For the following DNA sequence, write the DNA sequence of another in.pdf

•

0 likes•3 views

For the following DNA sequence, write the DNA sequence of another individual that would have an alternative allele for i) a SNP and ii) for an Indel. ATTGGCGCTAAGGGCATAGCGTAAT TAACCGCGATTCCCGTATCGCATTA Solution ATTGGCGCTAAGGGCATAGCGTAAT TAACCGCGATTCCCGTATCGCATTA The reading frame is AN SNP substitiution of A with G will cause an SNP where the aminoacid is converted from Isoleucine to Metheonine A DELETION of the third nucleotide T will shift the reading frame.

Education

Determine if the following series or improper integrals are convergent or divergent: Solution Here is a complex-analytic proof. For zD=C{0,1}, let R(z)=1log2z where the sum is taken over all branches of the logarithm. Each point in D has a neighbourhood on which the branches of log(z) are analytic. Since the series converges uniformly away from z=1, R(z)is analytic on D. Now a few observations: (i) Each term of the series tends to 0 as z0. Thanks to the uniform convergence this implies that the singularity at z=0 is removable and we can set R(0)=0. (ii) The only singularity of R is a double pole at z=1 due to the contribution of the principal branch of logz. Moreover, limz1(z1)2R(z)=1. (iii) R(1/z)=R(z). By (i) and (iii) R is meromorphic on the extended complex plane, therefore it is rational. By (ii) the denominator of R(z) is (z1)2. Since R(0)=R()=0, the numerator has the form az. Then (ii) implies a=1, so thatR(z)=z(z1)2. Now, setting z=e2iw yieldsn=1(wn)2=2sin2(w) down vote Here is a complex-analytic proof. For zD=C{0,1}, let R(z)=1log2z where the sum is taken over all branches of the logarithm. Each point in D has a neighbourhood on which the branches of log(z) are analytic. Since the series converges uniformly away from z=1, R(z)is analytic on D. Now a few observations: (i) Each term of the series tends to 0 as z0. Thanks to the uniform convergence this implies that the singularity at z=0 is removable and we can set R(0)=0. (ii) The only singularity of R is a double pole at z=1 due to the contribution of the principal branch of logz. Moreover, limz1(z1)2R(z)=1. (iii) R(1/z)=R(z). By (i) and (iii) R is meromorphic on the extended complex plane, therefore it is rational. By (ii) the denominator of R(z) is (z1)2. Since R(0)=R()=0, the numerator has the form az. Then (ii) implies a=1, so thatR(z)=z(z1)2. Now, setting z=e2iw yieldsn=1(wn)2=2sin2(w) which implies thatk=01(2k+1)2=28, and the identity (2)=2/6 follows..

