1) Naïve T cells have the potential to differentiate into several
•Download as DOCX, PDF•
1 like•2 views
1) Naïve T cells have the potential to differentiate into several types of effector cells. In the space below, describe the roles and activities of each of these cells: TH1 cells TH2 cells TH17 cells TFH cells 2) Use the following diagram to compare and contrast systemic immunity and mucosal immunity. Systemic Both Systemic and Mucosal Mucosal ordinary surface epithelia Why is there a need for these differences in the first place? CDC Sexually Transmitted Diseases Case Study. Read the patient case study below General: The patient is a young seventeen-year-old female who came to the clinic with complaint of abdominal pain. Chief Complaint: Kim reports "I've been having pain in my stomach for several weeks." She describes the pain as being sharp and being constant. She stated the pain often occurs on both sides of her lower abdominal. She has been experiencing the pain for the past two weeks. The pain has gotten worse since then. Reliability and Source of History: The patient is alert and oriented and able to answer most of the questions. Source & Reliability of History: O – "I have been having pain in my stomach for several weeks now.” she stated that the pain has lasted for two weeks without any relief. L – Both sides of her lower stomach D – The patient reported that she has been having this bilateral lower stomach pain for the last two weeks, However, the symptoms got worse since the pain started ago. C – She stated that since the onset of the pain, her pain has remained constant without any relieve and aggravating factor. The pain is firm regardless of the time or day or event. She further stated that her symptoms get worse. The patient states that she is unaware of what caused the pain or how the pain started; however, she stated that taking pills could relieve her stomach pain and stop her bleeding A – She stated that the pain remains constant. She also stated that she is unaware of what caused the pain or how the pain started. R – She stated that the pain remains steady and does not go away or radiate to other areas. T- she reported feeling uncomfortable doing her regular shores due to the pain. Past Medical history: Patient is asthmatic; however, her asthma is under control. She knows known history of any other condition or never been hospitalized. Family History: She is the second in a family of four who are all alive and healthy. There is no history of any chronic condition in the family. Social History: Patient is a regularly active young woman; she is single and does moderately active exercise. However, she stated that her daily activity and chores has recently reduced due to her recent symptoms of pain. She also stated to have no appetite secondary to her recent pain. She also stated that her stress level may be related with her college. She has no history of alcohol, smoking, or had never smoked in her life. She has not used any ...
Report
Share
Report
Share
Recommended
Give an example from your own experience or research an article or.docx
Give an example from your own experience or research an article or the media in which a business executive did something of significance that is morally right. Use APA format to cite your material from your sources.
Is there a relationship between obesity and socio-economic status? Should obese people be considered a protected class under Title VII of the Civil Rights Act?
1:
2:
3.
4.
5.
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______
Age: _______
Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and r ...
Nursing information helps you to collect history of patient which is helpful
Helps you to collect information
12SOAP Note Patient with UTIUnited State
1
2
SOAP Note Patient with UTI
United State University
FNP xxx: Common Illness Across the Lifespan -Clinical Practicum
Dr. xxxx
SOAP Note Patient with UTI
ID: L.U. a female patient presented to the clinic accompany by self, patient is a reliable historian.
Client’s Initials: L.U
Age :65 years.
Race: African American
Gender: Female
Date of Birth: 08
Insurance: BlueCross BlueShield .
Marital Status: Married
Subjective: “ I have been having pain and burning during urination for two weeks now and the pain goes to my lower abdomen, and I have been unable to hold urine, I now urinate on myself because I can no longer hold it until I get to the bathroom”.
CC: Pain and burning during urination.
HPI:
Patient stated symptoms began within the past two weeks and have worsened over the past seven days. The patient complains of severe pain and burning sensation during urination that radiates to lower abdomen, with urgency. The urine is cloudy and has a foul smell odor. After attempting to pass urine, the pain subsides for a little while, yet it reoccurs. Patient states that she has been sexually active only with the same partner for the past 15 years. On assessment patient reports pain of 8 /10 on pain scale. Patient denies having blood in urine, fever, headache, shortness of breath or chest pain at the moment.
ROS
Constitutional: Patient states she is in good state of health she denies headache , chest pain weakness fever chills, weight loss or gain.
Eyes: Denies double vision, change in vision factors, or blurry vision.
Ears/Nose/Mouth/Throat: denies sore throat, hearing issues, or nose congestion.
Cardiovascular: denies any kind of orthopnea, rapid heart rate, palpitations, or chest pain.
Pulmonary: Denies
Gastrointestinal: c/o moderate to severe pain in the abdominal area.
Genitourinary: acknowledged presence of increase in urgency and frequency of urination. Major pain while urinating for the past ten days.
Musculoskeletal: Denies any kind of pain
Integumentary & breast: Denies issues
Neurological: Denies issues
Psychiatric: Denies any kind of depression or mood swing
Endocrine: Denies having any problem
Hematologic/Lymphatic: Denies
Allergic/Immunologic: No Known allergy
Past Medical History:
· Medical problem list: patient denies having any major illnesses and only reports headaches and sometimes common seasonal allergy or cold.
· Denies history of chronic medical problems with father or mother.
· Preventative care: None indicated
· Surgeries: Denies
· Hospitalizations: Denies
· LMP: Patient states she do have a 28 days menstrual cycle and the last cycle was 2 weeks ago. She has had three pregnancies and three cesarean section.
Allergies: No known food or drug allergy
· Medications: Patient takes only Centrum vitamins and sometimes Tylenol for headache. Family History: Patient’s mother has hypertension that she manages by taking daily medication and exercising. The patient’s father has hypertension too a ...
12SOAP Note Patient with UTIUnited State
1
2
SOAP Note Patient with UTI
United State University
FNP xxx: Common Illness Across the Lifespan -Clinical Practicum
Dr. xxxx
SOAP Note Patient with UTI
ID: L.U. a female patient presented to the clinic accompany by self, patient is a reliable historian.
Client’s Initials: L.U
Age :65 years.
Race: African American
Gender: Female
Date of Birth: 08
Insurance: BlueCross BlueShield .
Marital Status: Married
Subjective: “ I have been having pain and burning during urination for two weeks now and the pain goes to my lower abdomen, and I have been unable to hold urine, I now urinate on myself because I can no longer hold it until I get to the bathroom”.
CC: Pain and burning during urination.
HPI:
Patient stated symptoms began within the past two weeks and have worsened over the past seven days. The patient complains of severe pain and burning sensation during urination that radiates to lower abdomen, with urgency. The urine is cloudy and has a foul smell odor. After attempting to pass urine, the pain subsides for a little while, yet it reoccurs. Patient states that she has been sexually active only with the same partner for the past 15 years. On assessment patient reports pain of 8 /10 on pain scale. Patient denies having blood in urine, fever, headache, shortness of breath or chest pain at the moment.
ROS
Constitutional: Patient states she is in good state of health she denies headache , chest pain weakness fever chills, weight loss or gain.
Eyes: Denies double vision, change in vision factors, or blurry vision.
Ears/Nose/Mouth/Throat: denies sore throat, hearing issues, or nose congestion.
Cardiovascular: denies any kind of orthopnea, rapid heart rate, palpitations, or chest pain.
Pulmonary: Denies
Gastrointestinal: c/o moderate to severe pain in the abdominal area.
Genitourinary: acknowledged presence of increase in urgency and frequency of urination. Major pain while urinating for the past ten days.
Musculoskeletal: Denies any kind of pain
Integumentary & breast: Denies issues
Neurological: Denies issues
Psychiatric: Denies any kind of depression or mood swing
Endocrine: Denies having any problem
Hematologic/Lymphatic: Denies
Allergic/Immunologic: No Known allergy
Past Medical History:
· Medical problem list: patient denies having any major illnesses and only reports headaches and sometimes common seasonal allergy or cold.
· Denies history of chronic medical problems with father or mother.
· Preventative care: None indicated
· Surgeries: Denies
· Hospitalizations: Denies
· LMP: Patient states she do have a 28 days menstrual cycle and the last cycle was 2 weeks ago. She has had three pregnancies and three cesarean section.
Allergies: No known food or drug allergy
· Medications: Patient takes only Centrum vitamins and sometimes Tylenol for headache. Family History: Patient’s mother has hypertension that she manages by taking daily medication and exercising. The patient’s father has hypertension too a ...
Comprehensive SOAP TemplateThis template is for a full history.docx
Comprehensive SOAP Template
This template is for a full history and physical. For this course include only areas that are related to the case.
Patient Initials: _______
Age: _______
Gender: _______
Note: The mnemonic below is included for your reference and should be removed before the submission of your final note.
