel could aid monolayer cultured
NP cells in restoring their functions.
5. Conclusion
Cell-based therapy is a novel biological treatment for tissue
regeneration, and the cell carrier plays an important role in cell-
based therapy. However, finding a suitable cell carrier is not an
easy task. In the study, we propose a method to prepare the inject-
able in situ cross-linking hydrogel, oxi-HA/ADH, as a NP cell carrier.
The oxi-HA/ADH hydrogel can be prepared in a liquid form at room
temperature and simply injected into the degeneration or treated
site through small gauge needles. The results of biodegradation
studies showed that the oxi-HA/ADH8 hydrogel was able to main-
tain its gel matrix in a PBS-rich environment for at least 35 days to
allow for ECM synthesis. Additionally, the oxi-HA/ADH8 hydrogel
was biocompatible with NP cells and allowed the promotion of
gene expression of aggrecan and type II collagen, which are the
major ECM components of NP cells. These results suggest that
the injectable hydrogel could be a suitable cell carrier for NP cells
in the treatment of nucleus pulposus degeneration.
Acknowledgements
The authors thank Dr. Sung-Ching Chen at ITRI for the use of the
HAKKE rheometer and the Department of Medical Research in
NTUH for the use of the NanoDrop and Applied Biosystems 7900
Real-Time PCR System.
Appendix A. Figures with essential colour discrimination
Certain figures in this article, particularly Figures 1 and 7, are
difficult to interpret in black and white. The full colour images
can be found in the on-line version, at doi:10.1016/j.actbio.
2010.02.037.
References
[1] Anderson DG, Tannoury C. Molecular pathogenic factors in symptomatic disc
degeneration. Spine J 2005;5:S260–6.
[2] Andersson GB. Epidemiological features of chronic low-back pain. Lancet
1999;354(9178):581–5.
[3] Leino PI, Berg MA, Puska P. Is back pain increasing? results from national surveys
in Finland during 1978/9–1992. Scand J Rheumatol 1994;23(5):269–76.
[4] Bressler HB, Keyes WJ, Rochon PA, Badley E. The prevalence of low back pain in
the elderly: a systematic review of the literature. Spine 1999;24(17):1813–9.
[5] Larson 3rd JW, Levicoff EA, Gilbertson LG, Kang JD. Biologic modification of
animal models of intervertebral disc degeneration. J Bone Joint Surg Am
2006;88:83–7.
[6] Tibrewal SB, Pearcy MJ. Lumbar intervertebral disc heights in normal subjects
and patients with disc herniation. Spine 1985;10(5):452–4.
[7] Ray CD. The PDNÒ
prosthetic disc-nucleus device. Eur Spine J
2002;11(2):S137–42.
[8] Allen MJ, Schoonmaker JE, Bauer TW, Williams PF, Higham PA, Yuan HA.
Preclinical evaluation of a poly(vinyl alcohol) hydrogel implant as a
replacement for the nucleus pulposus. Spine 2004;29(5):515–23.
[9] Di Martino A, Vaccaro AR, Lee JY, Denaro V, Lim MR. Nucleus pulposus
replacement: basic science and indications for clinical use. Spine
2005;30(16S):S16–22.
[10] Ahrens M, Tsantrizos A, Donkersloot P, Martens F, Lauweryns P, Le Huec JC,
et al. Nucleus replacement with the DASCOR disc arthroplasty device: interim
2-year efficacy and safety results from two prospective, non-randomized
multicenter European studies. Spine 2009;34(13):1376–84.
[11] Thompson JP, Oegema TR, Bradford DS. Stimulation of mature canine
intervertebral disc by growth factors. Spine 1991;16(3):253–60.
[12] Bulpitt P, Aeschlimann D. New strategy for chemical modification of
hyaluronic acid: preparation of functionalized derivatives and their use in
the formation of novel biocompatible hydrogels. J Biomed Mater Res
1999;47(2):152–69.
