2 The early Xenopus embryo has animal and vegetal halves A.pdf
•
0 likes•3 views
The early Xenopus embryo has an animal and vegetal half determined by specific gene products, with the animal half expressing genes like VegT and the vegetal half expressing genes like Xcat2. A fate map of this embryo would show the ectoderm arising from the animal half, the endoderm from the vegetal half, and the mesoderm developing between the two halves.
Report
Share
Report
Share
Download to read offline
Recommended
2 The pigment that accumulates in the cells of the stratum s.pdf
2 The pigment that accumulates in the cells of the stratum spinosum is a. actin. b. melanin. c.
keratin. d. collagen. 3 The protein that accumulates in the dead cells of the stratum corneum is a.
actin. b. melanin. c. keratin. d. collagen. In which layer of the epidermis are tactile discs found? a.
Stratum corneum. b. Stratum granulosum. c. Stratum basale. d. Stratum lucidum. e. Stratum
spinosum..
2 The following data for the United States is accurate as o.pdf
2. The following data for the United States is accurate as of January 2023. (Some numbers have
been rounded to make the arithmetic easier). According to this data, what was the unemployment
rate? A. 4.3% B. 2.7% C. 40.6% D. 5.2%.
2 Suppose X and Y are the survival times in days of two w.pdf
2. Suppose X and Y are the survival times (in days) of two white rats that were subjected to
different levels of radiation. Assume that X and Y are independent, fX(x)={(1+x)21,0,x>0
elsewhere.fY(y)={(1+y)32,0,y>0elsewhere. Show all your work and circle your final answers.
Correct answers with no justifications will not receive any marks. a) Give the joint density of X and
Y. b) Find the probability that the second rat outlives the first rat, P[X<Y]..
2 Suppose there are four languages ABCD such that AmBBm.pdf
2. Suppose there are four languages A,B,C,D such that AmB,BmC, DmC. True or false? (a) It
could be the case that A is not recursive and C is decidable. (b) If C is recursive, then D is
decidable. (c) If C is Turing recognizable, then BD is recursively enumerable..
2 Suppose that x1x2xn form a random sumple from o distr.pdf
This document asks to: 1) Write the likelihood function L in simplified form for a random sample from an exponential distribution over the interval [0,10]; 2) Write the log-likelihood ln(L) in simplified form; 3) Find the maximum likelihood estimate (MLE) of the parameter by taking the derivative of ln(L) and setting it equal to 0; 4) Given a sample, calculate the numerical value of the MLE of the first quartile Q1 of the distribution.
2 Suppose that X1X2Xn is a random sample from the N1.pdf
2. Suppose that X1,X2,,Xn is a random sample from the N(,1). (a). Find the CRLB for variances of
unbiased estimators of . (b). Find the M.L.E. ^ of . (c). Is ^ in (b) a UMVU estimator of ?.
2 Suppose that n identical balls are distributed randomly a.pdf
2. Suppose that n identical balls are distributed randomly among m boxes. Construct the
corresponding space of elementary outcomes. Assuming that each ball is placed in a random box
with equal probability, find the probability that the first box is empty..
2 points For computerclusters with shareddisks discuss .pdf
(2 points) For computer-clusters with shared-disks, discuss some of the advantages that have
made these configurations as popular as they have become, aside from the obvious data sharing
and load balancing advantages.
(1 point) Metropolitan Area Networks (MANs) typically are larger in geographic scope that LANs
but within a range of about 30 miles or less, and commonly include network lines that must cross
over someones property. Such network lines sometime require permission involving a concept
called:
Edge-Router
Domain-Name-Service
Right-of-Way Access
Ethernet-Star-Topology
(1 point) The Internet connectivity is primarily made up of connections between
National, Regional, and Local ISPs
The US Government
National and International CSPs
International WANs
(1 point) Which entity creates the standards for the Internet?
ISO
IETF
ISPs
IEEE
(1 point) Packets in the Data Link Layer of TCP/IP are called
Packets
Series datagrams
TCP datagrams
Frames
(1 point) Ethernet is the trade name for what is technically known as:
CSMA-CD protocol
CSMA-SA protocol
LAN connectivity
WAN connectivity
(1 point) The amount of time it takes for a packet to get from one end of the network to the other is
called:
TCP/IP
Network jitter
Network propagation delay
Collision-avoidance delay
(1 point) The Bandwidth of channel is the range of frequencies that are passed by the channel with
a large amount of attenuation (True/False).
(1 point) Its common for the CPU to be switched from one program to another and execute a few
instructions of each program using a clock-timed interrupt method. This is called:
Threading
Time-slicing
Multiprogramming
Non-preemptive switching
(1 point) What systems tools are available within Windows in the control-alt-delete menu?
(1 point) What do we mean when we call and operating system event-driven?
(1 Point) Which function among the OS functions handles plug-and-play devices?
Memory Management
The File Mgmt System
The I/O control function
Network Management
(1 point) Operating systems that sometimes have applications which handle I/O devises, and
which must respond within a short specific timeframe are called
Mobile
Real time
Distributed
Single user
(2 points) What are two key purposes of the operating systems user interfaces?
(1 point) The __________of a file is how it data is actually stored in it.
Physical view
Real view
Logical view
Image view
(1 point) The bootstrap is a read-write eligible program. (True/False)
(2 points) Describe how the bootstrap process (the IPL process) works.
(2 points) Invert this binary number and then convert it to the hexadecimal equivalent:
1110110010000000 is equivalent to ___________________________________ ?
