Dissecting the underlying pharmaceutical mechanism of Danggui Buxue decoction acting on idiopathic pulmonary fibrosis with network pharmacology

ARTICLE
Submit a manuscript: https://www.tmrjournals.com/tmr
TMR | July 2020 | vol. 5 | no. 4 | 238
doi: 10.12032/TMR20191102146
Traditional Chinese Medicine
Dissecting the underlying pharmaceutical mechanism of Danggui
Buxue decoction acting on idiopathic pulmonary fibrosis with
network pharmacology
Cai-Ping Zhao1#
, Hang Li1#
, Xiao-Hong Liu2
, Shuang Liang1
, Xue-Lei Liu1
, Xin-Rong Li1
, Yi Luo1
, Mei-Ling Zhu1*
1
Baoan Hospital of Traditional Chinese Medicine Affiliated to Guangzhou University of Traditional Chinese Medicine,
Shenzhen 518133, China. 2
Guangzhou University of Chinese Medicine, Guangzhou 510006, China.
#
Cai-Ping Zhao and Hang Li are the co-first authors of this paper.
*Corresponding to: Mei-Ling Zhu. Baoan Hospital of Traditional Chinese Medicine Affiliated to Guangzhou University of
Traditional Chinese Medicine, No. 25, Yu'an Second Road, Xin'an Street, Bao'an District, Shenzhen 518133, Chine. E-mail:
1930896811@qq.com.
Highlights
Kaempferol and quercetin are found to be the two main compounds of classical prescription of traditional
Chinese medicine named Danggui Buxue decoction with the highest network regulation, which can inhibit
the transformation of fibroblasts into myofibroblasts and reduce the expression of fibrosis markers
α-smooth muscle actin, collagen 1, fibronectin.
Traditionality
Danggui Buxue decoction (DBD), a classical prescription in traditional Chinese medicine composed of
Huangqi (Radix Astragali) and Danggui (Radix Angelicae Sinensis) in a ratio of 5:1, originates from the
Chinese medicine ancient book entitled Neiwai Shangbian Huolun written by the famous medical scientist
Li Dongyuan in 1247 C.E. At present, there are many researchers who try to study the biological activity of
individual chemical components in DBD and the mechanism of action of whole formula. Some studies have
shown that DBD has effect on fibrosis of heart, liver and kidney and has protective effect on
bleomycin-induced pulmonary fibrosis in rats by reducing alveolar inflammation and fibrosis.

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 239
Abstract
Backgroud: Danggui Buxue decoction (DBD), a classical prescription in traditional Chinese medicine, has been
found to have protective effect on bleomycin-induced pulmonary fibrosis in rats by reducing alveolar inflammation
and fibrosis. However, the biological activity of individual chemical components and mechanism of action of
whole formula are not clear. Methods: Potential targets of active ingredients of DBD were collected through
Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform and SymMap database.
Target genes related to idiopathic pulmonary fibrosis were obtained from the Online Mendelian Inheritance in Man
database, Therapeutic Targets Database and Gkb database. Then, the common targets were obtained by overlapping
the potential targets of active ingredients in DBD and diseases related targets. The selected targets were subjected
to Kyoto Encyclopedia of Genes and Genomes signaling pathway and Gene Ontology analysis, and the network
map of active component-target-pathway was established using Cytoscape 3.7.1 software. The active components
of DBD with most targets were selected for fibrosis-related marker verification. The mRNA and protein expression
of fibrosis markers, α-smooth muscle actin, collagen 1 and fibronectin, were detected in TGF-β1-induced fibroblast
cell line after treatment with the active components. Results: The 14 active ingredients, such as quercetin and
kaempferol, were screened from DBD. It acts on 26 targets like estrogen receptor 2 and
prostaglandin-endoperoxide synthase 2, and mainly involves 38 signaling pathways such as cell inflammation and
autophagy. Kaempferol and quercetin are the two compounds with the highest network regulation, which can
inhibit the transformation of fibroblasts into myofibroblasts and reduce the expression of fibrosis markers α-smooth
muscle actin, collagen 1 and fibronectin. Conclusion: The integration mode of multi-component, multi-target,
multi-channel and mechanism of DBD in the treatment of idiopathic pulmonary fibrosis are predicted by means of
network pharmacology. Our study could indicate the direction of further anti-fibrotic mechanism research.
Keywords: Danggui Buxue decoction, Pulmonary fibrosis, Network pharmacology, Myofibroblast, Chinese
medicine formula, Mechanism of action
Abbreviations:
IPF, Idiopathic pulmonary fibrosis; TCM, Traditional Chinese medicine; DBD, Danggui Buxue decoction;
TCMSP, Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform; OB, Oral
bioavailability; DL, Drug-like; TTD, Therapeutic Targets Database; OMIM, Online Mendelian Inheritance in
Man; TNF, Tumor necrosis factor; PTGS2, Prostaglandin-endoperoxide synthase 2; PRSS1, Recombinant
protease, serine 1; PGE2, Prostaglandin E2; MAPK, Mitogen-activated protein kinase; GO, Gene Ontology;
DAVID, Database for Annotation, Visualization and Integrated Discovery; KEGG, Kyoto Encyclopedia of
Genes and Genomes; PI3K, Phosphatidylinositol 3-kinase; α-SMA, α-Smooth muscle actin; AR: Androgen
receptor.
Competing interests:
The authors declare that there is no conflict of interest.
Citation:
Cai-Ping Zhao, Hang Li, Xiao-Hong Liu, et al. Dissecting the underlying pharmaceutical mechanism of
Danggui Buxue decoction acting on idiopathic pulmonary fibrosis with network pharmacology. Traditional
Medicine Research 2020, 5 (4): 238–251.
Executive editor: Cui-Hong Zhu, Mathew Goss.
Submitted: 7 October 2019, Accepted: 15 November 2019, Online: 18 November 2019.