O = onset of symptom (acute/gradual)
L= location
D= duration (recent/chronic)
C= character
A= associated symptoms/aggravating factors
R= relieving factors
T= treatments previously tried – response? Why discontinued?
S= severity
SUBJECTIVE DATA: Include what the patient tells you, but organize the information.
Chief Complaint (CC): In just a few words, explain why the patient came to the clinic.
History of Present Illness (HPI): This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, and billing analysis. Paint a picture of what is wrong with the patient. You need to start EVERY HPI with age, race, and gender (e.g., 34-year-old AA male). You must include the seven attributes ofeach principal symptom in paragraph form not a list:
1. Location
2. Quality
3. Quantity or severity
4. Timing, including onset, duration, and frequency
5. Setting in which it occurs
6. Factors that have aggravated or relieved the symptom
7. Associated manifestations
Medications: Include over-the-counter, vitamin, and herbal supplements. List each one by name with dosage and frequency.
Allergies: Include specific reactions to medications, foods, insects, and environmental factors. Identify if it is an allergy or intolerance.
Past Medical History (PMH): Include illnesses (also childhood illnesses), hospitalizations.
Past Surgical History (PSH): Include dates, indications, and types of operations.
Sexual/Reproductive History: If applicable, include obstetric history, menstrual history, methods of contraception, sexual function, and risky sexual behaviors.
Personal/Social History: Include tobacco use, alcohol use, drug use, patient’s interests, ADL’s and IADL’s if applicable, and exercise and eating habits.
Immunization History: Includelast Tdap, Flu, pneumonia, etc.
Significant Family History: Include history of parents, grandparents, siblings, and children.
Lifestyle: Include cultural factors, economic factors, safety, and support systems and sexual preference.
Review of Systems: From head-to-toe, include each system that covers the Chief Complaint, History of Present Illness, and History (this includes the systems that address any previous diagnoses).Remember that the information you include in this section is based on what the patient tells you so ensure that you include all essentials in your case (refer to Chapter 2 of the Sullivan text).
General: Include any recent weight changes, weakness, fatigue, or fever, but do not restate HPI data here.
HEENT:
Neck:
Breasts:
Respiratory:
Cardiovascular/Peripheral Vascular:
Gastrointestinal:
Genitourinary:
Mu.
SOAP NOTEName J.D.Date 03262020Time 200 pmAge 25 .docx
SOAP NOTE
Name: J.D.
Date: 03/26/2020
Time: 2:00 pm
Age: 25 y/o
Sex: F
SUBJECTIVE
CC:
” I have a lot of pain on my left side, in my lower belly”
HPI: J.D. is a 25-year-old white female that came to the office today complaining of pain in her lower abdomen. The patient has always had painful cramps with her periods but this time it is much worse being described as a 6 out of 10 and lasting up to 5 hours. The pain started 2 days ago. The pain is described as more painful cramps. It is debilitating and prevents the patient from performing most daily activities. It is localized in the lower abdominal area, and sometimes radiates down her legs, and to her lower back. The patient uses hot compresses to relieve the pain as Tylenol does not work. The patient also states that she has been feeling nauseous ever since the pain started. She also urinates more frequently and pain on urination. Denies fever, vomiting, or chills.
Medications:
2 Tylenol as needed for her pain
PMH (include-immunization status including Gardisil, GTPLA).
Current or past illnesses: No current or past illnesses
Immunizations: All vaccines updated including flu vaccine and Gardasil.
Allergies: NKDA
Medication Intolerances: None.
Chronic Illnesses/Major traumas: None.
Hospitalizations/Surgeries (include delivery of pregnancies here)
No hospitalizations.
G0P0
Family History
Mother: 49 years old, no significant health problems
Maternal Side: No significant health problems
Father: 50 years old, hypertensive
Paternal Side: no significant health problems
Social History
Patient works full-time as a research assistant at a local university. A full-time student seeking a master’s degree in biochemistry at a local university. Married. Sexually active only with husband. Always uses male condoms as contraceptive device. Does not use recreational drugs, tobacco, or electronic cigarettes. Devout follower of Christianity. Denomination: catholic.
ROS
General Patient denies fever or chills, no weight changes.
Cardiovascular Denies chest pain, or discomfort. Denies palpitations, dyspnea, or orthopnea.
Skin: Denies presences of moles, rash, or itching.
Respiratory: Denies dyspnea, cough, hemoptysis, or pleuritic pains.
Eyes Denies problems or changes in her vision; denies double or blurred vision.
Gastrointestinal Positive for nausea.Denies hemorrhoids, constipation, or diarrhea. No variation in bowel habits. Denies vomiting.
Ears Denies difficulty or changes in his hearing. Denies tinnitus, or discharges.
Genitourinary/Gynecological Menarche 11 years old. Regular menstrual periods starting around the 3rd week of every month. LMP: 03.
AssignmentAnalyze the possible conditions from your colleague.docx
Assignment:
Analyze the possible conditions from your colleagues' differential diagnoses.
Determine which of the conditions you would reject and why.
Identify the most likely condition, and justify your reasoning.
42-year-old White Male
S.
Chief Complaint:
“low back pain for the past month that sometimes radiates to my left leg.”
HPI:
The patient is a 42-year-old white male who is complaining of low back pain that began one month ago. He explains that the pain will intermittently radiate to his left leg as well. He reports that the pain is constant and is also “sharp” at times. He describes the pain that radiates to his left leg as a “tingling” sensation and can sometimes even feel it “all the way down to his toes.” He rates the pain at an “8” when he is standing or walking but describes that the intensity decreases to a “4” when he is sitting or lying down. The patient complains of intermittent numbness and tingling in his left leg that seems to have gotten worse “in the past week.” He explains that the numbness and tingling is always worse first thing in the morning. He also describes the pain as almost “unbearable” after working a 12-hour shift and that he even has experienced a loss of appetite on those days after working long hours. He explains that the pain does wake him up sometimes at night. The patient explains that Aleve has been his “lifesaver,” as he does not feel that he could have worked at all if it wasn’t for taking it routinely before work. He proceeded to verbalize that the Aleve only “took the edge off,” but that he is worried about the effect it may be having on his stomach.
Current Medications:
Centrum Vitamin for Men, one PO daily; Aleve capsule, one PO every 8 hours; over-the-counter Zantac 150 mg PO, “occasionally” at bedtime for heartburn.
Allergies:
PCN- experienced hives after taking as a teenager; Denies food or environmental allergies.
PMH:
Occasional acid reflux, history of childhood asthma, hospitalized last year with pneumonia. Reports only surgery being tonsillectomy at age 5. Reports that he is current with immunizations and received a tetanus injection two years ago when he cut his finger at work.
FH:
Father died at age 60 with a heart attack, mother is living and has HTN. Maternal grandparents are living with no history of heart disease or cancer. Maternal grandmother-type 2 diabetes; Maternal grandfather- HTN, controlled with medication. Paternal grandmother- living and in excellent health, with no history of heart disease or cancer. Paternal grandfather died at age 72 with a heart attack. Reports that both children are in excellent health. Denies a history of back pain or scoliosis with maternal or paternal relatives.
SH:
Works as a nurse in the ICU at a local hospital and has been married for 15 years; they have two school-aged children. He reports that he and his family love to spend time outdoors and that they usually hike on the weekends together..
CC I have itchy white discharge”HPI Patient is a 32 African.docx
CC: "I have itchy white discharge”
HPI: Patient is a 32 African American female who reports having increased vaginal itching and discharge times 2 days. She states that her vagina feels irritated and that the itch is progressively getting worst. She reports a thick white cottage cheese discharge is present. She reports that she used a Monistat 3 day 6 days ago but hasn't had any relief. She states that the pain is worst after sex.
PMH: Patient denies having any past medical history. She denies any past traumas or hospitalizations.
PSH: Patient denies having a history of trauma. Patient denies having any surgical history.
Allergies: Patient denies having allergies to latex, food or any medications.
Medications: Patient reports she is currently on no medications.
Social history: Patient reports that her entire family lives nearby. She states that she lives in a two-bedroom apartment alone. States that she drinks 3 glasses of 8oz glasses of wine with friends twice a week. Denies recreational drug use. Denies tobacco use. Reports that she is single. She denies having any new sex partners during the last 3 years. She states that she drinks 1 8oz cups of coffee daily. She reports that she has worked as a real estate agent for the last 2years. Reports no job-related stressors.
Family History: Patient reports that her mother is a live and has a medical history of that she was diagnosed with anxiety and depression at the age of 35. She states her father has a medical history of depression which he was diagnosed with at age 45. She reports her maternal grandmother had a history of COPD and CHF. She reports her maternal grandmother died from complications of chronic kidney disease at the age of 80. She reports that her maternal grandfather had a medical history of hypertension, she reports he is still alive at 88. Patient reports her paternal grandmother has a medical history of CHF and diabetes mellitus type 2. She reports her paternal grandmother is still alive at 85 but has dementia She states paternal grandfather had a medical history of COPD and CHF, she reports he died at age 85 from complications of diabetes mellitus type 2. She has two older sister who both have no medical history.