Define the yield to maturity.SolutionYTM is the discount rate .pdf

fashiondestinationld

CPU has an ArithmeticLogic Unit (ALU). Which are true for ALUSel.pdf

fashiondestinationld

a) How many bit strings of length 6 are there which contain at least.pdf

fashiondestinationld

A group of legislators wanted to look at factors that affect the num.pdf

fashiondestinationld

A group of legislators wanted to look at factors that affect the number of traffic fatalities. They collected some data for 1992 from the National Transportation Safety Board on the number of fatalities for 50 states and the District of Columbia (DC), the number of licensed drivers, the number of registered vehicles, and the number of vehicle miles traveled. Select the Number of Traffic Fatalities as the dependent variable and the Number of licensed drivers (in thousands), the Number of Registered Vehicles (in thousands) and the Number of Vehicle Miles Traveled (in millions) as independent variables. Suppose there was a state with the following values of the independent variables: Number of Licensed Drivers (in thousands) = 3,600, Number of Registered Vehicles (in thousands) = 4,200 and Number of Vehicle Miles Traveled (in millions) = 46,000. Determine and interpret the predicted value of the number of traffic fatalities. State Traffic Fatalities Vehicle Miles Traveled (millions) Licensed Drivers (thousands) Registered Vehicles (thousands) AL 1083 48956 3102 3422 AK 85 4150 443 508 AZ 903 38774 2879 3920 AR 610 24948 1770 1560 CA 4226 271943 20201 21980 CO 585 33705 2620 3144 CT 310 27138 2012 2638 DE 112 7025 512 672 DC 100 3448 366 189 FL 2860 121989 10691 10132 GA 1426 82822 4666 4725 HI 122 7935 791 781 ID 361 11652 779 1173 IL 1554 92316 7029 7692 IN 974 62108 3834 4850 IA 478 25737 1921 3920 KS 442 24678 1794 1965 KY 409 39822 2109 2615 LA 838 37430 2606 7261 ME 201 12469 916 1071 MD 651 44165 3311 2930 MA 440 46990 4209 3956 MI 1419 85183 6819 7599 MN 644 43317 2668 3869 MS 791 28548 1659 2056 MO 1089 57288 3512 4179 MT 202 9116 536 967 NE 271 15466 1102 1490 NV 294 13019 987 983 NH 119 10501 878 1013 NJ 890 60466 5521 5752 NM 447 20480 1162 1472 NY 1782 112970 10444 10428 NC 1431 71928 4779 5462 ND 88 6338 443 687 OH 1371 98200 7722 9647 OK 687 36980 2363 2863 OR 490 29453 2401 2748 PA 1190 92347 8146 8557 RI 63 7095 682 728 SC 847 37245 2458 2764 SD 154 7631 512 845 TN 1214 54524 3583 5150 TX 3186 178348 12012 13287 UT 342 18078 1203 1381 VT 77 6152 435 502 VA 930 67609 4631 5593 WA 638 47428 3741 4654 WV 356 17112 1317 1375 WI 712 50273 3542 4044 WY 144 6689 354 583 State Traffic Fatalities Vehicle Miles Traveled (millions) Licensed Drivers (thousands) Registered Vehicles (thousands) AL 1083 48956 3102 3422 AK 85 4150 443 508 AZ 903 38774 2879 3920 AR 610 24948 1770 1560 CA 4226 271943 20201 21980 CO 585 33705 2620 3144 CT 310 27138 2012 2638 DE 112 7025 512 672 DC 100 3448 366 189 FL 2860 121989 10691 10132 GA 1426 82822 4666 4725 HI 122 7935 791 781 ID 361 11652 779 1173 IL 1554 92316 7029 7692 IN 974 62108 3834 4850 IA 478 25737 1921 3920 KS 442 24678 1794 1965 KY 409 39822 2109 2615 LA 838 37430 2606 7261 ME 201 12469 916 1071 MD 651 44165 3311 2930 MA 440 46990 4209 3956 MI 1419 85183 6819 7599 MN 644 43317 2668 3869 MS 791 28548 1659 2056 MO 1089 57288 3512 4179 MT 202 9116 536 967 NE 271 15466 1102 1490 NV 294 13019 987 983 N.

6. Why might The Home Depot and Lowes choose such odd dates to end.pdf

fashiondestinationld

6. Why might The Home Depot and Lowe\'s choose such odd dates to end their fiscal years? Solution The reasons are few: 1. The sales are less in january when compared to december so they can more focus on financial statements In december the burden will be more and to focus at a time on sales and preparing financial statements is difficult. 2. They can clear last year stock in january and also the purchases by company also lower in the january month so the inventory will be closed by year end. And therefore it is easy for them to prepare accounts and do auditing. 3. Because of its size of operations and other factors, it cannot focus on calender year end. So chooses january as fiscal year end..

3 Diseases [10 marks] create two classes zika and Plague. Each of t.pdf

fashiondestinationld

3: Diseases [10 marks] create two classes: zika and Plague. Each of these classes must extend the Disease class. Each of these classes must define (override) both abstract methods inherited from Disease. For each, when creating objects, the name passed in should just be the name of the disease. COMP1006/1406 Fall 2016 Assignment #5 Due Tuesday, November 1 at 3:30 pm zika class: The severity should be an integer between 0 and 10 (inclusive) public void impact (Person p) Precondition: none Post conditions: none Side Effects: (1) the person\'s health will be decreased by the value of the severity of the disease (2) The disease\'s severity will be reduced by 1 (until it reaches zero) (3) The disease\'s chance of transmission is reduced by 10% (i.e. 0.9 current chance of transmission) public void treat Pre and post conditions: none Side Effects: Both the severity and chance of transmission are reduced by a factor of 2. (i.e each is replaced by 1/2 of the current value using integer division for severitv) Solution Please find the required classes along with the comments which describes the step :.