ARTICLE
doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 240
Background
Idiopathic pulmonary fibrosis (IPF) is a chronic,
progressive, fibrotic interstitial lung disease that occurs
in the middle-aged and elderly population. The disease
is mostly sporadic. According to statistics, the
prevalence rate in the whole population is about
(2-29)/100,000 per year, and it is gradually increasing.
As a chronic interstitial lung disease, IPF’s onset is
concealed, and patients’ condition gradually becomes
worsen. In addition, it often manifested as acute
exacerbation. The average survival after IPF diagnosis
is only 2.8 years [1], and the mortality rate is higher
than most tumors, so it is called a tumor-like disease.
Currently, the drugs the FDA recommends for IPF are
only pirfenidone and nintedanib [2]. However, they are
only effective in some patients and have some serious
side effects. Therefore, there is still an urgent need to
further develop new strategies for the treatment of this
refractory respiratory disease.
In traditional Chinese medicine (TCM), IPF is
classified into the category of Fei Bi or Fei Wei [3]. Its
main clinical manifestations are dyspnea, dry cough
and other symptoms, and eventually leading to
respiratory failure [4-6]. At present, there are many
experimental and clinical studies on the treatment of
IPF with TCM therapy and in some ways, they have
achieved good results. For example, studies have
shown that the classical prescription of TCM named
Renshen Pingfei decoction can reduce the degree of
early lung injury and fibrosis and improve lung
function in IPF model rats by down-regulating
TGF-β1/Smad3 signaling pathway [7]. Wu Zhihuang
shows that the prescription of experience Bufei
Huoxue decoction has good curative effect on IPF, and
it is safe and has few side effects [8]. However, the
mechanism of action of TCM for treating pulmonary
fibrosis is still at an exploratory stage.
Danggui Buxue decoction (DBD) is from the
ancient book of Chinese medicine entitled Neiwai
Shangbian Huolun, written by the famous medical
scientist Li Dongyuan in 1247 C.E., composed of
Huangqi (Radix Astragali) and Danggui (Radix
Angelicae Sinensis) in a ratio of 5:1 [9]. Studies have
shown that DBD has effect on fibrosis of heart, liver
and kidney, which can alleviate peroxidative damage
[10], reduce collagen content, improve capillary
function [11], and reduce the degree of fibrosis [12].
The study also found that DBD acted on
bleomycin-induced pulmonary fibrosis in rats, which
could significantly reduce alveolar inflammation and
fibrosis, and had protective effect on pulmonary
fibrosis rats [13, 14]. At present, there are many
researchers studying the biological activity of
individual chemical components in Huangqi (Radix
Astragali) and Danggui (Radix Angelicae Sinensis),
but the target and mechanism of action of whole
formula are not clear.
Network pharmacology is a new technology
combines multi-disciplines, such as system biology,
multi-directional pharmacology, and network analysis.
By constructing an interactive network such as
disease-target-component, it uses professional software
to analyze the association between disease-protein
targets, protein targets-drugs, and then systematically
reveals the interaction and mechanism between drugs
and organisms. The holistic and multi-component,
multi-channel and multi-target characteristics of TCM
are consistent with the network pharmacology
characteristics [15]. In summary, this study used
network pharmacology to study and explore the
mechanism of action of DBD in the treatment of IPF
by constructing an effective network between the
active constituents of DBD and IPF related targets.
Materials and methods
The active ingredients screening and target
prediction of DBD
DBD consists of two Chinese herbal
medicines-Huangqi (Radix Astragali) and Danggui
(Radix Angelicae Sinensis). The compounds of these
two Chinese herbal medicines were collected using the
Traditional Chinese Medicine Systems Pharmacology
Database and Analysis Platform (TCMSP)
(http://lsp.nwu.edu.cn/tcmsp.php) and the SymMap
database (http://www.symmap.org/). The
pharmacokinetic properties of the drug are collected,
including oral bioavailability (OB), intestinal epithelial
permeability, blood brain barrier, and water solubility.
OB > 30% and drug-like (DL) > 0.18 were used as
indicators for screening compounds. There are 14
active ingredients in DBD showed good bioavailability
and DL properties through oral availability and DL
analysis. OB is the fraction of an oral administered
drug that reaches systemic circulation. This is essential
for determining whether a chemical component of
TCM has pharmacological activity. In the early
development stage of the drug, accurate evaluation of
the compound’s DL can help to screen out the
excellent compounds and improve the hit rate of drug
candidates. Compounds with a DL greater than 0.18
are considered to have higher DL. Therefore,
bioavailability and DL are selected to screen for
candidate components. The target proteins
corresponding to the candidate components were
searched using the TCMSP, Therapeutic Targets
Database (TTD) (https://db.idrblab.org/ttd/), Gkb
(https://www.pharmgkb.org/) and Drug Bank
(https://www.drugbank.ca/) database. The gene name
of the target protein is queried by the Unitprot database
(http://www.Unitprot.org/).
IPF target collection and target interaction
The IPF disease-associated phenotype was searched by

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 241
querying the Online Mendelian Inheritance in Man
(OMIM) (https://www.omim.org/) database, and
disease-related proteins and gene targets were
collected using OMIM, TTD, and Drug Bank
databases and literature research. The DBD and IPF
targets were imported into the Bioinformatics &
Evolutionary Genomics database for Venn map
analysis, and the common targets in the two sets of
data were selected as potential targets.
Construction of compound-target-pathway network
In order to reflect the relationship between drug
molecules and diseases, this study used the Database
for Annotation，
Visualization and Integrated Discovery
(DAVID) (https://david.ncifcrf.gov/) to analyze the
potential targets of Kyoto Encyclopedia of Genes and
Genomes (KEGG) signaling pathways and screen out
the signal pathways with higher target numbers.
Targets, compounds, and pathways are used as nodes
in the network, and the interaction between the two is
the edge of the network. The Cytoscape 3.7.1 software
is introduced to construct a compound-target-pathway
network. At the same time, the network analyzer
plug-in is used for network interaction analysis, and
the degree of each target protein are calculated.
Functional characterization and Gene Ontology (GO)
enrichment analysis of target proteins were performed
using the DAVID database. The P value reflects the
significance of the biological function of the protein.
The specific operation process is shown in Figure 1.
By constructing a network to study the
multi-component, multi-target and multi-channel
modes of DBD, the mechanism of DBD acting on IPF
can be understood from different perspectives, which
can provide reference for Chinese medicine therapy of
IPF.
Figure 1 Danggui Buxue decoction acts on IPF network pharmacology flow chart
Note: DBD, Danggui Buxue decoction; IPF, Idiopathic pulmonary fibrosis; TCMSP, Traditional Chinese Medicine
Systems Pharmacology Database and Analysis Platform; OMIM, Online Mendelian Inheritance in Man; TTD,
Therapeutic Targets Database; PCR, Polymerase chain reaction; WB, Western blot; GO, Gene Ontology; KEGG,
Kyoto Encyclopedia of Genes and Genomes.