[13] International Standardization Organization. Biological evaluation of medical
devices. Part 5. Test for cytotoxicity: in vitro methods. ISO 10993-5; 1992.
[14] Wang JY, Baer AE, Kraus VB, Setton LA. Intervertebral disc cells exhibit
differences in gene expression in alginate and monolayer culture. Spine
2001;26(16):1747–51.
[15] Chen KS, Ku YA, Lin HR, Yan TR, Sheu DC, Chen TM, et al. Preparation and
characterization of pH sensitive poly(N-vinyl-2-pyrrolidone/itaconic acid)
copolymer hydrogels. Mater Chem Phys 2005;91(2–3):484–9.
[16] Horner HA, Roberts S, Bielby RC, Menage J, Evans H, Urban JP. Cells from
different regions of the intervertebral disc: effect of culture system on matrix
expression and cell phenotype. Spine 2002;27(10):1018–28.
[17] Kluba T, Niemeyer T, Gaissmaier C, Gründer T. Human anulus fibrosis and
nucleus pulposus cells of the intervertebral disc: effect of degeneration and
culture system on cell phenotype. Spine 2005;30(24):2743–8.
[18] Mwale F, Iordanova M, Demers CN, Steffen T, Roughley P, Antoniou J. Biological
evaluation of chitosan salts cross-linked to genipin as a cell scaffold for disk
tissue engineering. Tissue Eng 2005;11(1–2):130–40.
[19] Stern S, Lindenhayn K, Schultz O, Perka C. Cultivation of porcine cells from the
nucleus pulposus in a fibrin/hyaluronic acid matrix. Acta Orthop Scand
2000;71(5):496–502.
[20] Alini M, Li W, Markovic P, Aebi M, Spiro RC, Roughley PJ. The potential and
limitations of a cell-seeded collagen/hyaluronan scaffold to engineer an
intervertebral disc-like matrix. Spine 2003;28(5):446–54.
[21] Masuda K, Takegami K, An H, Kumano F, Chiba K, Andersson GB, et al.
Recombinant osteogenic protein-1 upregulates extracellular matrix
metabolism by rabbit annulus fibrosus and nucleus pulposus cells cultured
in alginate beads. J Orthop Res 2003;21(5):922–30.
[22] Rong Y, Sugumaran G, Silbert JE, Spector M. Proteoglycans synthesized by
canine intervertebral disc cells grown in a type I collagen–glycosaminoglycan
matrix. Tissue Eng 2002;8(6):1037–47.
[23] De Smedt SC, Lauwers A, Demeester J, Van Steenbergen MJ, Hennink WE, Roefs
SPFM. Characterization of the network structure of dextran glycidyl
methacrylate hydrogels by studying the rheological and swelling behavior.
Macromolecules 1995;28(14):5082–8.
[24] Vervoort L, Vinckier I, Moldenaers P, Mooter GVD, Augustijns P, Kinget R.
Inulin hydrogels as carriers for colonic drug targeting. Rheological
characterization of the hydrogel formation and the hydrogel network. J
Pharm Sci 1999;88(2):209–14.
[25] Iatridis JC, Weidenbaum M, Seton LA, Mow VC. Is the nucleus pulposus a solid
or a fluid? Mechanical behaviors of the nucleus pulposus of the human
intervertebral disc. Spine 1996;10:1174–84.
[26] Bodine AJ, Ashany D, Hayes WC, White AA. Viscoelastic shear modulus of the
human intervertebral disc. Transactions of the 28th annual meeting of the
orthopaedic research society, vol. 7; 1982. p. 237.
[27] Setton LA, Mow VC, Howell DS. Mechanical behavior of articular cartilage in
shear is altered by transection of the anterior cruciate ligament. J Orthop Res
1995;12:437–82.
[28] Barbucci R, Lamponi S, Borzacchiello A, Ambrosio L, Fini M, Torricelli P, et al.
Hyaluronic acid hydrogel in the treatment of osteoarthritis. Biomaterials
2002;23(23):4503–13.