Chapter 16 Question 15 - Case StudyWhat can fish color tell us abo.pdf

fashiondestinationld

Chapter 16 Question 15 - Case Study What can fish color tell us about human pigmentation? Skin color is often one of the first traits people notice in each other. Studies in zebra fish uncovered a mutation that altered a transport protein and resulted in light-colored fish. This discovery led to the finding that the same gene in humans has a strong influence on skin pigmentation in many populations. Part A The allele of the human transport protein associated with light skin is found almost exclusively in Europeans. The other common allele, which appears to be the ancestral allele, is found in Africans. Explain how you think the allele present in Europeans came to be so common in this population. Select all that apply.1. A mutation must have occurred in the population ancestral to modern Europeans after their migration to Europe.2. A mutation must have occurred in the population ancestral to modern Europeans before their migration to Europe.3. This mutation gave a reproductive advantage to people who carried it in the environments of Europe. So, over generations, the allele became more and more frequent until it predominated in this population.4. A mutation must have occurred in the population ancestral to modern Europeans either before or after their migration to Europe.5. This mutation was dominant. For this reason, over generations, the allele became more and more frequent.6. The same mutations have occurred very often, so the allele became more and more frequent until it predominated in this population. Chapter 1 Question 15 Case Study What can fish color tell us about human pigmentation? Skin color is often one of the first traits people notice in each other. Studies in zebra fish uncovered a ion that altered a transport protein and resulted in light-colored fish. This discovery led to the finding that the same gere in humans has a strong nnuerice on skin pigmerilation irl arly popula Part A Thc allok of the human transport protcin associated with light skin is found almost exclusivchy in Europeans. The other common allolo. appears to be the ancostral alkolc, is found in Africans. Explain how you think the allcle prcsent in Europeans which came to be so common in this population. Select all that apply. A mutation must have occurred in the population ancestral to modern Europeans atter their migration to Europe A mutation must have occurred in the population ancestral to modern Furopeans betore their migration to Europe This mutation gave a reproductive advantage to people who carried it in the environments of Europe So, over generations the allele became more and more frequent until it predominated in this population A mutation must have occurred in the population ancestral to modern Europeans either before or after their migration to Europe. This mutation was dominant. For this reason, over generations, the allele became more and more frequent The same mulalions have curred very orlen, so lhe allele became more and rnore requeril urili i.

CASE APPLICATION #3 Decision Making, Saudi Style appreciate the distinctive cultural differences in many Saudi Arabian-based businesses. Decision making can take longer because many of the companies are family owned, and the tradition is for the family to thoroughly discuss a particular proposition before committing the business to it, Equally, the chief executive is often also the head of the family, Ahmed Youssef of the global management consultancy Booz & Company believes that a major issue facing Saudi family businesses is making the choice as to who traditionally takes leadership positions in the business and those who may be more capable of fulfilling such roles. This problem cuts to the heart of the issue of decision making. Added to this are the issues of the business being expected to support an ever-increasing number of and securing time with this individual may be difficult. Saudi Arabia has what could be called a merchant, or trad beyond their original core competences. ing, culture. Long before the discovery of oil, the Saudis wene shrewd negotiators. Saudi company hierarchies can be fairly faster and more focused, especially given the fact that many of rigid, and employees operate with clear lines of authority. In the countries in which these merchant family businesses operate recent years, the pace of business has accelerated, but decision making can still be a Sdi Arablan businesseSbefore. A survey carried out by slow and deliberate process. Decision makers will consult widely within the organization if they are unsure about how the decision will affect the best interests of the company. made it difficult to coordinate decision making and planning. In this respect, navigating several layers of approval and support The suggestion from the consulting firm is that businesses should may be necessary before a decision is finally made. Decision making, according to Youssef, will have to be difficulties in navigating the Gulf!\" Booz discovered that many of the divest themselves of some of the ventures unrelated to core ac- In soine cases in Saudi Arabia, the decision making can be ivities and concentrate on reinvestment in core businesses. In this delegated down the organization, but the decision will still need way, decision making can be more focused and streamlined. What does all this mean for the non-Saudi? It entails a slightly different approach to the decision-making process and Decisions are often made with reference to the specific situa tion rather than an all-encompassing set of rules or laws. In many cases, personal feelings and experiences are more important in decisions than simple objective and empirical data To make a risky decision, decision makers need to feel comfort able with that decision and may be more willing to make the deci- 1. Friendship and business are nearly always interlinked and 2. Scheduled meetings are often moveable due to Saudis sion if they trust those involved. Solution 4.25)in Saudi busin.

You and another tech are discussing the relative merits of SCSI inte.pdf

fashiondestinationld

You and another tech are discussing the relative merits of SCSI interfaces. You say that SCSI is dead, at least as far as drives go, and has been replaced by SAS and SATA. Your coworker says that SCSI has evolved and still has valid technical applications in today’s computing environment. Which modern applications does she say SCSI currently possesses? A. SCSI now can use serial as well as parallel interfaces. B. SCSI now uses TCP/IP as a transport mechanism. C. Some motherboard manufacturers still market SCSI interfaces supporting PCI Express and PCI-X. D. SCSI Ultra-5 (parallel) now supports as 64-bit data width. Solution A and D. LCD monitors do not have a refresh rate as such because LCDs use a separate backlight for illuminating an image displayed by liquid crystal shutters and shutters do not “refresh” but rather stay continuously at their stated opacity. You only need to degauss a CRT monitor, since LCD monitors do not acquire or generate a magnetic field..