ARTICLE
doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 242
Experiment
Reagents and instruments. Mouse embryonic
fibroblasts (NIH/3T3) established by the National
Institutes of Health were purchased from Shanghai
Academy of TCM and routinely cultured in Dulbecco's
modified Eagle's medium supplemented with 10% fetal
bovine serum and 1% streptomycin/penicillin in a 5%
carbon dioxide, 37 °C incubator.
Quercetin (B20527) and kaempferol (B21126) were
purchased from Yuanye (Shanghai, China), TGF-β1
(7666-MB-005) was purchased from R&D
(Minneapolis, MN, USA), MTS (G3581) was
purchased from Promega (Madison, WI, USA), RNA
extraction kit (DP419) was purchased from Tiangen
(Beijing, China), RNA reverse transcription kit (AT341)
and qPCR kit (AQ601) were purchased from
Quanshijin (Beijing, China), rabbit-derived collagen1
antibody (84336) and horseradish peroxidase-labeled
secondary antibody (7074) were purchased from CST
(Danvers, MA, USA), rabbit-derived fibronectin
antibody (ab32419) was purchased from Abcam
(Cambridge, MA, USA). Multi-function microplate
reader was purchased from Biotek (Biotek Winooski,
Vermont, USA), Bio-Rad vertical electrophoresis
system and T100 Thermal cycler gradient PCR
instrument were purchased from Bio-Rad (Hercules,
CA, USA), Nanodrop One nucleic acid quantitation
instrument was purchased from Thermo (Waltham,
MA, USA), LC 480II fluorescence quantitative PCR
instrument was purchased from Roche (Basel,
Switzerland), FluorChem E chemiluminescence gel
imager was purchased from ProteinSimple (Silicon
Valley, CA, USA).
Effect of quercetin and kaempferol on cell viability
of NIH/3T3 cell line by MTS assay. NIH/3T3 cells
were seeded in 96-well plates at a concentration of 1.5
× 104
cells/well, and cultured overnight at 37°C. The
medium was removed, and 100 μL/well of the medium
containing different concentrations of drugs was added
to treat the cells, and the medium was used as a control
well. The cells were cultured in a 5% CO2, 37°C
incubator for 24 h. The MTS solution was added, and
the mixture was incubated at 37°C for 1 h in the dark,
and the absorbance was measured by a multi-function
microplate reader.
Detection of mRNA expression levels of α-smooth
muscle actin, collagen1 and fibronectin in
fibroblasts induced by TGF-β1 by RT-PCR. The
relative expression of α-smooth muscle actin (α-SMA),
collagen1 and fibronectin mRNA was determined by
Real-time PCR with GAPDH as an internal reference.
NIH/3T3 cells were seeded in six-well plates and
incubated in a constant temperature incubator
overnight. Quercetin and kaempferol at a final
concentration of 0, 5, 10, and 20 μM/L were added to
each well. Normal control group was also established.
After 2 h, 5ng/mL of TGF-β1 was added to each well
and culture was continued for 12 h. The mRNA was
extracted: the cells were washed twice with pre-cooled
PBS, the lysate was added, and the sample was beaten
several times until the solution was transparent. Then
200 μL of chloroform was added and shaken
vigorously for 15 secs. Centrifuged at 12,000 rpm for
10 min at 4°C, transferred the aqueous phase to a new
tube, slowly added 0.5 volumes of absolute ethanol,
and mixed. Centrifuged at 12,000 rpm at 4°C for 30
secs and discarded the waste. Five hundred μL of
deproteinized liquid RD was added to the adsorption
column CR3, and the waste liquid was centrifuged.
Five hundred μL of the rinse liquid RW was added to
the adsorption column CR3, and the waste liquid was
centrifuged, and the residual liquid was removed once.
Add 30 μL of RNase-Free ddH2O, let stand for 2 min
at room temperature, and centrifuged at 12,000 rpm for
2 min at 4°C to obtain total mRNA. The mRNA was
quantified using a nucleic acid quantitation instrument,
and then mRNA, gDNA Remover, H2O, and
All-in-One No-RT Control SuperMix were mixed into
a 20 μL system, incubated at 42°C for 15 min, and
incubated at 85°C for 5 secs to obtain cDNA. The Top
Green qPCR SuperMix, template, primer and water
were mixed into a 20 μL system, and qPCR
amplification was performed to obtain a sample Ct
value. The primer sequences are shown in Table 1. The
sample Ct value was analyzed and quantified by the
2-ΔΔCT
method in relative quantification.
Table 1 Primer sequence
Gene Sequence (5'-3')
α-SMA forward TCAGGGAGTAATGGTTGGAATG
α-SMA reverse GGTGATGATGCCGTGTTCTA
GAPDH forward CCAGAACATCATCCCTGCAT
GAPDH reverse CAGTGAGCTTCCCGTTCA
Collagen 1 forward AGACCTGTGTGTTCCCTACT
Collagen 1 reverse GAATCCATCGGTCATGCTCTC
Fibronectin forward TCCTGTCTACCTCACAGACTAC
Fibronectin reverse GTCTACTCCACCGAACAACAA