2 16
-3
(1 point) What is the number 1326.5 x 10 without the exponential notation?
(3 points) What is the largest decimal positive integer that can be stored in 2 bytes using:
16
An unsigned integer___________________. Answer 2 -1 65,536 - 1 = 65,535
15
An integer using a sign bit _______________. Answe.
Recommended
2 The pigment that accumulates in the cells of the stratum s.pdf
2 The pigment that accumulates in the cells of the stratum spinosum is a. actin. b. melanin. c.
keratin. d. collagen. 3 The protein that accumulates in the dead cells of the stratum corneum is a.
actin. b. melanin. c. keratin. d. collagen. In which layer of the epidermis are tactile discs found? a.
Stratum corneum. b. Stratum granulosum. c. Stratum basale. d. Stratum lucidum. e. Stratum
spinosum..
2 The following data for the United States is accurate as o.pdf
2. The following data for the United States is accurate as of January 2023. (Some numbers have
been rounded to make the arithmetic easier). According to this data, what was the unemployment
rate? A. 4.3% B. 2.7% C. 40.6% D. 5.2%.
2 Suppose X and Y are the survival times in days of two w.pdf
2. Suppose X and Y are the survival times (in days) of two white rats that were subjected to
different levels of radiation. Assume that X and Y are independent, fX(x)={(1+x)21,0,x>0
elsewhere.fY(y)={(1+y)32,0,y>0elsewhere. Show all your work and circle your final answers.
Correct answers with no justifications will not receive any marks. a) Give the joint density of X and
Y. b) Find the probability that the second rat outlives the first rat, P[X<Y]..
2 Suppose there are four languages ABCD such that AmBBm.pdf
2. Suppose there are four languages A,B,C,D such that AmB,BmC, DmC. True or false? (a) It
could be the case that A is not recursive and C is decidable. (b) If C is recursive, then D is
decidable. (c) If C is Turing recognizable, then BD is recursively enumerable..
2 Suppose that x1x2xn form a random sumple from o distr.pdf
This document asks to: 1) Write the likelihood function L in simplified form for a random sample from an exponential distribution over the interval [0,10]; 2) Write the log-likelihood ln(L) in simplified form; 3) Find the maximum likelihood estimate (MLE) of the parameter by taking the derivative of ln(L) and setting it equal to 0; 4) Given a sample, calculate the numerical value of the MLE of the first quartile Q1 of the distribution.
2 Suppose that X1X2Xn is a random sample from the N1.pdf
2. Suppose that X1,X2,,Xn is a random sample from the N(,1). (a). Find the CRLB for variances of
unbiased estimators of . (b). Find the M.L.E. ^ of . (c). Is ^ in (b) a UMVU estimator of ?.
2 Suppose that n identical balls are distributed randomly a.pdf
2. Suppose that n identical balls are distributed randomly among m boxes. Construct the
corresponding space of elementary outcomes. Assuming that each ball is placed in a random box
with equal probability, find the probability that the first box is empty..
2 points For computerclusters with shareddisks discuss .pdf
(2 points) For computer-clusters with shared-disks, discuss some of the advantages that have
made these configurations as popular as they have become, aside from the obvious data sharing
and load balancing advantages.
(1 point) Metropolitan Area Networks (MANs) typically are larger in geographic scope that LANs
but within a range of about 30 miles or less, and commonly include network lines that must cross
over someones property. Such network lines sometime require permission involving a concept
called:
Edge-Router
Domain-Name-Service
Right-of-Way Access
Ethernet-Star-Topology
(1 point) The Internet connectivity is primarily made up of connections between
National, Regional, and Local ISPs
The US Government
National and International CSPs
International WANs
(1 point) Which entity creates the standards for the Internet?
ISO
IETF
ISPs
IEEE
(1 point) Packets in the Data Link Layer of TCP/IP are called
Packets
Series datagrams
TCP datagrams
Frames
(1 point) Ethernet is the trade name for what is technically known as:
CSMA-CD protocol
CSMA-SA protocol
LAN connectivity
WAN connectivity
(1 point) The amount of time it takes for a packet to get from one end of the network to the other is
called:
TCP/IP
Network jitter
Network propagation delay
Collision-avoidance delay
(1 point) The Bandwidth of channel is the range of frequencies that are passed by the channel with
a large amount of attenuation (True/False).
(1 point) Its common for the CPU to be switched from one program to another and execute a few
instructions of each program using a clock-timed interrupt method. This is called:
Threading
Time-slicing
Multiprogramming
Non-preemptive switching
(1 point) What systems tools are available within Windows in the control-alt-delete menu?
(1 point) What do we mean when we call and operating system event-driven?
(1 Point) Which function among the OS functions handles plug-and-play devices?
Memory Management
The File Mgmt System
The I/O control function
Network Management
(1 point) Operating systems that sometimes have applications which handle I/O devises, and
which must respond within a short specific timeframe are called
Mobile
Real time
Distributed
Single user
(2 points) What are two key purposes of the operating systems user interfaces?
(1 point) The __________of a file is how it data is actually stored in it.
Physical view
Real view
Logical view
Image view
(1 point) The bootstrap is a read-write eligible program. (True/False)
(2 points) Describe how the bootstrap process (the IPL process) works.
(2 points) Invert this binary number and then convert it to the hexadecimal equivalent:
1110110010000000 is equivalent to ___________________________________ ?