Which of the following is NOT true of reflexes They are involuntary.pdf

fashiondestinationld

Which of the following is NOT true of reflexes? They are involuntary. The simplest pathway by which they occur is a reflex arc. They must be integrated in the brain. They allow individuals to react to a stimulus very quickly. Solution Answer: They must be intergrated in the brain. Explanation: A reflex is an involuntary and nearly instantaneous movement in response to a stimulus. Scientific use of the term \"reflex\" refers to a behavior that is mediated via the reflex arc. A reflex arc is a neural pathway that controls a reflex action. In higher animals, most sensory neurons do not pass directly into the brain, but synapse in the spinal cord. This characteristic allows reflex actions to occur relatively quickly by activating spinal motor neurons without the delay of routing signals through the brain, although the brain will receive sensory input while the reflex is carried out. Analysis of the signal takes place after action has been taken..

What is this pedigree and example of Autosomal dominant autosomal .pdf

fashiondestinationld

What is this pedigree and example of? Autosomal dominant autosomal recessive X-linked dominant X-linked recessive Solution This is a case of Autosomal recessive. Cannot be dominant as two unaffected parents could have affected offspring as they inherit two mutated genes, one from each parent. These disorders are usually passed on by two carriers. For example cystic fibrosis Autosomal dominant: can\'t be possible as affected parents cannot have unaffected offsprings. X-linked recessive: affected sons result from affected mother. X-linked dominant: affected daughters result from affected father..

what is total output in economicsSolutionWhat is total output .pdf

fashiondestinationld

what is total output in economics Solution What is total output in economics Total output in economics is defined as the quantity of goods or services produced in a given period ot time by a firm, industry or a country whether consumed or used for further production. It is the national output that makes a country rich, not the amounts of money. It is a tool to determine whether an economy is growing or contracting by comparing outputs at two different points in time. The Gross Domestic Product (GDP) is the measure we use today to measure national economic output. *****.

What are the components of the prokaryotic and eukaryotic cells a.pdf

fashiondestinationld

What are the components of the prokaryotic and eukaryotic cells ? a) Structure, Composition, and function Solution Feature Prokaryotic cell Eukaryotic cell Cell size 1-10 µm (But larger surface area to volume ratio. Hence higher metabolic rate, higher growth rate and shorter generation time) . 10-100 µm Cell wall Chemically complexed, mostly made of peptidoglycan. Present only in fungi and plants. Cell membrane/plasma membrane Double layer of phospholipid Double layer of phospholipid with sterols and carbohydrates as receptors. Nucleus Absent Present with well bound nuclear membrane. Cell organelles (mitochondria, endoplasmic reticulum, lysosomes, peroxisomes, microtubules, Golgi apparatus) Absent Present with well bound membranes Vesicles, vacuoles Present Present Ribosomes Smaller(70 S) Larger (80 S). Smaller size in organelles. Cytoskeleton (interconnected system of fibers, threads that give structure to the cell. The main components are microtubules, microfilaments, and intermediate filaments). May be present Present. Cytoplasmic streaming DNA A single loop of stable chromosomal DNA stored in the nucleoid area, which lack histones. Commonly known as plasmids. DNA is tightly bound and organised with multiple and linear chromosomes. Transcription and translation occur simultaneously in the cytoplasm Transcription occurs in the nucleus and translation occurs in the cytoplasm Genes (Differ in the structure, packing, density, and arrangement on the chromosome.) Compact genomes since introns and large non-coding regions are absent. All of the genome codes or controls cellular functions. Genes are also expressed in groups, known as operons. All the genes in an operon are transcribed on the same RNA and then made into separate proteins. Majority of genes have no known functions. (About 95% of the human genome does not code for proteins or RNA or includes a gene promoter). Genes have their own promoter and transcribed on their own strand of mRNA. Cell division Binary fission Mitosis Recombination Transfer of DNA Meiosis Feature Prokaryotic cell Eukaryotic cell Cell size 1-10 µm (But larger surface area to volume ratio. Hence higher metabolic rate, higher growth rate and shorter generation time) . 10-100 µm Cell wall Chemically complexed, mostly made of peptidoglycan. Present only in fungi and plants. Cell membrane/plasma membrane Double layer of phospholipid Double layer of phospholipid with sterols and carbohydrates as receptors. Nucleus Absent Present with well bound nuclear membrane. Cell organelles (mitochondria, endoplasmic reticulum, lysosomes, peroxisomes, microtubules, Golgi apparatus) Absent Present with well bound membranes Vesicles, vacuoles Present Present Ribosomes Smaller(70 S) Larger (80 S). Smaller size in organelles. Cytoskeleton (interconnected system of fibers, threads that give structure to the cell. The main components are microtubules, microfilaments, and intermediate filaments). May be present Present. Cytoplasmic streaming .