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 243
Detection of TGF-β1-induced expression of α-SMA,
collagen 1 and fibronectin in fibroblasts by western
blot. Western blot was used to detect the effects of
quercetin and kaempferol on lung fibrosis-associated
proteins induced by TGF-β1 in NIH/3T3 cells were
examined. Logarithmic growth phase cells were
seeded in six-well plates, and the cells were incubated
overnight for adherent administration. The drug groups
were divided into different concentrations: 0, 5, 10, 20
μM/L. At the same time, a normal control group was
established. After 2 hours, 5ng/mL of TGF-β1 was
administered and cultured for 24 hours to induce
fibrosis. Total cellular protein was extracted. The
quantification and denaturation of protein were
performed. An 8% SDS-PAGE gel was prepared, and
the sample was electrophoresed and transferred to a
PVDF membrane. The 5% skim milk powder was used
to blocked protein for 2 h. The membranes were
exposed to primary antibody: anti-fibronectin,
anti-collagen1, anti-α-SMA antibodies at dilutions of
1:1000 respectively, and incubated overnight at 4°C.
This was followed by incubation with the secondary
antibody for 2 h at room temperature. The strip was
developed using a chemiluminometer. The protein
band was analyzed, and the relative expression amount
was calculated from the ratio of the gray value of the
target protein to the gray value of the internal reference
Tubulin.
Statistical analysis. Data analysis was performed
using SPSS 20.0 statistical software. The data were
expressed as mean ± standard deviation (x ± s). The
comparison between the data of multiple groups was
analyzed by one-way ANOVA. P < 0.05 was
considered statistically significant.
Result
Collection of active ingredients in Danggui Buxue
decoction and predicted targets
Through the search of above databases, DBD collected
a total of 212 active ingredients, of which 125 active
ingredients related to Danggui (Radix Angelicae
Sinensis) and 87 active ingredients related to Huangqi
(Radix Astragali). After OB and DL screening, 22
Table 2 The active ingredients of Danggui Buxue decoction after screening
TCMSP Name
OB
(> 30%)
DL
(> 0.18)
MOL000449 Stigmasterol 43.83 0.76
MOL000358 Beta-sitosterol 36.91 0.75
MOL000387 Bifendate 31.10 0.67
MOL000033
(3S,8S,9S,10R,13R,14S,17R)-10,13-Dimethyl
-17-[(2R,5S)-5-propan-2-yloctan-2-yl]-2,3,4,7
,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclo
penta [a] phenanthren-3-ol
36.23 0.78
MOL000379
9,10-Dimethoxypterocarpan-3-O-β-D-glucosi
de
36.74 0.92
MOL000296 Hederagenin 36.91 0.75
MOL000442 3,9-Dimethoxy-6H- [1] benzofuro [3,2-c]
chromene-1,7-diol
39.05 0.48
MOL000374
5'-Hydroxyiso-muronulatol-2',5'-di-O-Glucosi
de
41.72 0.69
MOL000422 Kaempferol 41.88 0.24
MOL000098 Quercetin 46.43 0.28
MOL000417 Calycosin 47.75 0.24
MOL000439 Isomucronulatol-7,2'-di-O-glucosiole 49.28 0.62
MOL000354 Isorhamnetin 49.60 0.31
MOL000239 Jaranol 50.83 0.29
MOL000371 3,9-Di-O-methylnissolin 53.74 0.48
MOL000211 Mairin 55.38 0.78
MOL000380
(6aR,11aR)-3-Hydroxy-9,10-dimethoxypteroc
arpan
64.26 0.42
MOL000438
(3R)-3-(2-Hydroxy-3,4-dimethoxyphenyl)-3,4
-dihydro-2H-chromen-7-ol
67.67 0.26
MOL000433 FA 68.96 0.71
MOL000392 Formononetin 69.67 0.21
MOL000378 7-O-Methylisomucronulatol 74.69 0.30
MOL000398 Isoflavanone 109.99 0.30
TCMSP, Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform; OB, Oral
bioavailability; DL, Drug-like.

ARTICLE
doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 244
Table 3 Part of the target of Danggui Buxue decoction component (nodes ≥ 6)
UniProt Name Gene name Node
Q92731 Estrogen receptor beta ESR2 15
P35354 Prostaglandin G/H synthase 2 PTGS2 14
P23219 Prostaglandin G/H synthase 1 PTGS1 12
P07477 Trypsin-1 PRSS1 10
P35228 Nitric oxide synthase, inducible NOS2 9
P24941 Cyclin-dependent kinase 2 CDK2 8
P19793 Retinoic acid receptor RXR-alpha RXRA 8
Q14524
Sodium channel protein type 5 subunit
alpha
SCN5A 7
P11229 Muscarinic acetylcholine receptor M1 CHRM1 7
P10275 Androgen receptor AR 7
P07550 Beta-2 adrenergic receptor ADRB2 7
P22303 Acetylcholinesterase ACHE 6
P49841 Glycogen synthase kinase-3 beta GSK3B 6
Figure 2 Compound-target-pathway network
Note: The protein is a blue diamond frame, the active ingredient is a red circular frame, and the pathway is a yellow
square frame. The more nodes, the larger the font.
active ingredients were obtained. The data in Table 2
show the names of the active ingredients, OB values
and DL values. The target proteins corresponding to
the screened compounds were obtained and a total of
354 active component’s targets were collected. Table 3
shows the targets number of nodes ≥ 6, including
Uniprot number, target name, gene name, number of
nodes.
Target collection and potential target prediction of
IPF disease
The 5,980 IPF-related phenotypes and targets were
obtained by database search, and 401 disease-related
targets were obtained after combined descreening.
After mapping 401 targets of IPF and 354 targets of
DBD by Venn, the common potential targets numbers
were 26.
Analysis of compound-target-pathway network
Fourteen active components, 26 target proteins, and
signal pathways with higher nodes are shown on the