2 16
-3
(1 point) What is the number 1326.5 x 10 without the exponential notation?
(3 points) What is the largest decimal positive integer that can be stored in 2 bytes using:
16
An unsigned integer___________________. Answer 2 -1 65,536 - 1 = 65,535
15
An integer using a sign bit _______________. Answe.
2 Studies suggest that 6 of all American adults consider t.pdf
2. Studies suggest that 6% of all American adults consider themselves to be atheist. In a rando
sample of twenty-five adults, find the probability that (a) none are atheist (b) at least one is an
atheist (c) exactly three are athiest.
2 Please state your goal using the SMART Method Specific .pdf
2) Please state your goal using the SMART Method: Specific: Avoid generalities! Your goal should
have specific details so you know what you are achiev Measurable: Make sure you have solid
criteria for establishing your progress toward your goal. Actionable: You can clearly define action
steps towards your goal Rewarding: Your goal must be something that is meaningful and
worthwhile. Time Specific: Having specific dates for beginning and finishing goals keeps you on
track..
2 prrafo cada uno 1 Qu caractersticas de los barrios m.pdf
2 prrafo cada uno
1. Qu caractersticas de los barrios marginales son ms problemticas desde el punto de vista de un
economista urbano frente al de un planificador urbano? Son estas caractersticas las mismas
cuando se asume una perspectiva poltica?
2) Qu recomendaciones de poltica se le ocurren para resolver la crisis actual de los barrios
marginales y para mejorar los medios de vida de los habitantes informales de las ciudades? Cmo
pueden los proyectos de renovacin urbana convertirse en una solucin sostenible para los pobres?.
2 Queens Corporation QC has a net profit margin NPM of .pdf
2) Queens Corporation (QC) has a net profit margin (NPM) of 5%, a total asset turnover of 1 , total
assets of $30 million, and a book value of equity of $20 million. QC also has 2 million shares
outstanding, and a market price of $20 per share..
2 Prof Mincyte in her guest lecture on Environmental Soci.pdf
2. Prof. Mincyte, in her guest lecture on Environmental Sociology talked about environmental
justice. Explain what environmental justice means and provide an example, clearly. explaining how
your example illustrates the issue of environmental justice/injustice. 3. The reading by Erica
Obendorfer, et. al., "Green Roofs as Urban Ecosystems" discusses how planted rooftops provide
ecosystem services..
2 points A patient sustains a serious injury to their cerebe.pdf
2 points A patient sustains a serious injury to their cerebellum. What problems might this patient
suffer from? The patient would have trouble processing sensory information. The patient would be
unable to regulate numerous homeostatic processes. The patient would have difficulty with higher-
order processes such as critical thinking and emotional regulation. The patient would struggle with
coordination..
2 points Identify the correct order of events i synaptic v.pdf
2 points Identify the correct order of events. i. synaptic vesicles fuse with presynaptic membrane ii.
ligand-gated channels in the postsynaptic membrane open iii. Ca2+ ions enter presynaptic area iv.
neurotransmitters are released into the synaptic cleft iv, iii, ii, i iii, i, iv, ii I, ii, iii, iv.
2 points During muscle contraction the myosin head can only.pdf
2 points During muscle contraction, the myosin head can only bind to actin if . Select two. Calcium
is present. Calcium is absent. Troponin and tropomyosin cover the myosin binding sites. ATP has
been hydrolyzed to ADP and Pi.
2 points A patient sustains a serious injury to their tempor.pdf
2 points A patient sustains a serious injury to their temporal lobe. What problems might this patient
suffer from? The patient would have trouble processing auditory information. The patient would be
unable to regulate numerous homeostatic processes. The patient would have difficulty with
decision-making. The patient would be unable to speak or read..
2 Let X be a nonnegative random variable with probability .pdf
2. Let X be a non-negative random variable with probability density function (pdf) f. (a) Show that
EX=0P(Xx)dx. (b) Using (a), show that E[X]=0x1P(Xx) d x for any >0. [1].
2 One strand of a doublehelical DNA has the sequence 5.pdf
#2) One strand of a double-helical DNA has the sequence (5)
GCGCAATATTTCTCAAAATATTGCGC (3).
A. Write the base sequence of the complementary strand below the sequence of the given strand.
B. What special type of sequence is contained in this DNA segment?
C. Does the double-stranded DNA have the potential to form any alternative structures?.
2 Mono Lake food web Based on the video draw a detailed d.pdf
2. Mono Lake food web. Based on the video, draw a detailed diagram of the Mono Lake food web.
(4 pts) - Yes... I said "draw". Use a simple word processing program, a web whiteboard, or just a
pencil/paper. Upload your file. - Be sure to show the initial energy source. i.e. Where are the
producers getting their energy? - Use the correct terms to label each trophic level (e.g. producers)
..... and include at least 3 trophic levels. - Be sure it is a web and not a simple chain..
2 Modify the servlet from the previous part The new servle.pdf
2. Modify the servlet from the previous part. The new servlet should add cookies for firstName,
LastName, birthDay and Sex.
a. Create a Servlet (called fcc) that reads the four cookies and displays their values. Add a link
under your HTML form to invoke the ReadCookie Servlet.(hint: doGet/doPost)
b. Create another servlet that count the number of visits using cookies.