Health Promotion/Maintenace: Patient reports she had a flu shot in September 2017 in a private doctor's office. Reports she had a TDAP booster in 2014. Based on the patients age USPSTF recommends screening for cervical cancer every 3 years with cervical cytology alone in women aged 21 to 29 years. Reports she had a std screen 2 years ago. She reports that she has never had an abnormal pap smear. She states STD screen was negative. Reports she had a pap 4 years ago. She reports she does monthly self-breast exams at home. She reports that she eats 2 times daily. Reports she eats well balanced nutritious meals for each meal. She reportedly drinks approximately 30oz of water a day.
General: Patient reports having, fever, chills, and malaise
Skin: Pat.
Recommended
Give an example from your own experience or research an article or.docx
Give an example from your own experience or research an article or the media in which a business executive did something of significance that is morally right. Use APA format to cite your material from your sources.
Is there a relationship between obesity and socio-economic status? Should obese people be considered a protected class under Title VII of the Civil Rights Act?
1:
2:
3.
4.
5.
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______
Age: _______
Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and r ...
Nursing information helps you to collect history of patient which is helpful
Helps you to collect information
12SOAP Note Patient with UTIUnited State
1
2
SOAP Note Patient with UTI
United State University
FNP xxx: Common Illness Across the Lifespan -Clinical Practicum
Dr. xxxx
SOAP Note Patient with UTI
ID: L.U. a female patient presented to the clinic accompany by self, patient is a reliable historian.
Client’s Initials: L.U
Age :65 years.
Race: African American
Gender: Female
Date of Birth: 08
Insurance: BlueCross BlueShield .
Marital Status: Married
Subjective: “ I have been having pain and burning during urination for two weeks now and the pain goes to my lower abdomen, and I have been unable to hold urine, I now urinate on myself because I can no longer hold it until I get to the bathroom”.
CC: Pain and burning during urination.
HPI:
Patient stated symptoms began within the past two weeks and have worsened over the past seven days. The patient complains of severe pain and burning sensation during urination that radiates to lower abdomen, with urgency. The urine is cloudy and has a foul smell odor. After attempting to pass urine, the pain subsides for a little while, yet it reoccurs. Patient states that she has been sexually active only with the same partner for the past 15 years. On assessment patient reports pain of 8 /10 on pain scale. Patient denies having blood in urine, fever, headache, shortness of breath or chest pain at the moment.
ROS
Constitutional: Patient states she is in good state of health she denies headache , chest pain weakness fever chills, weight loss or gain.
Eyes: Denies double vision, change in vision factors, or blurry vision.
Ears/Nose/Mouth/Throat: denies sore throat, hearing issues, or nose congestion.
Cardiovascular: denies any kind of orthopnea, rapid heart rate, palpitations, or chest pain.
Pulmonary: Denies
Gastrointestinal: c/o moderate to severe pain in the abdominal area.
Genitourinary: acknowledged presence of increase in urgency and frequency of urination. Major pain while urinating for the past ten days.
Musculoskeletal: Denies any kind of pain
Integumentary & breast: Denies issues
Neurological: Denies issues
Psychiatric: Denies any kind of depression or mood swing
Endocrine: Denies having any problem
Hematologic/Lymphatic: Denies
Allergic/Immunologic: No Known allergy
Past Medical History:
· Medical problem list: patient denies having any major illnesses and only reports headaches and sometimes common seasonal allergy or cold.
· Denies history of chronic medical problems with father or mother.
· Preventative care: None indicated
· Surgeries: Denies
· Hospitalizations: Denies
· LMP: Patient states she do have a 28 days menstrual cycle and the last cycle was 2 weeks ago. She has had three pregnancies and three cesarean section.
Allergies: No known food or drug allergy
· Medications: Patient takes only Centrum vitamins and sometimes Tylenol for headache. Family History: Patient’s mother has hypertension that she manages by taking daily medication and exercising. The patient’s father has hypertension too a ...
12SOAP Note Patient with UTIUnited State
1
2
SOAP Note Patient with UTI
United State University
FNP xxx: Common Illness Across the Lifespan -Clinical Practicum
Dr. xxxx
SOAP Note Patient with UTI
ID: L.U. a female patient presented to the clinic accompany by self, patient is a reliable historian.
Client’s Initials: L.U
Age :65 years.
Race: African American
Gender: Female
Date of Birth: 08
Insurance: BlueCross BlueShield .
Marital Status: Married
Subjective: “ I have been having pain and burning during urination for two weeks now and the pain goes to my lower abdomen, and I have been unable to hold urine, I now urinate on myself because I can no longer hold it until I get to the bathroom”.
CC: Pain and burning during urination.
HPI:
Patient stated symptoms began within the past two weeks and have worsened over the past seven days. The patient complains of severe pain and burning sensation during urination that radiates to lower abdomen, with urgency. The urine is cloudy and has a foul smell odor. After attempting to pass urine, the pain subsides for a little while, yet it reoccurs. Patient states that she has been sexually active only with the same partner for the past 15 years. On assessment patient reports pain of 8 /10 on pain scale. Patient denies having blood in urine, fever, headache, shortness of breath or chest pain at the moment.
ROS
Constitutional: Patient states she is in good state of health she denies headache , chest pain weakness fever chills, weight loss or gain.
Eyes: Denies double vision, change in vision factors, or blurry vision.
Ears/Nose/Mouth/Throat: denies sore throat, hearing issues, or nose congestion.
Cardiovascular: denies any kind of orthopnea, rapid heart rate, palpitations, or chest pain.
Pulmonary: Denies
Gastrointestinal: c/o moderate to severe pain in the abdominal area.
Genitourinary: acknowledged presence of increase in urgency and frequency of urination. Major pain while urinating for the past ten days.
Musculoskeletal: Denies any kind of pain
Integumentary & breast: Denies issues
Neurological: Denies issues
Psychiatric: Denies any kind of depression or mood swing
Endocrine: Denies having any problem
Hematologic/Lymphatic: Denies
Allergic/Immunologic: No Known allergy
Past Medical History:
· Medical problem list: patient denies having any major illnesses and only reports headaches and sometimes common seasonal allergy or cold.
· Denies history of chronic medical problems with father or mother.
· Preventative care: None indicated
· Surgeries: Denies
· Hospitalizations: Denies
· LMP: Patient states she do have a 28 days menstrual cycle and the last cycle was 2 weeks ago. She has had three pregnancies and three cesarean section.
Allergies: No known food or drug allergy
· Medications: Patient takes only Centrum vitamins and sometimes Tylenol for headache. Family History: Patient’s mother has hypertension that she manages by taking daily medication and exercising. The patient’s father has hypertension too a ...
Comprehensive SOAP TemplateThis template is for a full history.docx
Comprehensive SOAP Template
This template is for a full history and physical. For this course include only areas that are related to the case.
Patient Initials: _______
Age: _______
Gender: _______
Note: The mnemonic below is included for your reference and should be removed before the submission of your final note.
O = onset of symptom (acute/gradual)
L= location
D= duration (recent/chronic)
C= character
A= associated symptoms/aggravating factors
R= relieving factors
T= treatments previously tried – response? Why discontinued?
S= severity
SUBJECTIVE DATA: Include what the patient tells you, but organize the information.
Chief Complaint (CC): In just a few words, explain why the patient came to the clinic.
History of Present Illness (HPI): This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, and billing analysis. Paint a picture of what is wrong with the patient. You need to start EVERY HPI with age, race, and gender (e.g., 34-year-old AA male). You must include the seven attributes ofeach principal symptom in paragraph form not a list:
1. Location
2. Quality
3. Quantity or severity
4. Timing, including onset, duration, and frequency
5. Setting in which it occurs
6. Factors that have aggravated or relieved the symptom
7. Associated manifestations
Medications: Include over-the-counter, vitamin, and herbal supplements. List each one by name with dosage and frequency.
Allergies: Include specific reactions to medications, foods, insects, and environmental factors. Identify if it is an allergy or intolerance.
Past Medical History (PMH): Include illnesses (also childhood illnesses), hospitalizations.
Past Surgical History (PSH): Include dates, indications, and types of operations.
Sexual/Reproductive History: If applicable, include obstetric history, menstrual history, methods of contraception, sexual function, and risky sexual behaviors.
Personal/Social History: Include tobacco use, alcohol use, drug use, patient’s interests, ADL’s and IADL’s if applicable, and exercise and eating habits.