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 245
compound-target-pathway network map, as shown in
Figure 2. The proteins, active components and
pathways with a large number of nodes are shown as
prominent fonts. Use different shapes to represent
different nodes. The protein is a diamond-shaped
frame, the active component is a circular frame, and
the passage is a square frame. The use of different
colors and shapes to process the image indicates the
corresponding effects of multiple active components,
multiple targets and multiple channels. Ten targets are
shown in Table 4 including numbers, abbreviations,
degrees and mediators. The active ingredient
information is shown in Table 5.
Pathway analysis and GO analysis
The above 26 targets were subjected to KEGG
pathway enrichment analysis and GO analysis using
the DAVID database. Through the KEGG pathway
enrichment analysis, a total of 12 signaling pathways
were obtained (P < 0.05). Among them, the
phosphatidylinositol 3-kinase (PI3K)-Akt signaling
pathway [16], the mitogen-activated protein kinase
(MAPK) signaling pathway [17], the HIF-1 signaling
pathway [18], the T cell receptor signaling pathway
[19], and the tumor necrosis factor (TNF) signaling
pathway [20], Ras signaling pathway [21], FoxO
signaling pathway [22], Toll-like receptor signaling
pathway [23], TGF-β signaling pathway [24] are
closely related with pulmonary fibrotic inflammatory
immune response, angiogenesis, apoptosis muscle
fibroblast migration and phenotypic transformation,
cell matrix metabolism abnormalities and other aspects.
Through the GO analysis, biological process, cellular
compenent and molecular function were obtained. In
the chart of biological process categories, response to
stimulus and biological regulation account for 24
genes. The extracellular space, membrane and
endomembrane system are the first three factors in the
chart of cellular compenent categories. In the chart of
molecular function categories, the gene numbers of
protein linding and iron binding are 23 and 12,
respectively. This suggests that DBD can prevent and
treat pulmonary fibrosis by improving the above
aspects. The number and percentage of pathway targets
and P values are shown in Table 6. A
compound-pathway network map is drawn for the
active components of DBD and the predicted signaling
pathways, see Figure 3. The GO analysis result is
shown in Figure 4. Kaempferol and quercetin are the
active constituents of Huangqi (Radix Astragali) and
Danggui (Radix Angelicae Sinensis), respectively.
They have the highest number of nodes in the
compound-target-pathway network, indicating that
they may be the main component of DBD. Then the
next step is to verify the drug's effectiveness through a
myofibroblast model to verify the accuracy of the
network.
Verification of the effects of quercetin and
kaempferol on myofibroblasts
Effect of quercetin and kaempferol on cell viability
of NIH/3T3 cell line. The results showed that there is
no significant change in cell viability in the quercetin
and kaempferol treatment groups compared with the
normal control group, and there is no statistical
difference (Figure 5). It indicates that the concentration
used for quercetin and kaempferol have no toxic
effects on cells.
Effects of quercetin and kaempferol on the mRNA
expression of α-SMA, collagen1 and fibronectin
induced by TGF-β1 in fibroblasts. The levels of
α-SMA, collagen1 and fibronectin mRNA in the
TGF-β1 group are significantly higher than those in the
normal group. Compared with the model group,
kaempferol and quercetin can significantly inhibit the
increase of α-SMA, collagen1 and fibronectin mRNA
levels in NIH/3T3 cells. The mRNA levels of α-SMA
and collagen1 are dose-dependent in kaempferol
groups, and the levels of α-SMA, collagen1 and
fibronectin mRNA of quercetin groups are
dose-dependent, as shown in Figure 6.
Effects of quercetin and kaempferol on
TGF-β1-induced protein expression of collagen-1
and fibronectin in fibroblasts. Compared with the
normal group, the levels of collagen1 and fibronectin
protein in the TGF-β1 group are significantly higher.
Compared with the TGF-β1 group, medium (10 μM/L)
and high (20 μM/L) dose of kaempferol reduce the
increased collagen1 and fibronectin expression
induced by TGF-β1, as shown in Figure 7A. Different
doses of quercetin reduce collagen1 and fibronectin
protein expression, as shown in Figure 7B.
Table 4 Network and mediators of ten targets
Uniport Abbreviation Node Median
P35354 PTGS2 14 0.314
P07477 PRSS1 9 0.048
P01106 AR 7 0.075
Q92731 ESR2 7 0.075
Q14524 SCN5A 7 0.071
O95433 AHSA1 2 0.005
P08684 CYP3A4 2 0.005
P09488 GSTM1 2 0.005
P09211 GSTP1 2 0.005
Q27J81 TNF 2 0.005
Note: PTGS2, Prostaglandin-endoperoxide synthase 2;
PRSS1, Recombinant protease, serine 1; AR,
Androgen receptor; ESR2, Estrogen receptor 2;
SCN5A, Sodium voltage-gated channel alpha subunit 5;
AHSA1, Activator of HSP90 ATPase activity 1;
CYP3A4, Cytochrome P450 family 3 subfamily a
member 4; GSTM1, Glutathione s-transferase, MU-1;
GSTP1, Glutathione s-transferase, P1.

ARTICLE
doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 246
Table 5 The node and median of Danggui Buxue decoction active ingredients in the network
TCMSP Name Node Median
MOL000098 Quercetin 22 0.712
MOL000422 Kaempferol 10 0.067
MOL000392 Formononetin 6 0.068
MOL000378 7-O-Methylisomucronulatol 5 0.006
MOL000354 Isorhamnetin 4 0.004
MOL000417 Calycosin 4 0.004
MOL000371 3,9-Di-O-methylnissolin 3 0.003
MOL000380
(6aR,11aR)-9,10-dimethoxy-6a,11a-dihydro-6H-ben
zofurano [3,2-c] chromen-3-ol
3 0.003
MOL000239 Jaranol 2 0.006
MOL000551 Hederagenin 2 0.001
MOL000358 Beta-sitosterol 2 0.001
MOL000442 3,9-Di-O-methylnissolin 2 0.001
MOL000387 Bifendate 1 < 0.001
TCMSP, Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform.
Table 6 KEGG metabolic pathway statistics of Danggui Buxue decoction target
Pathway Targets Percent (%) P
T cell receptor signaling pathway 5 0.146 < 0.001
PI3K-Akt signaling pathway 5 0.146 0.010
MAPK signaling pathway 5 0.146 0.004
TNF signaling pathway 4 0.117 0.003
Jak-STAT signaling pathway 4 0.117 0.006
TGF-beta signaling pathway 4 0.117 0.001
FoxO signaling pathway 4 0.117 0.005
HIF-1 signaling pathway 4 0.117 0.002
Estrogen signaling pathway 3 0.088 0.027
MAPK, Mitogen-activated protein kinase; KEGG, Kyoto Encyclopedia of Genes and Genomes; PI3K,
Phosphatidylinositol 3-kinase.
Figure 3 Compound-pathway network

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 247
Figure 4 Gene Ontology analysis
Figure 5 Effect of quercetin and kaempferol on cell viability of NIH/3T3 cell line
Figure 6 Effect of quercetin and kaempferol on mRNA of α-SMA and collagen 1 (x ± s, n = 3)
Note: Compared with the normal control group, a
P < 0.01, b
P < 0.001; compared with the model group, c
P < 0.05,
d
P < 0.01, e
P < 0.001.