2 Longterm studies of recognized individuals indicate that.pdf
2. Long-term studies of recognized individuals indicate that males engage in different reproductive
strategies at different times in their lives. Some researchers emphasize the "friendships" that
young males establish with females in the groups the males are trying to join. Others emphasize
the value of heterosexual friendships to older, more mature males. Briefly evaluate each of these
explanations, considering how similar behavioral interactions might reflect the different competitive
abilities of young versus mature males..
2 LightValue enum Write a simple Enum named LightValue whi.pdf
2. LightValue enum
Write a simple Enum named LightValue, which lists the phases a particular stoplight lane may be
in. These states should include GREEN, RED, and LEFT_SIGNAL (we are considering yellow to
be part of green). Each TwoWayRoad instance (defined below) will have its own LightValue, which
should correspond to the following rules:
GREEN indicates that the right and middle lanes may proceed, but the left lane cannot (for both
directions).
RED indicates that no lane may proceed (for both directions).
LEFT_SIGNAL indicates that left can proceed, but the right and middle lanes cannot (for both
directions).
Cars in a particular lane may proceed (dequeue one car per time interval) when it is their turn to
go, according to the rules above. If you still need help with Java Enum types, you can read about
them in this Java tutorial.
3. Vehicle Class
Write a fully documented class named Vehicle. This class represents a car which passes through
the intersection. Each instance must contain the serialId (the first car to arrive at the intersection is
serialId 1, the second car to arrive is serialId 2, the n'th car to arrive will have serialId >n) and the
time it arrived (stored as an int). The car must be initialized with a serialId and the time it arrived.
The serial counter is static and stores the number of vehicles that have arrived at the intersection
so far. It is the only variable that is modifiable.
The Vehicle class itself is actually immutable. This means once it has been constructed, no data
within the instance can be changed (the static serialCounter can and should be incremented on
each constructor call). From the UML diagram, note that the public constructor takes all the
member variables as arguments. Data can still be read via the getter methods.
private static int serialCounter = 0
private int serialId
private int timeArrived
public Vehicle(int initTimeArrived)
Brief:
Default Constructor. You should automatically increment the serialCounter, and set the serialId to
its new value.
Parameters:
initTimeArrived
Time the vehicle arrived at the intersection.
Preconditions:
initTimeArrived > 0.
Throws:
IllegalArgumentException
If initTimeArrived 0.
4. VehicleQueue class
Lanes in our simulator will be modelled as a Queue of Vehicles. You may implement a Queue of
vehicles however you like, and are encouraged to use any Java API class you prefer. Remember
that the VehicleQueue class must implement the following methods in order to comply with the
Queue ADT:
void enqueue(Vehicle v)
Vehicle dequeue()
int size()
boolean isEmpty()
Note: If you decide to use a Java API class to implement VehicleQueue, you must use inheritance
(extend a Java API class) to simplify the class definition.
5. TwoWayRoad Class
Write a fully documented class called TwoWayRoad that represents one of the roads in our
intersection. Each road it bi-directional, with each direction having three lanes - a left turn lane, a
middle lane, and a right turn lane. Lanes, modelled.
2 Let X1Xn be a random sample from Poisson distribution P.pdf
2. Let X1,,Xn be a random sample from Poisson distribution P(),>0. (1) (10 points) Find a
complete sufficient statistic for . (2) (15 points) Find the UMVUE of P(X1=0)=exp(). (Hint: I(X1=0)
is an unbiased estimator of exp() ). (3) (15 points) Find the CFR lower bound for all unbiased
estimators of exp()..
2 List and describe two unique evolutionary adaptations tha.pdf
2. List and describe two unique evolutionary adaptations that have occurred to further the success
of angiosperins in their ife cycie: (2 points)uterebion of eletrents ( 3 points)4. Describe
transpiration in plants. What challenges does a plant have in very arid environments? (3 points)6.
Combine your own diagrams and discussion to compare the gymnosperm life cycle (fiom unit 1)
with me angiospeem ilfe cycie (4 points)7. Describe the acid growth hypothesis for cell elongation
in plants. (2 points).
2 If the pH of a system is falling is it becoming more aci.pdf
2. If the pH of a system is falling, is it becoming more acidic or more basic? a. Does that mean it
has more or less H+ions? b. Based on this, will a buffer need to produce H+ions or take them up?
c. Look at the bicarbonate buffer system. If pH is falling will that favor the formation or dissociation
of carbonic acid (H2CO3) ?.
2 In one of your assigned videos CO2 consumption is demonst.pdf
2. In one of your assigned videos CO2 consumption is demonstrated in the process of
photosynthesis. The chemical indicator used to show this was IODINE POTASSIUM IODIDE
CALCIUM CHLORIDE PHENOL RED BROMOTHYMOL BLUE CALCIUM CARBONATE.
2 Let X be a normal distributed random variable with 4 and.pdf
2. Let X be a normal distributed random variable with =4 and standard deviation =1.5. a) Find Pr(X
<10). Graphically represent your findings. b) Find Pr(X>10). Graphically represent your findings. c)
Find Pr(8<X<10). Graphically represent your findings. d) Find a number x such that Pr(X<x)=0.975
. Graphically represent your findings. e) Find a number x such that Pr(X>x)=0.025. Graphically
represent your findings. f) What share of the sample lives between 2 standard deviation of the
mean?.
More Related Content
More from advalue015
2 Studies suggest that 6 of all American adults consider t.pdf
2. Studies suggest that 6% of all American adults consider themselves to be atheist. In a rando
sample of twenty-five adults, find the probability that (a) none are atheist (b) at least one is an
atheist (c) exactly three are athiest.