Immunization History: Includelast Tdap, Flu, pneumonia, etc.
Significant Family History: Include history of parents, grandparents, siblings, and children.
Lifestyle: Include cultural factors, economic factors, safety, and support systems and sexual preference.
Review of Systems: From head-to-toe, include each system that covers the Chief Complaint, History of Present Illness, and History (this includes the systems that address any previous diagnoses).Remember that the information you include in this section is based on what the patient tells you so ensure that you include all essentials in your case (refer to Chapter 2 of the Sullivan text).
General: Include any recent weight changes, weakness, fatigue, or fever, but do not restate HPI data here.
HEENT:
Neck:
Breasts:
Respiratory:
Cardiovascular/Peripheral Vascular:
Gastrointestinal:
Genitourinary:
Mu.
SOAP NOTEName J.D.Date 03262020Time 200 pmAge 25 .docx
SOAP NOTE
Name: J.D.
Date: 03/26/2020
Time: 2:00 pm
Age: 25 y/o
Sex: F
SUBJECTIVE
CC:
” I have a lot of pain on my left side, in my lower belly”
HPI: J.D. is a 25-year-old white female that came to the office today complaining of pain in her lower abdomen. The patient has always had painful cramps with her periods but this time it is much worse being described as a 6 out of 10 and lasting up to 5 hours. The pain started 2 days ago. The pain is described as more painful cramps. It is debilitating and prevents the patient from performing most daily activities. It is localized in the lower abdominal area, and sometimes radiates down her legs, and to her lower back. The patient uses hot compresses to relieve the pain as Tylenol does not work. The patient also states that she has been feeling nauseous ever since the pain started. She also urinates more frequently and pain on urination. Denies fever, vomiting, or chills.
Medications:
2 Tylenol as needed for her pain
PMH (include-immunization status including Gardisil, GTPLA).
Current or past illnesses: No current or past illnesses
Immunizations: All vaccines updated including flu vaccine and Gardasil.
Allergies: NKDA
Medication Intolerances: None.
Chronic Illnesses/Major traumas: None.
Hospitalizations/Surgeries (include delivery of pregnancies here)
No hospitalizations.
G0P0
Family History
Mother: 49 years old, no significant health problems
Maternal Side: No significant health problems
Father: 50 years old, hypertensive
Paternal Side: no significant health problems
Social History
Patient works full-time as a research assistant at a local university. A full-time student seeking a master’s degree in biochemistry at a local university. Married. Sexually active only with husband. Always uses male condoms as contraceptive device. Does not use recreational drugs, tobacco, or electronic cigarettes. Devout follower of Christianity. Denomination: catholic.
ROS
General Patient denies fever or chills, no weight changes.
Cardiovascular Denies chest pain, or discomfort. Denies palpitations, dyspnea, or orthopnea.
Skin: Denies presences of moles, rash, or itching.
Respiratory: Denies dyspnea, cough, hemoptysis, or pleuritic pains.
Eyes Denies problems or changes in her vision; denies double or blurred vision.
Gastrointestinal Positive for nausea.Denies hemorrhoids, constipation, or diarrhea. No variation in bowel habits. Denies vomiting.
Ears Denies difficulty or changes in his hearing. Denies tinnitus, or discharges.
Genitourinary/Gynecological Menarche 11 years old. Regular menstrual periods starting around the 3rd week of every month. LMP: 03.
AssignmentAnalyze the possible conditions from your colleague.docx
Assignment:
Analyze the possible conditions from your colleagues' differential diagnoses.
Determine which of the conditions you would reject and why.
Identify the most likely condition, and justify your reasoning.
42-year-old White Male
S.
Chief Complaint:
“low back pain for the past month that sometimes radiates to my left leg.”
HPI:
The patient is a 42-year-old white male who is complaining of low back pain that began one month ago. He explains that the pain will intermittently radiate to his left leg as well. He reports that the pain is constant and is also “sharp” at times. He describes the pain that radiates to his left leg as a “tingling” sensation and can sometimes even feel it “all the way down to his toes.” He rates the pain at an “8” when he is standing or walking but describes that the intensity decreases to a “4” when he is sitting or lying down. The patient complains of intermittent numbness and tingling in his left leg that seems to have gotten worse “in the past week.” He explains that the numbness and tingling is always worse first thing in the morning. He also describes the pain as almost “unbearable” after working a 12-hour shift and that he even has experienced a loss of appetite on those days after working long hours. He explains that the pain does wake him up sometimes at night. The patient explains that Aleve has been his “lifesaver,” as he does not feel that he could have worked at all if it wasn’t for taking it routinely before work. He proceeded to verbalize that the Aleve only “took the edge off,” but that he is worried about the effect it may be having on his stomach.
Current Medications:
Centrum Vitamin for Men, one PO daily; Aleve capsule, one PO every 8 hours; over-the-counter Zantac 150 mg PO, “occasionally” at bedtime for heartburn.
Allergies:
PCN- experienced hives after taking as a teenager; Denies food or environmental allergies.
PMH:
Occasional acid reflux, history of childhood asthma, hospitalized last year with pneumonia. Reports only surgery being tonsillectomy at age 5. Reports that he is current with immunizations and received a tetanus injection two years ago when he cut his finger at work.
FH:
Father died at age 60 with a heart attack, mother is living and has HTN. Maternal grandparents are living with no history of heart disease or cancer. Maternal grandmother-type 2 diabetes; Maternal grandfather- HTN, controlled with medication. Paternal grandmother- living and in excellent health, with no history of heart disease or cancer. Paternal grandfather died at age 72 with a heart attack. Reports that both children are in excellent health. Denies a history of back pain or scoliosis with maternal or paternal relatives.
SH:
Works as a nurse in the ICU at a local hospital and has been married for 15 years; they have two school-aged children. He reports that he and his family love to spend time outdoors and that they usually hike on the weekends together..
CC I have itchy white discharge”HPI Patient is a 32 African.docx
CC: "I have itchy white discharge”
HPI: Patient is a 32 African American female who reports having increased vaginal itching and discharge times 2 days. She states that her vagina feels irritated and that the itch is progressively getting worst. She reports a thick white cottage cheese discharge is present. She reports that she used a Monistat 3 day 6 days ago but hasn't had any relief. She states that the pain is worst after sex.
PMH: Patient denies having any past medical history. She denies any past traumas or hospitalizations.
PSH: Patient denies having a history of trauma. Patient denies having any surgical history.
Allergies: Patient denies having allergies to latex, food or any medications.
Medications: Patient reports she is currently on no medications.
Social history: Patient reports that her entire family lives nearby. She states that she lives in a two-bedroom apartment alone. States that she drinks 3 glasses of 8oz glasses of wine with friends twice a week. Denies recreational drug use. Denies tobacco use. Reports that she is single. She denies having any new sex partners during the last 3 years. She states that she drinks 1 8oz cups of coffee daily. She reports that she has worked as a real estate agent for the last 2years. Reports no job-related stressors.
Family History: Patient reports that her mother is a live and has a medical history of that she was diagnosed with anxiety and depression at the age of 35. She states her father has a medical history of depression which he was diagnosed with at age 45. She reports her maternal grandmother had a history of COPD and CHF. She reports her maternal grandmother died from complications of chronic kidney disease at the age of 80. She reports that her maternal grandfather had a medical history of hypertension, she reports he is still alive at 88. Patient reports her paternal grandmother has a medical history of CHF and diabetes mellitus type 2. She reports her paternal grandmother is still alive at 85 but has dementia She states paternal grandfather had a medical history of COPD and CHF, she reports he died at age 85 from complications of diabetes mellitus type 2. She has two older sister who both have no medical history.
Health Promotion/Maintenace: Patient reports she had a flu shot in September 2017 in a private doctor's office. Reports she had a TDAP booster in 2014. Based on the patients age USPSTF recommends screening for cervical cancer every 3 years with cervical cytology alone in women aged 21 to 29 years. Reports she had a std screen 2 years ago. She reports that she has never had an abnormal pap smear. She states STD screen was negative. Reports she had a pap 4 years ago. She reports she does monthly self-breast exams at home. She reports that she eats 2 times daily. Reports she eats well balanced nutritious meals for each meal. She reportedly drinks approximately 30oz of water a day.
General: Patient reports having, fever, chills, and malaise
Skin: Pat.