The Software Quality plan and a Software Configuration Management pl.pdf

fashiondestinationld

The Software Quality plan and a Software Configuration Management plan describe the activities, procedures, standards, and tools that will be used for the projects software quality and configuration management activities. Does a project need both? Why or why not? Solution Software Qualiy plan describes the ways to achieve the quality standards,It defines and describes the quality assurance activities which needs to be executed on day to day basis.And for each project the plan needs to be in place because if a project comes up and doesn\'t meet the quality standard then all the hardwork done on other parts will be a waste. Software Configuration Management : This is the process of tracking the changes made in the software running whether a new entry made or changes to existing one made. Its required in order to keep track of changes and whenever due to some change done in current release goes wrong then we can go back to the previous state , one of the example is SVN which is version control tool which gives the flexibility to check what all changes has been done to it and due to which change functionality is not working properly..

t distribution is a continuous distribution.TrueFalseSolutio.pdf

fashiondestinationld

Since this is a group discussion, each group has own conversation for.pdf

fashiondestinationld

Since this is a group discussion, each group has own conversation for this topic, Here are the ones you have access to: group own Discussion Question 2 Please answer the question below. Minimum participation standard: You must one original response and one return comment p to classmates. You will not be able to see other student\'s response until you answer the question. This discussion question addresses and aligns with the following Course Learning objectives 1. Recognize general microbiology concepts including microbial diversity (prokaryotic and eukaryotic) characteristics. taxonomy. metabolism growth and control reproduction, genetics, biotechnology and immunology 2. Evaluate the importance of microbes to health and disease. ecology and industry. 4. Apply concepts of general microbiology to natural world and society. Addresses and aligns with the following Chapter Learning objective: 5.15- Analyze the relative importance of viruses in human infection and disease Topic from Chapter 5: Viral structure and Life cycles-ls there such a thing as a \"good virus\"? Explain why or why not. Consider both bacteriophages and viruses of eukaryotic organisms. Unread Search entries or author Reply Replies are only visible to those who have posted at least one reply Previous Solution Bacteriophages and virus of eukaryotes organisms which include the Endogenous Retroviruses (ERVs) can be considered as good virus because they are beneficial to the host. The bacteriophages may be used to feed on certain infectious harmful bacterias. These phages are normally found in mucosal membranes thus residing in mucus of nose, mouth, genitals etc. The incoming pathogenic bacteria are invaded and combat operation is performed by these phages which protects the body. Also similar kind of phage therapy wherein bacteriophages are used to treat skin infections is used against acne. These phages confer the antibacterial resistance. ERVs have an evolutionary role in protecting the human fetus. They do so in many ways. Being the Retroviruses, the ERVs integrate their genome with the human genome as a result of which around 2-7% of human genome is of the viral origin. Retrovirus infection in reproductive cells can be passed on in generations as the ERVs. Such an infection is thought to be leading to viviparity in mammals which aids the developing fetus to survive mothers immune system. The ERVs most useful in this task are theEndosymbiotic ERVs. During pregnancy these ERVs are initiated in high amounts when the fetus is implanted. These are immunodepressors, which shield the baby from its mom\'s immune system. They also secrete a few viral proteins which help in formation of the placental syncytium which controls the exchange of migratory cells between the embryo and the mother..

REEF Activity Which of the following general transcriptions factors u.pdf

fashiondestinationld

Q2. Jay rents a room in his house to a college student. In the event.pdf

fashiondestinationld

Q2. Jay rents a room in his house to a college student. In the event that the house is seriously damaged by a fire or other peril, what kind of loss(es), in addition to the actual cash value of the damaged home, is Jay likely to encounter? A2. (At least one loss exposure; and inappropriate explanation will make deduction) Solution Jay Loses his Rental Income which he can earn when the house exists This is a Oppurtunity Cost for JAy.

Problem 5.7 Part A How do mammals, including humans, solve the dosa.pdf

fashiondestinationld

Problem 5.7 Part A How do mammals, including humans, solve the \"dosage problem\" caused by the presence of an X and Y chromosome in one sex and two X chromosomes in the other sex? Male RNA transcripts from the X chromosome have leaders that cause them to be translated at twice the rate as those in females. O Females produce twice the RNA transcripts as males do, but in females half of them are destroyed before being translated. O n males, the X chromosome is up-regulated so that its genes are transcribed and translated twice as much as the X chromosomes in females O They don\'t, but the X chromosome contains genes whose expression is not quantitatively sensitive, so the differences are not important. O They don\'t; the fact that females have twice as much X chromosome protein products as males is critical for sex determination in mammals. o n females, one of the X chromosomes is condensed and largely inactive so that each sex has one active X chromosome Submit My Answers Give Up Provide Feedback Continue Solution 1. Dosage compensation is the process by which the expression levels of sex-linked genes are altered in one sex to offset a difference in sex chromosome number between females and males of a heterogametic species. In case of humans, females have two copies of X chromosome(XX) and males have one(XY). Therefore, the females can produce twice as much gene product than the males,but it is due to Dosage Compensation that one of the X chromosomeis condensed and inactivated and hence the activity of X-linked genes is made equal in both the sexes. In case of placental mammals, i.e, marsupials Dosage Compensation is initiated by inactivation of one X chromosome in somatic cells of the females. 2. Down syndrome, one of the most familiar type of human trisomy in which affected individuals have an extra copy of chromosome 21 which is caused by nondisjunction of chromosome 21 during oogenesis. This incidence is related to maternal age, wherein with growing age of mothers there is a possibility that the chromosome tetrad during prophase I of meiosis will not remain together. Before birth, all oocytes are arrested in Diplotene stage in females. Once the beginning of menstrual period, meiosis resumes which indicates that the chromosomes in the tetrad must remain properly associated till menopause. Now, with maternal age there is a probability of these associations to break down which may lead to nondisjunction at Anaphase I..