2 Please state your goal using the SMART Method Specific .pdf
2) Please state your goal using the SMART Method: Specific: Avoid generalities! Your goal should
have specific details so you know what you are achiev Measurable: Make sure you have solid
criteria for establishing your progress toward your goal. Actionable: You can clearly define action
steps towards your goal Rewarding: Your goal must be something that is meaningful and
worthwhile. Time Specific: Having specific dates for beginning and finishing goals keeps you on
track..
2 prrafo cada uno 1 Qu caractersticas de los barrios m.pdf
2 prrafo cada uno
1. Qu caractersticas de los barrios marginales son ms problemticas desde el punto de vista de un
economista urbano frente al de un planificador urbano? Son estas caractersticas las mismas
cuando se asume una perspectiva poltica?
2) Qu recomendaciones de poltica se le ocurren para resolver la crisis actual de los barrios
marginales y para mejorar los medios de vida de los habitantes informales de las ciudades? Cmo
pueden los proyectos de renovacin urbana convertirse en una solucin sostenible para los pobres?.
2 Queens Corporation QC has a net profit margin NPM of .pdf
2) Queens Corporation (QC) has a net profit margin (NPM) of 5%, a total asset turnover of 1 , total
assets of $30 million, and a book value of equity of $20 million. QC also has 2 million shares
outstanding, and a market price of $20 per share..
2 Prof Mincyte in her guest lecture on Environmental Soci.pdf
2. Prof. Mincyte, in her guest lecture on Environmental Sociology talked about environmental
justice. Explain what environmental justice means and provide an example, clearly. explaining how
your example illustrates the issue of environmental justice/injustice. 3. The reading by Erica
Obendorfer, et. al., "Green Roofs as Urban Ecosystems" discusses how planted rooftops provide
ecosystem services..
2 points A patient sustains a serious injury to their cerebe.pdf
2 points A patient sustains a serious injury to their cerebellum. What problems might this patient
suffer from? The patient would have trouble processing sensory information. The patient would be
unable to regulate numerous homeostatic processes. The patient would have difficulty with higher-
order processes such as critical thinking and emotional regulation. The patient would struggle with
coordination..
2 points Identify the correct order of events i synaptic v.pdf
2 points Identify the correct order of events. i. synaptic vesicles fuse with presynaptic membrane ii.
ligand-gated channels in the postsynaptic membrane open iii. Ca2+ ions enter presynaptic area iv.
neurotransmitters are released into the synaptic cleft iv, iii, ii, i iii, i, iv, ii I, ii, iii, iv.
2 points During muscle contraction the myosin head can only.pdf
2 points During muscle contraction, the myosin head can only bind to actin if . Select two. Calcium
is present. Calcium is absent. Troponin and tropomyosin cover the myosin binding sites. ATP has
been hydrolyzed to ADP and Pi.
2 points A patient sustains a serious injury to their tempor.pdf
2 points A patient sustains a serious injury to their temporal lobe. What problems might this patient
suffer from? The patient would have trouble processing auditory information. The patient would be
unable to regulate numerous homeostatic processes. The patient would have difficulty with
decision-making. The patient would be unable to speak or read..
2 Let X be a nonnegative random variable with probability .pdf
2. Let X be a non-negative random variable with probability density function (pdf) f. (a) Show that
EX=0P(Xx)dx. (b) Using (a), show that E[X]=0x1P(Xx) d x for any >0. [1].
2 One strand of a doublehelical DNA has the sequence 5.pdf
#2) One strand of a double-helical DNA has the sequence (5)
GCGCAATATTTCTCAAAATATTGCGC (3).
A. Write the base sequence of the complementary strand below the sequence of the given strand.
B. What special type of sequence is contained in this DNA segment?
C. Does the double-stranded DNA have the potential to form any alternative structures?.
2 Mono Lake food web Based on the video draw a detailed d.pdf
2. Mono Lake food web. Based on the video, draw a detailed diagram of the Mono Lake food web.
(4 pts) - Yes... I said "draw". Use a simple word processing program, a web whiteboard, or just a
pencil/paper. Upload your file. - Be sure to show the initial energy source. i.e. Where are the
producers getting their energy? - Use the correct terms to label each trophic level (e.g. producers)
..... and include at least 3 trophic levels. - Be sure it is a web and not a simple chain..
2 Modify the servlet from the previous part The new servle.pdf
2. Modify the servlet from the previous part. The new servlet should add cookies for firstName,
LastName, birthDay and Sex.
a. Create a Servlet (called fcc) that reads the four cookies and displays their values. Add a link
under your HTML form to invoke the ReadCookie Servlet.(hint: doGet/doPost)
b. Create another servlet that count the number of visits using cookies.
2 Longterm studies of recognized individuals indicate that.pdf
2. Long-term studies of recognized individuals indicate that males engage in different reproductive
strategies at different times in their lives. Some researchers emphasize the "friendships" that
young males establish with females in the groups the males are trying to join. Others emphasize
the value of heterosexual friendships to older, more mature males. Briefly evaluate each of these
explanations, considering how similar behavioral interactions might reflect the different competitive
abilities of young versus mature males..
2 LightValue enum Write a simple Enum named LightValue whi.pdf
2. LightValue enum
Write a simple Enum named LightValue, which lists the phases a particular stoplight lane may be
in. These states should include GREEN, RED, and LEFT_SIGNAL (we are considering yellow to
be part of green). Each TwoWayRoad instance (defined below) will have its own LightValue, which
should correspond to the following rules:
GREEN indicates that the right and middle lanes may proceed, but the left lane cannot (for both
directions).