Soap Note 2 Chronic ConditionsSoap Note Chronic Conditions (
Soap Note 2 Chronic Conditions
Soap Note Chronic Conditions (15 Points)
Pick any Chronic Disease from Weeks 6-10
Soap notes will be uploaded to Moodle and put through TURN-It-In (anti-Plagiarism program)
Follow the MRU Soap Note Rubric as a guide
Turn it in Score must be less than 50% or will not be accepted for credit, must be your own work and in your own words. You can resubmit, Final submission will be accepted if less than 50%. Copy paste from websites or textbooks will not be accepted or tolerated. Please see College Handbook with reference to Academic Misconduct Statement
SOAP NOTE SAMPLE FORMAT FOR MRC
Name:
LP
Date:
Time:
1315
Age:
30
Sex:
F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known med ...
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center that she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue sinc.
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center that she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue sinc.
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
SOAP NOTE SAMPLE FORMAT FOR MRC
Name: LP
Date:
Time: 1315
Age: 30
Sex: F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known medical issues; No children.
Social History
Lives alone. Currently in a stable sexual relationship with one man. Works for DEFACS. Reports occasional alcohol use, but denies tobacco or illicit drug use.
ROS
General
Denies weight change, fatigue, fever, night sweats
Cardiovascular
Denies chest pain and edema. Reports rare palpitations that are relieved by drinking water
Skin
Denies any wounds, rashes, bruising, bleeding or skin discolorations, any changes in lesions
Respiratory
Denies cough. Reports dyspnea that accompanies the rare palpitations and is also relieved by drinking water
Eyes
Denies corrective lenses, blurring, visual changes of an.
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDate.docx
SOAP NOTE SAMPLE FORMAT FOR MRC
Name:
LP
Date:
Time:
1315
Age:
30
Sex:
F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known medical issues; No children.
Social History
Lives alone. Currently in a stable sexual relationship with one man. Works for DEFACS. Reports occasional alcohol use, but denies tobacco or illicit drug use.
ROS
General
Denies weight change, fatigue, fever, night sweats
Cardiovascular
Denies chest pain and edema. Reports rare palpitations that are relieved by drinking water
Skin
Denies any wounds, rashes, bruising, bleeding or skin discolorations, any changes in lesions
Respiratory
Denies cough. Reports dyspnea that accompanies the rare palpitati.
1[Shortened Title up to 50 Characters]16Week 9 Assignment.docx
1
[Shortened Title up to 50 Characters] 16Week 9 Assignment
Bethel U. Godwins
Walden University
NURS 6551, Section 8, Primary Care of Women
July 31, 2016
Abnormal Uterine Bleeding
Society for Reproductive Endocrinology and Infertility (SREI, 2012) described abnormal uterine bleeding as bleeding that differs in quality and quantity from normal menstrual bleeding, such as women spotting or bleeding between the women’s menstrual periods; bleeding after sex; bleeding heavier or last more days than normal; and bleeding post menopause. According to SREI (2012), factors that can cause abnormal bleeding include structural abnormalities of the reproductive system, such as uterine polyps, fibroids, and adenomyosis. Furthermore, SREI (2012) explained that vaginal, uterine or cervical lesions, miscarriage, ectopic pregnancy, endometritis, adhesions in the endometrium, and use of an intrauterine device (IUD) can also cause abnormal bleeding. Johns Hopkins Medicine (2016) specified that early recognition of abnormal bleeding, and seeing a health care provider immediately for appropriate diagnosis and treatment increase the chance of successful treatment. Therefore, the author will focus on a single patient comprehensive evaluation, which includes the patient’s personal/health history; physical examination; laboratory/diagnostic tests; diagnosis; treatment/management plan; education strategies; and follow-up care. Comment by DeAllen B Millender: Good introduction.
General Patient Information
Age: 41-year-old
Race/Ethnicity: Hispanic American
Partner Status: Married Comment by DeAllen B Millender: This information is not in APA format.
Current Health Status
Chief Complaint: “I have heavy, prolonged menstrual bleeding with severe cramping for the past one year”.
History of Present Illness (HPI): RG is a 41-year-old Hispanic American female who presented to the clinic with complaint of heavy prolonged menstrual bleeding with severe cramping for the past one year. Patient reported sharp pelvic pain during menstruation, bleeding between periods, pain with intercourse, blood clots during periods. Abdominal pain/pressure and bloating. Patient suggested that these symptoms started after her second caesarean section surgery one year ago. Patient also reported that she takes over-the counter medication, such as ibuprofen to relieve the pain. she also suggested that she uses heating pad on her abdomen/pelvic for pain relief, and she stated that she soaks in a warm sitz bath to ease pelvic pain and cramping. Patient also reported fatigue and weakness. Patient further stated that she decided to see an obstetrician and gynecologist (OB/GYN) because the heavy prolonged bleeding with severe menstrual cramp interfere with her regular activities. Patient denied nausea, vomiting, diarrhea, fever, and chills.
Timing/Onset: Patient said one year ago.
Location: The location of the problem as stated by the patient is pelvic/uterus/vaginal.
Duration: 5 to7 days d ...
1[Shortened Title up to 50 Characters]2Week 9 Assignment.docx
1
[Shortened Title up to 50 Characters] 2Week 9 Assignment
Bethel U. Godwins
Walden University
NURS 6551, Section 8, Primary Care of Women
July 31, 2016
Abnormal Uterine Bleeding
Society for Reproductive Endocrinology and Infertility (SREI, 2012) described abnormal uterine bleeding as bleeding that differs in quality and quantity from normal menstrual bleeding, such as women spotting or bleeding between the women’s menstrual periods; bleeding after sex; bleeding heavier or last more days than normal; and bleeding post menopause. According to SREI (2012), factors that can cause abnormal bleeding include structural abnormalities of the reproductive system, such as uterine polyps, fibroids, and adenomyosis. Furthermore, SREI (2012) explained that vaginal, uterine or cervical lesions, miscarriage, ectopic pregnancy, endometritis, adhesions in the endometrium, and use of an intrauterine device (IUD) can also cause abnormal bleeding. Johns Hopkins Medicine (2016) specified that early recognition of abnormal bleeding, and seeing a health care provider immediately for appropriate diagnosis and treatment increase the chance of successful treatment. Therefore, the author will focus on a single patient comprehensive evaluation, which includes the patient’s personal/health history; physical examination; laboratory/diagnostic tests; diagnosis; treatment/management plan; education strategies; and follow-up care. Comment by DeAllen B Millender: Good introduction.
General Patient Information
Age: 41-year-old
Race/Ethnicity: Hispanic American
Partner Status: Married Comment by DeAllen B Millender: This information is not in APA format.
Current Health Status
Chief Complaint: “I have heavy, prolonged menstrual bleeding with severe cramping for the past one year”.
History of Present Illness (HPI): RG is a 41-year-old Hispanic American female who presented to the clinic with complaint of heavy prolonged menstrual bleeding with severe cramping for the past one year. Patient reported sharp pelvic pain during menstruation, bleeding between periods, pain with intercourse, blood clots during periods. Abdominal pain/pressure and bloating. Patient suggested that these symptoms started after her second caesarean section surgery one year ago. Patient also reported that she takes over-the counter medication, such as ibuprofen to relieve the pain. she also suggested that she uses heating pad on her abdomen/pelvic for pain relief, and she stated that she soaks in a warm sitz bath to ease pelvic pain and cramping. Patient also reported fatigue and weakness. Patient further stated that she decided to see an obstetrician and gynecologist (OB/GYN) because the heavy prolonged bleeding with severe menstrual cramp interfere with her regular activities. Patient denied nausea, vomiting, diarrhea, fever, and chills.
Timing/Onset: Patient said one year ago.
Location: The location of the problem as stated by the patient is pelvic/uterus/vaginal.
Duration: 5 to7 days du ...
Analyze the subjective portion of the note. List additional inform.docx
Analyze the subjective portion of the note. List additional information that should be included in the documentation.
Analyze the objective portion of the note. List additional information that should be included in the documentation.
Is the assessment supported by the subjective and objective information? Why or why not?
Would diagnostics be appropriate for this case, and how would the results be used to make a diagnosis?
Would you reject/accept the current diagnosis? Why or why not? Identify three possible conditions that may be considered as a differential diagnosis for this patient. Explain your reasoning using at least three different references from current evidence-based literature.
GENITALIA ASSESSMENT
Subjective:
CC: “I have bumps on my bottom that I want to have checked out.”
HPI: AB, a 21-year-old WF college student reports to your clinic with external bumps on her genital area. She states the bumps are painless and feel rough. She states she is sexually active and has had more than one partner during the past year. Her initial sexual contact occurred at age 18. She reports no abnormal vaginal discharge. She is unsure how long the bumps have been there but noticed them about a week ago. Her last Pap smear exam was 3 years ago, and no dysplasia was found; the exam results were normal. She reports one sexually transmitted infection (chlamydia) about 2 years ago. She completed the treatment for chlamydia as prescribed.