ARTICLE
doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 248
Figure 7 Effect of quercetin and kaempferol on protein of collagen-1 and fibronectin (x ± s, n = 3)
Note: Compared with the normal control group, a
P < 0.05, b
P < 0.01, c
P < 0.001; compared with the model group,
d
P < 0.05, e
P < 0.01, f
P < 0.001.
Discussion
The cause of IPF is unknown, and its pathogenesis is
complicated. TCM has the characteristics of
multi-component and multi-target, and it has unique
advantages by forming the component-target network
to treat pulmonary fibrosis. Finding effective
anti-pulmonary fibrosis herbal medicine, formula or
small molecule compounds from TCM is of great
significance for improving the treatment of IPF [25].
In this study, 14 active ingredients and their
corresponding 354 targets were screened from the
Chinese medicine classical prescription DBD using a
network pharmacology tool. At the same time, 401
disease-related targets were screened from the human
disease database, and 26 pairs of active
components-targets were determined after target
interaction. After functional KEGG, and GO analysis,
a compound-target-pathway network was constructed.
Then, the active compounds with higher nodes were
tested by fibrosis related indicators. Further clarify the
mechanism of DBD in the treatment of IPF.
To be sure, candidate compounds with a higher
degree and centrality are very important in DBD. In
Table 2, 7 of the 22 key compounds are known active
compounds. For example, formononetin is an effective
component of DBD, which can be used to reduce
related indicators such as pulmonary edema and lung
cancer [26]. β-sitosterol has been shown to act on lung
inflammation and edema through the NF-κB pathway,
thereby alleviating acute lung injury [27]. It also
includes two well-recognized molecules with high
bioactivity-kaempferol and quercetin. Studies have
shown that kaempferol and quercetin have
anti-infection, anti-inflammation and anti-cancer
effects. However, the main components of Huangqi
(Radix Astragali), such as astragaloside, have
relatively low oral availability. It may be caused by
four reasons: consumption before entering the
organism’s circulation, metabolism of the
gastrointestinal tract, strong efflux and low membrane
permeability. Among these reasons, membrane
permeability may be a key factor in determining the
entry of drugs into the organism. In addition, in future
research, we should pay attention to the compounds of
DBD, such as hederagenin and isolaflavanone, which
may be potential new drugs for the treatment of
pulmonary fibrosis.
Through network analysis, it was found that the top
three candidate active molecules were kaempferol,
quercetin and fordononetin, and the top three targets
were prostaglandin-endoperoxide synthase 2 (PTGS2),
recombinant protease, serine 1 (PRSS1) and androgen
receptor. These active ingredients and targets may play
a key role in the decoction. The targets of the active
ingredients in DBD are participate in signal
transduction, anti-apoptosis, inflammatory reaction and
other processes, and undergoes molecular reactions
such as protein binding, zinc ion binding and ATP
binding, and exerts its pharmacological action in the
nuclear, plasma membrane and cytoplasmic parts. In
addition, there are 26 common targets for DBD and
IPF. Although the number of common targets is small,
it can also play a role in pulmonary fibrosis. PTGS2 is
a key regulatory enzyme in the synthesis of
prostaglandin E2 (PGE2) and prostaglandin D2 [28].
Since PGE2 can inhibit fibroblast proliferation,
collagen synthesis, migration and differentiation into

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 249
myofibroblasts and induce fibroblast apoptosis, it is
considered to be an anti-fibrotic molecule [29].
Fibroblast studies from IPF lungs showed a relative
deficiency production and reduced reactivity in PGE2.
Several studies have shown that bleomycin-induced
fibrosis is enhanced when PTGS2-derived PGE2 is
low or absent [30, 31]. Furthermore, downregulating
the expression of TGF-β1 in fibrotic tissue is a major
cause of ESR mitigation. Estrogen can significantly
inhibit cell proliferation and activation, reduce the
number of ER significantly, decrease the secretion of
TGF-β1, interrupt its own positive feedback, and
reduce fibrosis [32].
According to the compound-target-pathway network
of this study, DBD activates PI3K/Akt and MAPK
pathways mainly through targets such as TGF-β1,
MMP2 and TNF. In addition, it acts on lipid
metabolism, immune and inflammatory reactions, and
fibrosis protection to treat IPF. It is basically consistent
with the possible mechanism of the effects of Danggui
(Radix Angelicae Sinensis) and Huangqi (Radix
Astragali) on IPF. In this process, the TGF-β/Smads
signaling pathway is activated to regulate the
transcription and expression of downstream connective
tissue growth factor and other genes. Furthermore,
extracellular matrix and epithelial-mesenchymal
transition are induced to accelerate the oxidation
reaction, and cytokine imbalance is promoted. The
other signaling pathways such as MAPK and
extracellular regulated protein kinases synergistically
affect cell growth, signal transduction, extracellular
matrix and negative feedback systems and then
causing IPF. As studies have shown that Huangqi
(Radix Astragali) can reduce the activation of
TGF-β1/Smad [33], reduce the expression of MMP2
[34], inhibit epithelial-mesenchymal transition, delay
or even inhibit the occurrence of pulmonary fibrosis. It
has also been confirmed by experiments that both
Danggui (Radix Angelicae Sinensis) and Huangqi
(Radix Astragali) membranaceus can correct the
abnormality of extracellular matrix metabolism and act
on peroxide to prevent and treat pulmonary fibrosis by
regulating the expression of TNF-α and free radical
levels. Huangqi (Radix Astragali) also has an effect on
the activation of related pathways. For example,
astragaloside can significantly inhibit the activation of
TGF-β1/PI3K/Akt [35] and MAPK [6] pathways
during fibrosis, reverse epithelial-mesenchymal
transition, and alleviate pulmonary fibrosis. This is
consistent with the results of this study.
At present, the pathogenesis of pulmonary fibrosis is
still unclear. The hypotheses have inflammation,
abnormal angiogenesis, apoptosis and so on. Abnormal
repair after cell injury plays a decisive role in the
pathogenesis of IPF. The basis of pulmonary fibrosis is
the synthesis and deposition of collagen. TGF-β1 is a
key factor in promoting myofibroblast formation and
subsequent collagen production. The α-SMA is an
important molecule for various types of cell movement
and cytoskeleton maintenance, and it can be inhibited
by fibrotic drugs. And myofibroblasts characterized by
the expression of α-SMA are the main coordinators of
fibrosis in organs such as lung and liver [36].
Myofibroblasts produce large amounts of extracellular
matrix leading to pulmonary fibrosis. TGF-β also
mediates the synthesis, secretion and assembly of type
I collagen corresponding to fibroblast
transdifferentiation, which can affect the expression of
collagen and fibronectin [37, 38]. This study also
further showed that TGF-β1 can stimulate the
occurrence of pulmonary fibrosis, and the expression
of α-SMA, collagen1 and fibronectin decreased after
medicament.
The transformation of fibroblasts into
myofibroblasts leads to the formation of pulmonary
scarring, which is one of the main mechanisms of
pulmonary fibrosis [39]. In the
compound-target-pathway network we constructed,
kaempferol and quercetin accounted for the highest
degree and median, indicating that they may be the
main component of DBD against fibrosis. We validated
the efficacy of the network and drugs through
myofibroblast model. The results showed that both
quercetin and kaempferol could inhibit the activation
of myofibroblast cells induced by TGF-β1. They
reduced the mRNA and protein expression of
fibrosis-related markers such as α-SMA. This is
consistent with previous studies. Previous studies have
shown that quercetin can significantly inhibit TGF-β,
reduce lipid peroxidation by activating NF-κB and
MAPK pathways [40], reverse epithelial-mesenchymal
transition, and inhibit collagen deposition acts on the
fibrosis process [41]. Kaempferol can improve
pulmonary fibrosis by inhibiting the expression of
MMP-1 and tissue inhibitor of metalloproteinase 1,
reversing epithelial-mesenchymal transition [42, 43].
In this study, only molecules with higher oral
availability were selected, and some potential active
molecules may be missed. Therefore, further in-depth
studies can refer to the Angelica and Huangqi (Radix
Astragali) fractions in TCMSP, which contain
important pharmacokinetic information within all
intact compound molecules, including all oral
bioavailability values.
Conclusion
In summary, this study used network pharmacology to
explore the mechanism of DBD in the treatment of IPF
and explained the role of DBD in the treatment of
multi-component, multi-target and multi-channel
pulmonary fibrosis. The experimental verification of
the active ingredients was carried out, which provided
a research basis for further exploring the
pharmacological mechanism of DBD.