RED indicates that no lane may proceed (for both directions).
LEFT_SIGNAL indicates that left can proceed, but the right and middle lanes cannot (for both
directions).
Cars in a particular lane may proceed (dequeue one car per time interval) when it is their turn to
go, according to the rules above. If you still need help with Java Enum types, you can read about
them in this Java tutorial.
3. Vehicle Class
Write a fully documented class named Vehicle. This class represents a car which passes through
the intersection. Each instance must contain the serialId (the first car to arrive at the intersection is
serialId 1, the second car to arrive is serialId 2, the n'th car to arrive will have serialId >n) and the
time it arrived (stored as an int). The car must be initialized with a serialId and the time it arrived.
The serial counter is static and stores the number of vehicles that have arrived at the intersection
so far. It is the only variable that is modifiable.
The Vehicle class itself is actually immutable. This means once it has been constructed, no data
within the instance can be changed (the static serialCounter can and should be incremented on
each constructor call). From the UML diagram, note that the public constructor takes all the
member variables as arguments. Data can still be read via the getter methods.
private static int serialCounter = 0
private int serialId
private int timeArrived
public Vehicle(int initTimeArrived)
Brief:
Default Constructor. You should automatically increment the serialCounter, and set the serialId to
its new value.
Parameters:
initTimeArrived
Time the vehicle arrived at the intersection.
Preconditions:
initTimeArrived > 0.
Throws:
IllegalArgumentException
If initTimeArrived 0.
4. VehicleQueue class
Lanes in our simulator will be modelled as a Queue of Vehicles. You may implement a Queue of
vehicles however you like, and are encouraged to use any Java API class you prefer. Remember
that the VehicleQueue class must implement the following methods in order to comply with the
Queue ADT:
void enqueue(Vehicle v)
Vehicle dequeue()
int size()
boolean isEmpty()
Note: If you decide to use a Java API class to implement VehicleQueue, you must use inheritance
(extend a Java API class) to simplify the class definition.
5. TwoWayRoad Class
Write a fully documented class called TwoWayRoad that represents one of the roads in our
intersection. Each road it bi-directional, with each direction having three lanes - a left turn lane, a
middle lane, and a right turn lane. Lanes, modelled.
2 Let X1Xn be a random sample from Poisson distribution P.pdf
2. Let X1,,Xn be a random sample from Poisson distribution P(),>0. (1) (10 points) Find a
complete sufficient statistic for . (2) (15 points) Find the UMVUE of P(X1=0)=exp(). (Hint: I(X1=0)
is an unbiased estimator of exp() ). (3) (15 points) Find the CFR lower bound for all unbiased
estimators of exp()..
2 List and describe two unique evolutionary adaptations tha.pdf
2. List and describe two unique evolutionary adaptations that have occurred to further the success
of angiosperins in their ife cycie: (2 points)uterebion of eletrents ( 3 points)4. Describe
transpiration in plants. What challenges does a plant have in very arid environments? (3 points)6.
Combine your own diagrams and discussion to compare the gymnosperm life cycle (fiom unit 1)
with me angiospeem ilfe cycie (4 points)7. Describe the acid growth hypothesis for cell elongation
in plants. (2 points).
2 If the pH of a system is falling is it becoming more aci.pdf
2. If the pH of a system is falling, is it becoming more acidic or more basic? a. Does that mean it
has more or less H+ions? b. Based on this, will a buffer need to produce H+ions or take them up?
c. Look at the bicarbonate buffer system. If pH is falling will that favor the formation or dissociation
of carbonic acid (H2CO3) ?.
2 In one of your assigned videos CO2 consumption is demonst.pdf
2. In one of your assigned videos CO2 consumption is demonstrated in the process of
photosynthesis. The chemical indicator used to show this was IODINE POTASSIUM IODIDE
CALCIUM CHLORIDE PHENOL RED BROMOTHYMOL BLUE CALCIUM CARBONATE.
2 Let X be a normal distributed random variable with 4 and.pdf
2. Let X be a normal distributed random variable with =4 and standard deviation =1.5. a) Find Pr(X
<10). Graphically represent your findings. b) Find Pr(X>10). Graphically represent your findings. c)
Find Pr(8<X<10). Graphically represent your findings. d) Find a number x such that Pr(X<x)=0.975
. Graphically represent your findings. e) Find a number x such that Pr(X>x)=0.025. Graphically
represent your findings. f) What share of the sample lives between 2 standard deviation of the
mean?.