PMH: Asthma
Medications: Symbicort 160/4.5mcg
Allergies: NKDA
FH: No hx of breast or cervical cancer, Father hx HTN, Mother hx HTN, GERD
Social: Denies tobacco use; occasional etoh, married, 3 children (1 girl, 2 boys)
Objective:
VS: Temp 98.6; BP 120/86; RR 16; P 92; HT 5’10”; WT 169lbs
Heart: RRR, no murmurs
Lungs: CTA, chest wall symmetrical
Genital: Normal female hair pattern distribution; no masses or swelling. Urethral meatus intact without erythema or discharge. Perineum intact. Vaginal mucosa pink and moist with rugae present, pos for firm, round, small, painless ulcer noted on external labia.
Abd: soft, normoactive bowel sounds, neg rebound, neg murphy’s, negMcBurney
Diagnostics: HSV specimen obtained
Assessment:
Chancre
Episodic/Focused SOAP Note Template
Patient Information:
Initials, Age, Sex, Race
S.
CC
(chief complaint) a BRIEF statement identifying why the patient is here - in the patient’s own words - for instance "headache", NOT "bad headache for 3 days”.
HPI
: This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, and billing analysis. Paint a picture of what is wrong with the patient. Use LOCATES Mnemonic to complete your HPI. You need to start EVERY HPI with age, race, and gender (e.g., 34-year-old AA male). You must include the seven attributes of each principal symptom in paragraph form not a list. If the CC was “headache”, the LOCATES for the HPI might look like the following example:
L.
EpisodicFocused SOAP Note Exemplar Focused SOAP Note for a pati.docx
Episodic/Focused SOAP Note Exemplar
Focused SOAP Note for a patient with chest pain
S.
CC: “Chest pain”
HPI: The patient is a 65 year old AA male who developed sudden onset of chest pain, which began early this morning. The pain is described as “crushing” and is rated nine out of 10 in terms of intensity. The pain is located in the middle of the chest and is accompanied by shortness of breath. The patient reports feeling nauseous. The patient tried an antacid with minimal relief of his symptoms.
PMH: Positive history of GERD and hypertension is controlled
FH: Mother died at 78 of breast cancer; Father at 75 of CVA. No history of premature cardiovascular disease in first degree relatives.
SH : Negative for tobacco abuse, currently or previously; consumes moderate alcohol; married for 39 years
ROS
General--Negative for fevers, chills, fatigue
Cardiovascular--Negative for orthopnea, PND, positive for intermittent lower extremity edema
Gastrointestinal--Positive for nausea without vomiting; negative for diarrhea, abdominal pain
Pulmonary--Positive for intermittent dyspnea on exertion, negative for cough or hemoptysis
O.
VS: BP 186/102; P 94; R 22; T 97.8; 02 96% Wt 235lbs; Ht 70”
General--Pt appears diaphoretic and anxious
Cardiovascular--PMI is in the 5th inter-costal space at the mid clavicular line. A grade 2/6 systolic decrescendo murmur is heard best at the
second right inter-costal space which radiates to the neck.
A third heard sound is heard at the apex. No fourth heart sound or rub are heard. No cyanosis, clubbing, noted, positive for bilateral 2+ LE edema is noted.
Gastrointestinal--The abdomen is symmetrical without distention; bowel
sounds are normal in quality and intensity in all areas; a
bruit is heard in the right para-umbilical area. No masses or
splenomegaly are noted. Positive for mid-epigastric tenderness with deep palpation.
Pulmonary-- Lungs are clear to auscultation and percussion bilaterally
Diagnostic results: EKG, CXR, CK-MB (support with evidenced and guidelines)
A.
Differential Diagnosis:
1) Myocardial Infarction (provide supportive documentation with evidence based guidelines).
2) Angina (provide supportive documentation with evidence based guidelines).
3) Costochondritis (provide supportive documentation with evidence based guidelines).
Primary Diagnosis/Presumptive Diagnosis: Myocardial Infarction
P. This section is not required for the assignments in this course (NURS 6512) but will be required for future courses.
© 2019 Walden University
Page 2 of 2
© 2019 Walden University
Page 1 of 2
Episodic/Focused SOAP Note Template
Patient Information:
Initials, Age, Sex, Race
S.
CC (chief complaint) a BRIEF statement identifying why the patient is here - in the patient’s own words - for instance "headache", NOT "bad headache for 3 days”.
HPI: This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care ...
Example Focused SOAP Note for a patient with chest painS..docx
Example
Focused SOAP Note for a patient with chest pain
S.
CC: “Chest pain”
HPI: The patient is a 65 year old AA male who developed sudden onset of chest pain, which began early this morning. The pain is described as “crushing” and is rated nine out of 10 in terms of intensity. The pain is located in the middle of the chest and is accompanied by shortness of breath. The patient reports feeling nauseous. The patient tried an antacid with minimal relief of his symptoms.
PMH: Positive history of GERD and hypertension is controlled
FH: Mother died at 78 of breast cancer; Father at 75 of CVA. No history of premature cardiovascular disease in first degree relatives.
SH : Negative for tobacco abuse, currently or previously; consumes moderate alcohol; married for 39 years
ROS
General--Negative for fevers, chills, fatigue
Cardiovascular--Negative for orthopnea, PND, positive for intermittent lower extremity edema
Gastrointestinal--Positive for nausea without vomiting; negative for diarrhea, abdominal pain
Pulmonary--Positive for intermittent dyspnea on exertion, negative for cough or hemoptysis
O.
VS: BP 186/102; P 94; R 22; T 97.8; 02 96% Wt 235lbs; Ht 70”
General--Pt appears diaphoretic and anxious
Cardiovascular--PMI is in the 5th inter-costal space at the mid clavicular line. A grade 2/6 systolic decrescendo murmur is heard best at the
second right inter-costal space which radiates to the neck.
A third heard sound is heard at the apex. No fourth heart sound or rub are heard. No cyanosis, clubbing, noted, positive for bilateral 2+ LE edema is noted.
Gastrointestinal--The abdomen is symmetrical without distention; bowel
sounds are normal in quality and intensity in all areas; a
bruit is heard in the right para-umbilical area. No masses or
splenomegaly are noted. Positive for mid-epigastric tenderness with deep palpation.
Pulmonary-- Lungs are clear to auscultation and percussion bilaterally
Diagnostic results: EKG, CXR, CK-MB (support with evidenced and guidelines)
A.
Differential Diagnosis:
1) Myocardial Infarction (provide supportive documentation with evidence based guidelines).
2) Angina (provide supportive documentation with evidence based guidelines).
3) Costochondritis (provide supportive documentation with evidence based guidelines).
Primary Diagnosis/Presumptive Diagnosis: Myocardial Infarction
P. This section is not required for the assignments in this course (NURS 6512) but will be required for future courses.
© 2014 Laureate Education, Inc.
Page 2 of 2
© 2014 Laureate Education, Inc.
Page 1 of 2
Episodic/Focused SOAP Note Template
Patient Information:
Initials, Age, Sex, Race
S.
CC (chief complaint) a BRIEF statement identifying why the patient is here - in the patient’s own words - for instance "headache", NOT "bad headache for 3 days”.
HPI: This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, a.
Financial & Managerial Accounting Assignment 1 – Financial S.docx
Financial & Managerial Accounting
Assignment 1 – Financial Statement Analysis
Financial & Managerial Accounting
Assignment 1 – Financial Statement Analysis
Guidelines for assignment
This is an individual assignment
Ground your answer in relevant theory
Plagiarism and reproduction of someone else’s work as your own will be penalized
Make use of references, where appropriate – Use Harvard or APA referencing method.
Late submission are not accepted
Financial & Managerial Accounting
Assignment 1 – Financial Statement Analysis
Structural elements should include an introduction, main body, and a conclusion
Weight – 50%
Word count guidance : part 1 – N/A. Business report wordage should be 2000 +/-10%
Type of assignment: Excel Assessed Work Folder and Business Report
Start / Finish : Week 3 – 4
Learning Outcome Assessed: 1,2,3,4
Submit one single document and not lots of different files.
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______
Age: _______
Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November ...
SOAO NotePatient Initials S.MPt. Encounter Number 2 .docx
SOAO Note
Patient Initials: S.M
Pt. Encounter Number: 2
Date: 10/12/2020
Age: 61
Sex: Female
Allergies: NKA
Advanced Directives: No
SUBJECTIVE
Chief Complaint: "I have a lump on my right breast."