Please find a solution, show your work. Thx E None of the above. .pdf

fashiondestinationld

Part A Why is the amniotic egg considered an important evolutionary a.pdf

fashiondestinationld

Part A Why is the amniotic egg considered an important evolutionary adaptation? O Allowed the development of many more offspring O Reduced the dependence on an aqueous environment for reproduction O Allowed internal fertilization to occur O Reduced the need for sexual reproduction O It helps to separate the mammals from other groups such as reptiles Submit My Answers Give Up Incorrect, one attempt remaining, Try Again Solution -Why is the aminotic egg considered an important evolutionary adaptation? Aminotic eggs are evolutionary separation between amphibians and reptiles. As the amphibians lays eggs which are non- aminotic and must be remain in water while the amniotic eggs of reptiles were able to lay their eggs on land. As the aminotic egg is surrounded by tough outer shell that protect the egg from predator, damage and drying. It also contains series of fluid-filled membranes includes aminon, allantois, yolk sac and chorion.The first membrane is chorion which carries oxygen from shell to the embryo and waste carbon dioxide from embyo to the shell. Aminon is the layer filled with aminotic fluid which keeps the embyo from drying out. The third layer alantois, stores waste from embryo and fuse with chorion to fom chorioallantoic membrane, which helps to carry oxgen and carbon dioxide to and from the embryo. A fourth membrane yolk sac helps to provide nutrition to the developing embryo. - Plants , fungi and animals all have eukaroytic cells. This is due to : In this evloution, the distantly related or unrelated organisms evolve similar body forms, organs and adaptation. They tend to evlove similar trait due to their adaptation to similar environment..

Let T be the spanning tree rooted at the start vertex produced by th.pdf

fashiondestinationld

Let T be the spanning tree rooted at the start vertex produced by the depth-first search of a connected, undirected graph, G. Argue why every edge of G, not in T, goes from a vertex in T to one of its ancestors, that is, it is a back edge. Hint: Suppose that such a nontree edge is a cross edge, and argue based upon the order the DFS visits the end vertices of this edge how this leads to a contradiction. Solution Before we answer this question we will revise certain definitions: 1. A connected graph is a graph that has path from any vertex to any other vertex in the graph. 2. Spanning tree is a tree that covers all the vertices of the graph. 3. DFS, also known as Depth first search traverses a graph in the following order. To create the DFS tree from a graph what it does is the following, It takes a starting vertex and then keeps all the edges of the vertices that are NEIGHBOURS to the starting vertex. Then for each neighbouring vertex it keeps all the edges of the neighbours of the current vertex provided the new neighbours are not already present in the tree. Now, coming to our question. As DFS takes each vertex v and covers its neighbours (which are not already covered) by doing this the vertex v becomes parents of the neighbours that it is going to cover. So, if there is an edge that joins v and an uncovered neighbour x then edge v---x will belong to the DFS tree T. So the only edges left out is the edges like x---v because v cannot be a child to x as it is alread a parent of x. Similarly we can see that for any pair of vertices w and y such that if w is an ancestor of y in T then a path from w---y exists in T. obviously no path from y----w exists in T given the nature of DFS. Therefore if G has the path y---w that will not be present in T. This is how we can say that every edge of G, not in T , goes from a vertex in T to one of its ancestors, that is, it is a back edge. Because if it wasn\'t a back edge then it would be covered in the DFS tree T..