More from advalue015 (20)
2 Studies suggest that 6 of all American adults consider t.pdf
2 Studies suggest that 6 of all American adults consider t.pdf
2 Please state your goal using the SMART Method Specific .pdf
2 Please state your goal using the SMART Method Specific .pdf
2 prrafo cada uno 1 Qu caractersticas de los barrios m.pdf
2 prrafo cada uno 1 Qu caractersticas de los barrios m.pdf
2 Queens Corporation QC has a net profit margin NPM of .pdf
2 Queens Corporation QC has a net profit margin NPM of .pdf
2 Prof Mincyte in her guest lecture on Environmental Soci.pdf
2 Prof Mincyte in her guest lecture on Environmental Soci.pdf
2 points A patient sustains a serious injury to their cerebe.pdf
2 points A patient sustains a serious injury to their cerebe.pdf
2 points Identify the correct order of events i synaptic v.pdf
2 points Identify the correct order of events i synaptic v.pdf
2 points During muscle contraction the myosin head can only.pdf
2 points During muscle contraction the myosin head can only.pdf
2 points A patient sustains a serious injury to their tempor.pdf
2 points A patient sustains a serious injury to their tempor.pdf
2 Let X be a nonnegative random variable with probability .pdf
2 Let X be a nonnegative random variable with probability .pdf
2 One strand of a doublehelical DNA has the sequence 5.pdf
2 One strand of a doublehelical DNA has the sequence 5.pdf
2 Mono Lake food web Based on the video draw a detailed d.pdf
2 Mono Lake food web Based on the video draw a detailed d.pdf
2 Modify the servlet from the previous part The new servle.pdf
2 Modify the servlet from the previous part The new servle.pdf
2 Longterm studies of recognized individuals indicate that.pdf
2 Longterm studies of recognized individuals indicate that.pdf
2 LightValue enum Write a simple Enum named LightValue whi.pdf
2 LightValue enum Write a simple Enum named LightValue whi.pdf
2 Let X1Xn be a random sample from Poisson distribution P.pdf
2 Let X1Xn be a random sample from Poisson distribution P.pdf
2 List and describe two unique evolutionary adaptations tha.pdf
2 List and describe two unique evolutionary adaptations tha.pdf
2 If the pH of a system is falling is it becoming more aci.pdf
2 If the pH of a system is falling is it becoming more aci.pdf
2 In one of your assigned videos CO2 consumption is demonst.pdf
2 In one of your assigned videos CO2 consumption is demonst.pdf
2 Let X be a normal distributed random variable with 4 and.pdf
2 Let X be a normal distributed random variable with 4 and.pdf
Recently uploaded
How to Add Chatter in the odoo 17 ERP Module
In Odoo, the chatter is like a chat tool that helps you work together on records. You can leave notes and track things, making it easier to talk with your team and partners. Inside chatter, all communication history, activity, and changes will be displayed.
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
Denis is a dynamic and results-driven Chief Information Officer (CIO) with a distinguished career spanning information systems analysis and technical project management. With a proven track record of spearheading the design and delivery of cutting-edge Information Management solutions, he has consistently elevated business operations, streamlined reporting functions, and maximized process efficiency.
Certified as an ISO/IEC 27001: Information Security Management Systems (ISMS) Lead Implementer, Data Protection Officer, and Cyber Risks Analyst, Denis brings a heightened focus on data security, privacy, and cyber resilience to every endeavor.
His expertise extends across a diverse spectrum of reporting, database, and web development applications, underpinned by an exceptional grasp of data storage and virtualization technologies. His proficiency in application testing, database administration, and data cleansing ensures seamless execution of complex projects.
What sets Denis apart is his comprehensive understanding of Business and Systems Analysis technologies, honed through involvement in all phases of the Software Development Lifecycle (SDLC). From meticulous requirements gathering to precise analysis, innovative design, rigorous development, thorough testing, and successful implementation, he has consistently delivered exceptional results.
Throughout his career, he has taken on multifaceted roles, from leading technical project management teams to owning solutions that drive operational excellence. His conscientious and proactive approach is unwavering, whether he is working independently or collaboratively within a team. His ability to connect with colleagues on a personal level underscores his commitment to fostering a harmonious and productive workplace environment.
Date: May 29, 2024
Tags: Information Security, ISO/IEC 27001, ISO/IEC 42001, Artificial Intelligence, GDPR
-------------------------------------------------------------------------------
Find out more about ISO training and certification services
Training: ISO/IEC 27001 Information Security Management System - EN | PECB
ISO/IEC 42001 Artificial Intelligence Management System - EN | PECB
General Data Protection Regulation (GDPR) - Training Courses - EN | PECB
Webinars: https://pecb.com/webinars
Article: https://pecb.com/article
-------------------------------------------------------------------------------
For more information about PECB:
Website: https://pecb.com/
LinkedIn: https://www.linkedin.com/company/pecb/
Facebook: https://www.facebook.com/PECBInternational/
Slideshare: http://www.slideshare.net/PECBCERTIFICATION
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Natural birth techniques - Mrs.Akanksha Trivedi Rama UniversityAkanksha trivedi rama nursing college kanpur.
Natural birth techniques are various type such as/ water birth , alexender method, hypnosis, bradley method, lamaze method etcExploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar KanvariaChapter wise All Notes of First year Basic Civil Engineering.pptx
Chapter wise All Notes of First year Basic Civil Engineering
Syllabus
Chapter-1
Introduction to objective, scope and outcome the subject
Chapter 2
Introduction: Scope and Specialization of Civil Engineering, Role of civil Engineer in Society, Impact of infrastructural development on economy of country.
Chapter 3
Surveying: Object Principles & Types of Surveying; Site Plans, Plans & Maps; Scales & Unit of different Measurements.
Linear Measurements: Instruments used. Linear Measurement by Tape, Ranging out Survey Lines and overcoming Obstructions; Measurements on sloping ground; Tape corrections, conventional symbols. Angular Measurements: Instruments used; Introduction to Compass Surveying, Bearings and Longitude & Latitude of a Line, Introduction to total station.
Levelling: Instrument used Object of levelling, Methods of levelling in brief, and Contour maps.