HPI: S.M is a 61-year-old, Hispanic, female who presents to the office alarmed by a painful lump in her right breast that she discovered while showering. S.M reports the pain started 2 days ago while in the shower. The pain is felt when touching the right breast, and it felt on light touch. Current pain level is now 5/10. She does not report any skin changes. Patient denies any history of herbal medicine use and is currently on no medication. Pain gets worse with movement and with lifting weight. Pain is relieved with rest and medication. S.M gets some short relief with pain reliever ibuprofen 200mg that she takes twice a day for the past two days.
Past Medical History
Medication Intolerances: No known drug intolerance
Chronic Illnesses/Major traumas: The patient denies any history of major trauma.
Screening Hx/Immunizations Hx: last mammogram, which was normal, was 2 years ago.
OBGYN: Menarche at 10; LMP 2 weeks ago; last PAP 2019/Normal; GTPAL: 11001 score; no previous history of STDs. S.M is sexually active, have had 2 sexual partners in the past. S.M used condoms with previous partners. No previous gyn diagnoses or procedures done in the past.
Hospitalizations/Surgeries: Hospitalized once for delivery
Family History: There is no history of malignancy in first-degree relatives. She has one sister, age 58, who is in good health. Mother died at age 70; father died at age 64, from unknown causes.
Social History: S.M is married with one child. No use of alcohol; drinks wine socially; drinks one cup of coffee sometime to start her day at work. Never uses drugs.
Review of System
Constitutional: No significant gain/loss weight, no chills, no malaise or fatigue; no night sweats, no exercise intolerance. She does not report any skin changes. She has not experienced fever, weight loss, headache, nausea, vomiting, dizziness, or bone pain.
Skin: Denies rashes, pigmentation changes, lesions, or hair or nail changes.
Eyes: denies vision changes, diplopia, blurred vision, reports wearing eyeglasses.
Ears: Denies loss of hearing, ear pain, drainage, sensation of ears feeling full, ringing in the ear, or ear trauma.
Nose/Mouth/Throat: Denies sore throat, hoarseness, difficulty swallowing, postnasal
drip. No report of mouth or lips sore, bleeding gums, ulcerations or lesions of tongue or
mucosa; no dentures or dental appliances, or missing teeth reported.
Breast: Refers to right breast pain, or discomfort to right breast. Reports some brownish nipple discharges when squeezing the nipple and denies any breast trauma.
Heme/Lymph/Endo: Denies history of anemia, no bruising, no abnormal bleeding, and no swollen glands.
Cardiovascular: Denies chest pain, palpitations, orthopnea, edema, claudicati.
Comprehensive SOAP ExemplarPurpose To demonstrate what each s
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP note should include. Remember that Nurse Practitioners treat patients in a holistic manner and your SOAP note should reflect that premise.
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65 year old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last three days. She reported that the “cold feels like it is descending into her chest”. The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4, last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over the counter Ibuprofen 200mg -2 PO as needed
6.) Over the counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and an hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstrating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65 and the other with prostate CA, dx at age 62. She has 1 daughter, in her 50’s, healthy, living in nearby neighborhood.
Lifestyle:
She is a retired; widowed x 8 years; lives in the city, moderate crime area, with good public transportation. She college graduate, owns her home and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center and she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue since the illness starte ...
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
SOAP NOTE SAMPLE FORMAT FOR MRC
Name: LP
Date:
Time: 1315
Age: 30
Sex: F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known medical issues; No children.
Social History
Lives alone. Currently in a stable sexual relationship with one man. Works for DEFACS. Reports occasional alcohol use, but denies tobacco or illicit drug use.
ROS
General
Denies weight change, fatigue, fever, night sweats
Cardiovascular
Denies chest pain and edema. Reports rare palpitations that are relieved by drinking water
Skin
Denies any wounds, rashes, bruising, bleeding or skin discolorations, any changes in lesions
Respiratory
Denies cough. Reports dyspnea that accompanies the rare palpitations and is also relieved by drinking water
Eyes
Denies corrective lenses, blurring, visual changes of an.
Comprehensive SOAP ExemplarPurpose To demonstrate what each sec.docx
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______
Age: _______
Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center that she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue .
Nursing Care Plan Including Diagnosis and Intervention.pdf
Nursing Care Plan Including Diagnosis and Intervention.pdf
Bilateral Pulmonary Hydatid Cysts with Ruptured & Infected Hydatid Cyst of Le...
Bilateral Pulmonary Hydatid Cysts with Ruptured & Infected Hydatid Cyst of Left Lung - A Case Presentation
Operations:
First Operation:
VATS Enucleation of Hydatid Cyst of Lung (Right side)
Second Operation:
VATS followed by minimally invasive open Enucleation and Capitonnage of Hydatid Cyst of Lung (Left side)
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
More Related Content
Similar to 1) Naïve T cells have the potential to differentiate into several
Soap Note 2 Chronic ConditionsSoap Note Chronic Conditions (
Soap Note 2 Chronic Conditions
Soap Note Chronic Conditions (15 Points)
Pick any Chronic Disease from Weeks 6-10
Soap notes will be uploaded to Moodle and put through TURN-It-In (anti-Plagiarism program)
Follow the MRU Soap Note Rubric as a guide
Turn it in Score must be less than 50% or will not be accepted for credit, must be your own work and in your own words. You can resubmit, Final submission will be accepted if less than 50%. Copy paste from websites or textbooks will not be accepted or tolerated. Please see College Handbook with reference to Academic Misconduct Statement
SOAP NOTE SAMPLE FORMAT FOR MRC
Name:
LP
Date:
Time:
1315
Age:
30
Sex:
F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known med ...
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center that she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue sinc.
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center that she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue sinc.
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
SOAP NOTE SAMPLE FORMAT FOR MRC
Name: LP
Date:
Time: 1315
Age: 30
Sex: F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known medical issues; No children.
Social History
Lives alone. Currently in a stable sexual relationship with one man. Works for DEFACS. Reports occasional alcohol use, but denies tobacco or illicit drug use.
ROS
General
Denies weight change, fatigue, fever, night sweats
Cardiovascular
Denies chest pain and edema. Reports rare palpitations that are relieved by drinking water
Skin
Denies any wounds, rashes, bruising, bleeding or skin discolorations, any changes in lesions
Respiratory
Denies cough. Reports dyspnea that accompanies the rare palpitations and is also relieved by drinking water
Eyes
Denies corrective lenses, blurring, visual changes of an.
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDate.docx
SOAP NOTE SAMPLE FORMAT FOR MRC
Name:
LP
Date:
Time:
1315
Age:
30
Sex:
F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known medical issues; No children.
Social History
Lives alone. Currently in a stable sexual relationship with one man. Works for DEFACS. Reports occasional alcohol use, but denies tobacco or illicit drug use.
ROS
General
Denies weight change, fatigue, fever, night sweats
Cardiovascular
Denies chest pain and edema. Reports rare palpitations that are relieved by drinking water
Skin
Denies any wounds, rashes, bruising, bleeding or skin discolorations, any changes in lesions
Respiratory
Denies cough. Reports dyspnea that accompanies the rare palpitati.
1[Shortened Title up to 50 Characters]16Week 9 Assignment.docx
1
[Shortened Title up to 50 Characters] 16Week 9 Assignment
Bethel U. Godwins
Walden University
NURS 6551, Section 8, Primary Care of Women
July 31, 2016
Abnormal Uterine Bleeding
Society for Reproductive Endocrinology and Infertility (SREI, 2012) described abnormal uterine bleeding as bleeding that differs in quality and quantity from normal menstrual bleeding, such as women spotting or bleeding between the women’s menstrual periods; bleeding after sex; bleeding heavier or last more days than normal; and bleeding post menopause. According to SREI (2012), factors that can cause abnormal bleeding include structural abnormalities of the reproductive system, such as uterine polyps, fibroids, and adenomyosis. Furthermore, SREI (2012) explained that vaginal, uterine or cervical lesions, miscarriage, ectopic pregnancy, endometritis, adhesions in the endometrium, and use of an intrauterine device (IUD) can also cause abnormal bleeding. Johns Hopkins Medicine (2016) specified that early recognition of abnormal bleeding, and seeing a health care provider immediately for appropriate diagnosis and treatment increase the chance of successful treatment. Therefore, the author will focus on a single patient comprehensive evaluation, which includes the patient’s personal/health history; physical examination; laboratory/diagnostic tests; diagnosis; treatment/management plan; education strategies; and follow-up care. Comment by DeAllen B Millender: Good introduction.
General Patient Information
Age: 41-year-old
Race/Ethnicity: Hispanic American
Partner Status: Married Comment by DeAllen B Millender: This information is not in APA format.
Current Health Status
Chief Complaint: “I have heavy, prolonged menstrual bleeding with severe cramping for the past one year”.