[29] Zhu W, Iatridis JC, Hlibczuk V, Ratcliffe A, Mow VC. Determination of collagen–
proteoglycan interactions in vitro. J Biomech 1996;29:773–83.
[30] Betre H, Setton LA, Meyer DE, Chilkoti A. Characterization of a genetically
engineered elastin-like polypeptide for cartilaginous tissue repair.
Biomacromolecules 2002;3:910–6.
[31] Zhu W, Mow VC, Rosenberg LC, Tang LH. Determination of kinetic changes of
aggrecan–hyaluronan interactions in solution from its rheological properties. J
Biomech 1994;27:571–9.
[32] Leach JB, Bivens KA, Patrick J, Schmidt CE. Photocrosslinked hyaluronic acid
hydrogels: natural, biodegradable tissue engineering scaffolds. Biotechnol
Bioeng 2003;82:578–89.
[33] Nettles DL, Vail TP, Morgan MT, Grinstaff MW, Setton LA. Photocrosslinkable
hyaluronan as a scaffold for articular cartilage repair. Annu Rev Biomed Eng
2004;32(3):391–7.
[34] LeRoux MA, Guilak F, Setton LA. Compressive and shear properties of alginate
gel: effects of sodium ions and alginate concentration. J Biomed Mater Res
1999;47:46–53.
[35] Trabbic-Carlson K, Setton LA, Chilkoti A. Swelling and mechanical behaviors of
chemically cross-linked hydrogels of elastin-like polypeptides.
Biomacromolecules 2003;4:572–80.
[36] Leone G, Torricelli P, Chiumiento A, Facchini A, Barbucci R. Amidic alginate
hydrogel for nucleus pulposus replacement. J Biomed Mat Res A
2007;84(2):391–401.
[37] Braund KG, Ghosh P, Taylor TK, et al. Morphological studies of the canine
intervertebral disc: the assignment of the beagle to the achondroplastic
classification. Res Vet Sci 1975;19:167–72.
[38] Preradovic A, Kleinpeter G, Feichtinger H, Balaun E, Krugluger W. Quantitation
of collagen I, collagen II and aggrecan mRNA and expression of the
corresponding proteins in human nucleus pulposus cells in monolayer
cultures. Cell Tissue Res 2005;321:459–64.
3054 W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055

12. [39] Hoogendoorn R, Doulabi BZ, Huang CL, Wuisman PI, Bank RA, Helder MN.
Molecular changes in the degenerated goat intervertebral disc. Spine
2008;33(16):1714–21.
[40] Weiler C, Nerlich AG, Zipperer J, Bachmeier BE, Boos N. 2002 SSE Award
Competition in Basic Science: expression of major matrix metalloproteinases
is associated with intervertebral disc degradation and resorption. Eur Spine J
2002;11(4):308–20.
[41] Roberts S, Caterson B, Menage J, Evans EH, Jaffray DC, Eisenstein SM. Matrix
metalloproteinases and aggrecanase: their role in disorders of the human
intervertebral disc. Spine 2000;25(23):3005–13.
[42] Knudson CB, Knudson W. Hyaluronan and CD44: modulators of chondrocyte
metabolism. Clin Orthop Relat Res 2004;427(Suppl.):S152–62.
[43] Knudson W, Knudson CB. The hyaluronan receptor CD44, an update. Available from:
http://www.glycoforum.gp.jp/science/hyaluronan/HA10a/HA10a.html; 2004.
[44] Robert S, Akira AA, Kazuki NS. Hyaluronan fragments: an information-rich
system. Eur J Cell Biol 2006;85(8):699–715.
[45] Noble PW, Lake FR, Henson PM, Riches DW. Hyaluronate activation of CD44
induces insulin-like growth factor-1 expression by a tumor necrosis factor
alpha-dependent mechanism in murine macrophages. J Clin Invest
1993;91:2368–77.
W.-Y. Su et al. / Acta Biomaterialia 6 (2010) 3044–3055 3055