ARTICLE
doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 250
Reference
1. Ballester B, Milara J, Cortijo J. Idiopathic
Pulmonary Fibrosis and Lung Cancer:
Mechanisms and Molecular Targets. Int J Mol Sci
2019, 20: E593.
2. Raghu G, Rochwerg B, Zhang Y, et al. An Official
ATS/ERS/JRS/ALAT Clinical Practice Guideline:
Treatment of Idiopathic Pulmonary Fibrosis. An
Update of the 2011 Clinical Practice Guideline.
Am J Respir Crit Care Med 2015,192: e3–19.
3. Li LC, Kan LD. Traditional Chinese medicine for
pulmonary fibrosis therapy: Progress and future
prospects. J ethnopharmacol 2017, 198: 45–63.
4. Guo SF. Application of Traditional Chinese
Medicine Therapy in the Treatment of Idiopathic
Pulmonary Fibrosis. Chin J Inform Tradit Chin
Med 2008, 15: 90–91. (Chinese)
5. Chen MG. Application of Bufei Yishen Method in
the Treatment of Chronic Respiratory Failure
Caused by IPF. Chin J Exp Tradit Med Formulae
2012, 18: 327–329. (Chinese)
6. Xu WJ, Shao XH, Xu XP, et al. Astragaloside IV
attenuates renal tubulointerstitial fibrosis by
inhibiting p38 MAPK signaling. Chin J Nephrol
2014, 30: 770–776.
7. Chen F, Wang PL, Fan XS, et al. Effect of
Renshen Pingfei Decoction, a traditional Chinese
prescription, on IPF induced by Bleomycin in rats
and regulation of TGF-β1/Smad3. J
Ethnopharmacol 2016, 186: 289–297.
8. Wu ZH, Zhang XX. Clinical Observation of Bufei
Huoxue Decoction in Treating Idiopathic
Pulmonary Fibrosis. Beijing J Tradit Chin Med
2010, 29: 118–120. (Chinese)
9. Liu YQ. Danggui Buxue Tang. J Beneficial
Readines Drug Inf Med Adv 2015: 50. (Chinese)
10. Chen Y, Tao YY, Li FH. Effects of Danggui
Buxue Decoction on liver fibrosis and hepatic
lipid peroxidation in rats. Chin J Integr Tradit
West Med 2008, 28: 39–42. (Chinese)
11. Guo T. Anti-liver fibrosis effect of Danggui
Buxue Decoction and its disassembled. In:
proceedings of the National Conference on
Integrative Digestive System Diseases, 2013.
12. Wei MG, He WM, Liu W, et al. Experimental
study on anti-kidney fibrosis of Jiawei Danggui
Buxue Decoction. Chin J Basic Med Tradit Chin
Med 2014: 904–908. (Chinese)
13. Zhao P, Zhou WC, Li DL, et al. Total glucosides
of Danggui Buxue Tang attenuate BLM-induced
pulmonary fibrosis via regulating oxidative stress
by inhibiting NOX4. Oxid Med Cell Longev 2015,
2015: 645814.
14. Liu Y Li J, Gao J. Experimental Study of Danggui
Buxue Decoction on Rat Pulmonary Fibrosis.
Acta Univer Medicinalis Anhui 2009: 594–598.
(Chinese)
15. Zhang YQ, Li X. Some advances in network
pharmacology and modern research of traditional
Chinese medicine. Chin J Pharmacol Toxicol
2015, 29: 883–892. (Chinese)
16. Zhang L, Li Y, Liang C, et al. CCN5
overexpression inhibits profibrotic phenotypes via
the PI3K/Akt signaling pathway in lung
fibroblasts isolated from patients with idiopathic
pulmonary fibrosis and in an in vivo model of
lung fibrosis. Int J Mol Med 2013 ,33: 478–486.
17. Antoniou KM, Margaritopoulos GA, Giannoula S,
et al. Expression analysis of Akt and MAPK
signaling pathways in lung tissue of patients with
idiopathic pulmonary fibrosis (IPF). J Recept
Signal Transduct Res 2010, 30: 262–269.
18. Gibbons MA, Fitch PM, Macduff A, et al.
S124 Macrophage deletion of vHL results in
alternative activation and enhanced lung fibrosis
independent of HIF-1. Thorax 2010, 65: A57.
19. Simonian PL, Roark CL, Diaz del Valle F, et al.
Regulatory role of gammadelta T cells in the
recruitment of CD4+ and CD8+ T cells to lung
and subsequent pulmonary fibrosis. J Immunol
2006, 177: 4436–4443.
20. Epstein SG, Brook E, Israeli-shani L, et al.
Fibroblast paracrine TNF-α signaling elevates
integrin A5 expression in idiopathic pulmonary
fibrosis (IPF). Respir Res 2017,18:122.
21. Watanabe-Takano H, Takano K, Hatano M, et al.
DA-Raf-Mediated Suppression of the Ras-ERK
Pathway Is Essential for TGF-β1-Induced
Epithelial-Mesenchymal Transition in Alveolar
Epithelial Type 2 Cells. PloS One 2015, 10:
e0127888.
22. Nho RS, Im J, Ho YY, et al. MicroRNA-96
inhibits FoxO3a function in IPF fibroblasts on
type I collagen matrix. Am J Physiol Lung Cell
Mol Physiol 2014, 307: 632–642.
23. Ahmed S, Moawad M, Elhefny R, et al. Is toll
like receptor 4 a common pathway hypothesis for
development of lung cancer and idiopathic
pulmonary fibrosis? Egypt J Chest Dis Tuberc
2016, 65: 289–294.
24. Saito S, Zhuang Y, Shan B, et al. Tubastatin
ameliorates pulmonary fibrosis by targeting the
TGFβ-PI3K-Akt pathway. PloS One 2017, 12:
e0186615.
25. Huang H, Peng X, Zhong C. Idiopathic
pulmonary fibrosis: The current status of its
epidemiology, diagnosis, and treatment in China.
Intractable Rare Dis Res 2013, 2: 88–93.
26. Li ZQ Meng XJ. Effects of formononetin on
proliferation and apoptosis of human non-small
cell lung cancer cells and related mechanisms.
Chin J Exp Tradit Med Formulae 2016: 142.
(Chinese)
27. Yao F, Zhou QY, Xiong Y. et al. Protective effect