Chapter 4
Buildings: Selection of site for Buildings, Layout of Building Plan, Types of buildings, Plinth area, carpet area, floor space index, Introduction to building byelaws, concept of sun light & ventilation. Components of Buildings & their functions, Basic concept of R.C.C., Introduction to types of foundation
Chapter 5
Transportation: Introduction to Transportation Engineering; Traffic and Road Safety: Types and Characteristics of Various Modes of Transportation; Various Road Traffic Signs, Causes of Accidents and Road Safety Measures.
Chapter 6
Environmental Engineering: Environmental Pollution, Environmental Acts and Regulations, Functional Concepts of Ecology, Basics of Species, Biodiversity, Ecosystem, Hydrological Cycle; Chemical Cycles: Carbon, Nitrogen & Phosphorus; Energy Flow in Ecosystems.
Water Pollution: Water Quality standards, Introduction to Treatment & Disposal of Waste Water. Reuse and Saving of Water, Rain Water Harvesting. Solid Waste Management: Classification of Solid Waste, Collection, Transportation and Disposal of Solid. Recycling of Solid Waste: Energy Recovery, Sanitary Landfill, On-Site Sanitation. Air & Noise Pollution: Primary and Secondary air pollutants, Harmful effects of Air Pollution, Control of Air Pollution. . Noise Pollution Harmful Effects of noise pollution, control of noise pollution, Global warming & Climate Change, Ozone depletion, Greenhouse effect
Text Books:
1. Palancharmy, Basic Civil Engineering, McGraw Hill publishers.
2. Satheesh Gopi, Basic Civil Engineering, Pearson Publishers.
3. Ketki Rangwala Dalal, Essentials of Civil Engineering, Charotar Publishing House.
4. BCP, Surveying volume 1
How to Make a Field Mandatory in Odoo 17
In Odoo, making a field required can be done through both Python code and XML views. When you set the required attribute to True in Python code, it makes the field required across all views where it's used. Conversely, when you set the required attribute in XML views, it makes the field required only in the context of that particular view.
How to deliver Powerpoint Presentations.pptx
"How to make and deliver dynamic presentations by making it more interactive to captivate your audience attention"
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)Academy of Science of South Africa
A workshop hosted by the South African Journal of Science aimed at postgraduate students and early career researchers with little or no experience in writing and publishing journal articles.The History of Stoke Newington Street Names
Presented at the Stoke Newington Literary Festival on 9th June 2024
www.StokeNewingtonHistory.com
The Diamonds of 2023-2024 in the IGRA collection
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...Nguyen Thanh Tu Collection
https://app.box.com/s/tacvl9ekroe9hqupdnjruiypvm9rdanePollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...National Information Standards Organization (NISO)
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.Walmart Business+ and Spark Good for Nonprofits.pdf
"Learn about all the ways Walmart supports nonprofit organizations.
You will hear from Liz Willett, the Head of Nonprofits, and hear about what Walmart is doing to help nonprofits, including Walmart Business and Spark Good. Walmart Business+ is a new offer for nonprofits that offers discounts and also streamlines nonprofits order and expense tracking, saving time and money.
The webinar may also give some examples on how nonprofits can best leverage Walmart Business+.
The event will cover the following::
Walmart Business + (https://business.walmart.com/plus) is a new shopping experience for nonprofits, schools, and local business customers that connects an exclusive online shopping experience to stores. Benefits include free delivery and shipping, a 'Spend Analytics” feature, special discounts, deals and tax-exempt shopping.
Special TechSoup offer for a free 180 days membership, and up to $150 in discounts on eligible orders.
Spark Good (walmart.com/sparkgood) is a charitable platform that enables nonprofits to receive donations directly from customers and associates.
Answers about how you can do more with Walmart!"
Recently uploaded (20)
Film vocab for eal 3 students: Australia the movie
Film vocab for eal 3 students: Australia the movie
Digital Artefact 1 - Tiny Home Environmental Design
Digital Artefact 1 - Tiny Home Environmental Design
Liberal Approach to the Study of Indian Politics.pdf
Liberal Approach to the Study of Indian Politics.pdf
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
ISO/IEC 27001, ISO/IEC 42001, and GDPR: Best Practices for Implementation and...
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
Natural birth techniques - Mrs.Akanksha Trivedi Rama University
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
NEWSPAPERS - QUESTION 1 - REVISION POWERPOINT.pptx
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...
Chapter wise All Notes of First year Basic Civil Engineering.pptx
Chapter wise All Notes of First year Basic Civil Engineering.pptx
South African Journal of Science: Writing with integrity workshop (2024)
South African Journal of Science: Writing with integrity workshop (2024)
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
BÀI TẬP BỔ TRỢ TIẾNG ANH LỚP 9 CẢ NĂM - GLOBAL SUCCESS - NĂM HỌC 2024-2025 - ...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Pollock and Snow "DEIA in the Scholarly Landscape, Session One: Setting Expec...
Walmart Business+ and Spark Good for Nonprofits.pdf
Walmart Business+ and Spark Good for Nonprofits.pdf
2 The early Xenopus embryo has animal and vegetal halves A.pdf
- 1. 2. The early Xenopus embryo has animal and vegetal halves (A and V) and a dorsal and ventral half (D and Ve ) crudely depicted below. a. When and how are the animal and vegetal poles determined? Be specific about the molecular details including some gene product specific to the animal and vegetal halves, respectively. b. If you were to draw the fate map for this embryo, which area of the embryo will give rise to the ectoderm, endoderm and mesoderm, respectively?