Let I and J be ideals of R with I J. (a) Show JI is an ideal of R.pdf

fashiondestinationld

Let I and J be ideals of R with I J. (a) Show J/I is an ideal of R/I. (b) Define phi: R rightarrow (R/I)/(J/I) by phi(r) = (r + I) + J/I for r R. Show phi is a subjective homomorphism with ker phi = J. (c) Conclude that (R/I)/(J/I) R/J. Solution Let I and J be ideal of R with IJ Certainly 0+I J/I since J is an ideal and hence 0J. The additive identity of R/I lies in J/I take a+I, b+IJ/I so a,bJ since J is an ideal, we get a+b, -aJ Now (a+I)+(b+I)=(a+b)+IJ/I and -(a+I)=-a+IJ/I therefore J/I is a subgroup of R/I under addition now take x+IR/I so xR since J is an ideal, we know xaJ where aJ so (x+I)(a+I)=xa+IJ/I Hence J/I is an ideal of R/I consider the map :R/IR/J given by (x+I)=x+J let x+I=x+I, implies x-xI, implies x-xJ since IJ we get x+J=x+J is well-defined. hence is surjective. now for kernel we have ker={x+IR/Isuchthat (x+I)=0} ={x+IR/Isuchthat xJ} = J/I Im()={a+Jsuchthat aR}=R/J Hence we conclude that (R/I)/(R/J)isomorphic to R/J.theorem is proved..

1 Which component contains menusa. Menu button.b. Title bar.c.pdf

fashiondestinationld

1 Which component contains menus? a. Menu button. b. Title bar. c. Menu bar. d. Combo box. 2. Which of the following statements for a JTextField is false? a. Can be used to display uneditable text. b. Can be used to display editable text. c. Enables users to enter data from the keyboard. d. Displays a list of fields. 3. Which of the following statements about heavyweight components is false? a. AWT components are not heavyweight components. b. Several Swing components are heavyweight components. c. The look-and-feel may vary across platforms. d. The functionality may vary across platforms. 4. Which pair of words does not complete the sentence below correctly? A ________ is a ________. a. Container, Component. b. Container, JPanel. c. JComponent, Container. d. Component, Object. 5. provides the basic attributes and behaviors of a window—a title bar at the top of the window, and buttons to minimize, maximize and close the window. a. JLabel. b. JFrame. c. JSwing. d. JWindowControl. 6. Method can be used to set the layout manager of a container. a. setManager. b. setLayout. c. setLayoutManager. d. setGUILayout. 7. A JLabel can be attached to a JFrame using method: a. attach. b. contain. c. append. d. add. 8. A JRadioButton is different from a JCheckBox in that . a. a JRadioButton is a subclass of JToggleButton, JCheckBox is not. b. normally several JRadioButtons are grouped together and are mutually exclusive. c. a JRadioButton is a type of button, JCheckBox is not. d. a JRadioButton is a state button, JCheckBox is not. 9. The logical relationship between radio buttons is maintained by objects of what class? a. MutualExclusionGroup. b. RadioButtonGroup. c. Group. d. ButtonGroup. 10. Adding a ButtonGroup object to a container: a. is necessary for the functionality of the ButtonGroup to work properly. b. causes all the JRadioButtons in the group to have their event handlers registered. c. results in a compilation error. d. None of the above. 1 Which component contains menus? a. Menu button. b. Title bar. c. Menu bar. d. Combo box. 2. Which of the following statements for a JTextField is false? a. Can be used to display uneditable text. b. Can be used to display editable text. c. Enables users to enter data from the keyboard. d. Displays a list of fields. 3. Which of the following statements about heavyweight components is false? a. AWT components are not heavyweight components. b. Several Swing components are heavyweight components. c. The look-and-feel may vary across platforms. d. The functionality may vary across platforms. 4. Which pair of words does not complete the sentence below correctly? A ________ is a ________. a. Container, Component. b. Container, JPanel. c. JComponent, Container. d. Component, Object. 5. provides the basic attributes and behaviors of a window—a title bar at the top of the window, and buttons to minimize, maximize and close the window. a. JLabel. b. JFrame. c. JSwing. d. JWindowControl. 6. Method can be used to set the.

In a pedigree, a rare trait appears in both sexes with equal frequenc.pdf

fashiondestinationld

In a pedigree, a rare trait appears in both sexes with equal frequency, and affected offspring often has one affected parent. What is the MOST likely mode of inheritance? Autosomal recessive Autosomal dominant X-linked recessive X-linked dominant Y-linked Since linked genes segregate together, they would be expected to: not show dominance. not assort independently. produce a novel phenotype by gene interaction. show incomplete dominance. None of the above Solution 5. Autosmal dominanat would have equaly frquency appearance in both sex (so not x and y linked) and always an affected parents only would give a affected off spring 7. Linked gene would show dominanace if they are domianat and would assort independently on recombiantion other wise not. they will show complate dominanace unless they ahve intereaction to other gene. so option E is best answer here.