ARTICLE doi: 10.12032/TMR20191102146
TMR | July 2020 | vol. 5 | no. 4 | 251
of β-sitosterol on lipopolysaccharide-induced
acute lung injury in mice. Chin Agricult Sci Bull
2015, 31: 55–61. (Chinese)
28. Smith WL, Langenbach R. Why there are two
cyclooxygenase isozymes. J Clin Invest 2001, 107:
1491–1495.
29. Huang SK, White ES, Wettlaufer SH, et al.
Prostaglandin E2 induces fibroblast apoptosis by
modulating multiple survival pathways. FASEB J
2009, 23: 4317–4326.
30. Liu F, Mih JD, Shea BS, et al. Feedback
amplification of fibrosis through matrix stiffening
and COX-2 suppression. J Cell Biol 2010, 190:
693–706.
31. Hartney JM, Coggins KG, Tilley SL, et al.
Prostaglandin E2 protects lower airways against
bronchoconstriction. Am J Physiol Lung Cell Mol
Physiol 2006, 290: L105–113.
32. Wang AX Yan XL, Zhao NJ, et al. Pathological
study on the protective effect of sex hormones on
acute lung injury and pulmonary fibrosis caused
by paraquat poisoning. Chin J Lung Diseases
(Electronic Edition), 2013, 6: 20–23. (Chinese)
33. Xu CJ, Wang PF, Huang YW, et al. Intervention
of total flavonoids of Astragalus membranaceus
on miRNA-21, let-7 d and TGF-β/smad signaling
in idiopathic pulmonary fibrosis. Chin Archives
Tradit Chin Med 2018: 1308–1311. (Chinese)
34. Xin JB Xiang F, Wang SZ, et al. Effects of
Astragalus on the expression of MMP-2 and
TIMP-1 in rats with pulmonary fibrosis. In:
proceedings of the National Academic
Conference on Integrated Traditional Chinese and
Western Medicine Respiratory Diseases, 2004.
(Chinese)
35. Qian W, Cai X, Qian Q, et al. Astragaloside IV
modulates TGF-β1-dependent
epithelial-mesenchymal transition in
bleomycin-induced pulmonary fibrosis. J Cell
Mol Med 2018, 22: 4354–4365.
36. Pechkovsky DV, Hackett TL, An SS, et al. Human
lung parenchyma but not proximal bronchi
produces fibroblasts with enhanced TGF-beta
signaling and alpha-SMA expression. Am J
Respir Cell Mol Biol 2010, 43: 641–651.
37. Petrov VV, Fagard RH, Lijnen PJ. Stimulation of
collagen production by TGF-beta1 during
differentiation of cardiac fibroblasts to
myofibroblasts. Hypertension 2002, 39: 258–263.
38. Hocevar BA, Brown TL, Howe PH. TGF-beta
induces fibronectin synthesis through a c-Jun
N-terminal kinase-dependent, Smad4-independent
pathway. EMBO J 1999, 18: 1345–1356.
39. Coward WR, Saini G, Jenkins G. The
pathogenesis of idiopathic pulmonary fibrosis.
Ther Adv Respir Dis 2010, 4: 367–388.
40. Biswajit P, Kyoung Seob S, Ho-Yeon S, et al.
Cytoprotective effect of kaempferol on
paraquat-exposed BEAS-2B cells via modulating
expression of MUC5AC. Biol Pharm Bull 2014,
37: 1486–1494.
41. Gong JH, Cho IH, Shin D, et al. Inhibition of
airway epithelial-to-mesenchymal transition and
fibrosis by kaempferol in endotoxin-induced
epithelial cells and ovalbumin-sensitized mice.
Lab Invest 2014, 94: 297–308.
42. Wang CM, Huang H, Zhang ZX, et al. The
protective effects of quercetin on
Bleomycin-Induced pulmonary fibrosis in rats.
Chin Pharm Bull 2000, 16: 94–96. (Chinese)
43. Zhang X, Cai Y, Zhang W, et al. Quercetin
ameliorates pulmonary fibrosis by inhibiting
SphK1/S1P signaling. Biochem Cell Biol 2018,
96: 742–751.

Dissecting the underlying pharmaceutical mechanism of Danggui Buxue decoction acting on idiopathic pulmonary fibrosis with network pharmacology

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to Dissecting the underlying pharmaceutical mechanism of Danggui Buxue decoction acting on idiopathic pulmonary fibrosis with network pharmacology

Similar to Dissecting the underlying pharmaceutical mechanism of Danggui Buxue decoction acting on idiopathic pulmonary fibrosis with network pharmacology (20)

More from LucyPi1

More from LucyPi1 (20)

Recently uploaded

Recently uploaded (20)

Dissecting the underlying pharmaceutical mechanism of Danggui Buxue decoction acting on idiopathic pulmonary fibrosis with network pharmacology