I need help with those definitions, please. Define toxic shock synd.pdf

fashiondestinationld

I need help with those definitions, please. Define: toxic shock syndrome (TSS) impetigo MRSA Solution Toxic shock syndrome (TSS): It is an illness caused due to bacterial toxins. The main causative bacteria is Staphylococcus aureus. It could also be caused by Streptococcus pyogenes. TSS caused by S. pyogenes is sometimes called toxic shock like syndrome. Symptoms include high fever, low blood pressure. In extreme conditions it may lead to coma and multiorgan failure. Impetigo is a disease that occurs on superficial skin. It is caused by either Staphylococcus aureus or Streptococcus pyogenes. Yellowish crust formed on face, arms or legs represent impetigo. MRSA: methicillin resistant Staphylococcus aureus infections. These infections are difficult to treat, since the bacteria are resistant to several antibiotics such as penicillins and cephalosporins..

Help Pleaaaaase D Question 1 In a diploid organism, alleles of a gen.pdf

fashiondestinationld

Help Pleaaaaase D Question 1 In a diploid organism, alleles of a gene are located on O non homologous chromosomes O sister chromatids O homologous chromosomes O the same chromosome 0.5 pts Solution 1. The variant form of a gene is called as an allele. In diploid organisms, alleles of same locus either may be homozygous or heterozygous. Therefore, the alleles occur on sister chromatids. Option 2 is correct. 12. During meiosis two consecutive nuclear divisions take place and result in formation of 4 haploid daughter nuclei. The meiosis is carried out in series of events occurring at various stages. In the first stage (prophase I) the diploid nuclei containing chromosomes from as tetrads and are condensed. The synapsis and crossing over takes place to exchange the fragments between the chromosomes. Option 1 is correct. 13. Gametes of diploid organisms are haploid and should have one copy of every gene. Option 4 is correct..

What is the purpose of studying mathematics.pptx

christianmathematics

Assignment_4_ArianaBusciglio Marvel(1).docx

ArianaBusciglio

Recently uploaded

What is the purpose of studying mathematics.pptx

christianmathematics

Assignment_4_ArianaBusciglio Marvel(1).docx

ArianaBusciglio

Normal Labour/ Stages of Labour/ Mechanism of Labour

Wasim Ak

Group Presentation 2 Economics.Ariana Buscigliopptx

ArianaBusciglio

South African Journal of Science: Writing with integrity workshop (2024)

Academy of Science of South Africa

CACJapan - GROUP Presentation 1- Wk 4.pdf

camakaiclarkmusic

Natural birth techniques - Mrs.Akanksha Trivedi Rama University

Akanksha trivedi rama nursing college kanpur.

Lapbook sobre os Regimes Totalitários.pdf

Jean Carlos Nunes Paixão

Digital Artifact 1 - 10VCD Environments Unit

chanes7

বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf

eBook.com.bd (প্রয়োজনীয় বাংলা বই)

বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত .. আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ... তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...। বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...

MATATAG CURRICULUM: ASSESSING THE READINESS OF ELEM. PUBLIC SCHOOL TEACHERS I...

NelTorrente

RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3

IreneSebastianRueco1

Best Digital Marketing Institute In NOIDA

deeptiverma2406

Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification. for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.

PCOS corelations and management through Ayurveda.

Dr. Shivangi Singh Parihar

The Diamonds of 2023-2024 in the IGRA collection

Israel Genealogy Research Association

PIMS Job Advertisement 2024.pdf Islamabad

AyyanKhan40

Digital Artefact 1 - Tiny Home Environmental Design

amberjdewit93

How to Add Chatter in the odoo 17 ERP Module

Celine George

S1-Introduction-Biopesticides in ICM.pptx

tarandeep35

Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...

National Information Standards Organization (NISO)

Recently uploaded (20)

What is the purpose of studying mathematics.pptx

Assignment_4_ArianaBusciglio Marvel(1).docx

Normal Labour/ Stages of Labour/ Mechanism of Labour

Group Presentation 2 Economics.Ariana Buscigliopptx

South African Journal of Science: Writing with integrity workshop (2024)

CACJapan - GROUP Presentation 1- Wk 4.pdf

Natural birth techniques - Mrs.Akanksha Trivedi Rama University

Lapbook sobre os Regimes Totalitários.pdf

Digital Artifact 1 - 10VCD Environments Unit

বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf

MATATAG CURRICULUM: ASSESSING THE READINESS OF ELEM. PUBLIC SCHOOL TEACHERS I...

RPMS TEMPLATE FOR SCHOOL YEAR 2023-2024 FOR TEACHER 1 TO TEACHER 3

Best Digital Marketing Institute In NOIDA

PCOS corelations and management through Ayurveda.

The Diamonds of 2023-2024 in the IGRA collection

PIMS Job Advertisement 2024.pdf Islamabad

Digital Artefact 1 - Tiny Home Environmental Design

How to Add Chatter in the odoo 17 ERP Module

S1-Introduction-Biopesticides in ICM.pptx

Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...