History of Present Illness (HPI): RG is a 41-year-old Hispanic American female who presented to the clinic with complaint of heavy prolonged menstrual bleeding with severe cramping for the past one year. Patient reported sharp pelvic pain during menstruation, bleeding between periods, pain with intercourse, blood clots during periods. Abdominal pain/pressure and bloating. Patient suggested that these symptoms started after her second caesarean section surgery one year ago. Patient also reported that she takes over-the counter medication, such as ibuprofen to relieve the pain. she also suggested that she uses heating pad on her abdomen/pelvic for pain relief, and she stated that she soaks in a warm sitz bath to ease pelvic pain and cramping. Patient also reported fatigue and weakness. Patient further stated that she decided to see an obstetrician and gynecologist (OB/GYN) because the heavy prolonged bleeding with severe menstrual cramp interfere with her regular activities. Patient denied nausea, vomiting, diarrhea, fever, and chills.
Timing/Onset: Patient said one year ago.
Location: The location of the problem as stated by the patient is pelvic/uterus/vaginal.
Duration: 5 to7 days d ...
1[Shortened Title up to 50 Characters]2Week 9 Assignment.docx
1
[Shortened Title up to 50 Characters] 2Week 9 Assignment
Bethel U. Godwins
Walden University
NURS 6551, Section 8, Primary Care of Women
July 31, 2016
Abnormal Uterine Bleeding
Society for Reproductive Endocrinology and Infertility (SREI, 2012) described abnormal uterine bleeding as bleeding that differs in quality and quantity from normal menstrual bleeding, such as women spotting or bleeding between the women’s menstrual periods; bleeding after sex; bleeding heavier or last more days than normal; and bleeding post menopause. According to SREI (2012), factors that can cause abnormal bleeding include structural abnormalities of the reproductive system, such as uterine polyps, fibroids, and adenomyosis. Furthermore, SREI (2012) explained that vaginal, uterine or cervical lesions, miscarriage, ectopic pregnancy, endometritis, adhesions in the endometrium, and use of an intrauterine device (IUD) can also cause abnormal bleeding. Johns Hopkins Medicine (2016) specified that early recognition of abnormal bleeding, and seeing a health care provider immediately for appropriate diagnosis and treatment increase the chance of successful treatment. Therefore, the author will focus on a single patient comprehensive evaluation, which includes the patient’s personal/health history; physical examination; laboratory/diagnostic tests; diagnosis; treatment/management plan; education strategies; and follow-up care. Comment by DeAllen B Millender: Good introduction.
General Patient Information
Age: 41-year-old
Race/Ethnicity: Hispanic American
Partner Status: Married Comment by DeAllen B Millender: This information is not in APA format.
Current Health Status
Chief Complaint: “I have heavy, prolonged menstrual bleeding with severe cramping for the past one year”.
History of Present Illness (HPI): RG is a 41-year-old Hispanic American female who presented to the clinic with complaint of heavy prolonged menstrual bleeding with severe cramping for the past one year. Patient reported sharp pelvic pain during menstruation, bleeding between periods, pain with intercourse, blood clots during periods. Abdominal pain/pressure and bloating. Patient suggested that these symptoms started after her second caesarean section surgery one year ago. Patient also reported that she takes over-the counter medication, such as ibuprofen to relieve the pain. she also suggested that she uses heating pad on her abdomen/pelvic for pain relief, and she stated that she soaks in a warm sitz bath to ease pelvic pain and cramping. Patient also reported fatigue and weakness. Patient further stated that she decided to see an obstetrician and gynecologist (OB/GYN) because the heavy prolonged bleeding with severe menstrual cramp interfere with her regular activities. Patient denied nausea, vomiting, diarrhea, fever, and chills.
Timing/Onset: Patient said one year ago.
Location: The location of the problem as stated by the patient is pelvic/uterus/vaginal.
Duration: 5 to7 days du ...
Analyze the subjective portion of the note. List additional inform.docx
Analyze the subjective portion of the note. List additional information that should be included in the documentation.
Analyze the objective portion of the note. List additional information that should be included in the documentation.
Is the assessment supported by the subjective and objective information? Why or why not?
Would diagnostics be appropriate for this case, and how would the results be used to make a diagnosis?
Would you reject/accept the current diagnosis? Why or why not? Identify three possible conditions that may be considered as a differential diagnosis for this patient. Explain your reasoning using at least three different references from current evidence-based literature.
GENITALIA ASSESSMENT
Subjective:
CC: “I have bumps on my bottom that I want to have checked out.”
HPI: AB, a 21-year-old WF college student reports to your clinic with external bumps on her genital area. She states the bumps are painless and feel rough. She states she is sexually active and has had more than one partner during the past year. Her initial sexual contact occurred at age 18. She reports no abnormal vaginal discharge. She is unsure how long the bumps have been there but noticed them about a week ago. Her last Pap smear exam was 3 years ago, and no dysplasia was found; the exam results were normal. She reports one sexually transmitted infection (chlamydia) about 2 years ago. She completed the treatment for chlamydia as prescribed.
PMH: Asthma
Medications: Symbicort 160/4.5mcg
Allergies: NKDA
FH: No hx of breast or cervical cancer, Father hx HTN, Mother hx HTN, GERD
Social: Denies tobacco use; occasional etoh, married, 3 children (1 girl, 2 boys)
Objective:
VS: Temp 98.6; BP 120/86; RR 16; P 92; HT 5’10”; WT 169lbs
Heart: RRR, no murmurs
Lungs: CTA, chest wall symmetrical
Genital: Normal female hair pattern distribution; no masses or swelling. Urethral meatus intact without erythema or discharge. Perineum intact. Vaginal mucosa pink and moist with rugae present, pos for firm, round, small, painless ulcer noted on external labia.
Abd: soft, normoactive bowel sounds, neg rebound, neg murphy’s, negMcBurney
Diagnostics: HSV specimen obtained
Assessment:
Chancre
Episodic/Focused SOAP Note Template
Patient Information:
Initials, Age, Sex, Race
S.
CC
(chief complaint) a BRIEF statement identifying why the patient is here - in the patient’s own words - for instance "headache", NOT "bad headache for 3 days”.
HPI
: This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, and billing analysis. Paint a picture of what is wrong with the patient. Use LOCATES Mnemonic to complete your HPI. You need to start EVERY HPI with age, race, and gender (e.g., 34-year-old AA male). You must include the seven attributes of each principal symptom in paragraph form not a list. If the CC was “headache”, the LOCATES for the HPI might look like the following example:
L.
EpisodicFocused SOAP Note Exemplar Focused SOAP Note for a pati.docx
Episodic/Focused SOAP Note Exemplar
Focused SOAP Note for a patient with chest pain
S.
CC: “Chest pain”
HPI: The patient is a 65 year old AA male who developed sudden onset of chest pain, which began early this morning. The pain is described as “crushing” and is rated nine out of 10 in terms of intensity. The pain is located in the middle of the chest and is accompanied by shortness of breath. The patient reports feeling nauseous. The patient tried an antacid with minimal relief of his symptoms.
PMH: Positive history of GERD and hypertension is controlled
FH: Mother died at 78 of breast cancer; Father at 75 of CVA. No history of premature cardiovascular disease in first degree relatives.
SH : Negative for tobacco abuse, currently or previously; consumes moderate alcohol; married for 39 years
ROS
General--Negative for fevers, chills, fatigue
Cardiovascular--Negative for orthopnea, PND, positive for intermittent lower extremity edema
Gastrointestinal--Positive for nausea without vomiting; negative for diarrhea, abdominal pain
Pulmonary--Positive for intermittent dyspnea on exertion, negative for cough or hemoptysis
O.
VS: BP 186/102; P 94; R 22; T 97.8; 02 96% Wt 235lbs; Ht 70”
General--Pt appears diaphoretic and anxious
Cardiovascular--PMI is in the 5th inter-costal space at the mid clavicular line. A grade 2/6 systolic decrescendo murmur is heard best at the
second right inter-costal space which radiates to the neck.
A third heard sound is heard at the apex. No fourth heart sound or rub are heard. No cyanosis, clubbing, noted, positive for bilateral 2+ LE edema is noted.
Gastrointestinal--The abdomen is symmetrical without distention; bowel
sounds are normal in quality and intensity in all areas; a
bruit is heard in the right para-umbilical area. No masses or
splenomegaly are noted. Positive for mid-epigastric tenderness with deep palpation.
Pulmonary-- Lungs are clear to auscultation and percussion bilaterally
Diagnostic results: EKG, CXR, CK-MB (support with evidenced and guidelines)
A.
Differential Diagnosis:
1) Myocardial Infarction (provide supportive documentation with evidence based guidelines).
2) Angina (provide supportive documentation with evidence based guidelines).
3) Costochondritis (provide supportive documentation with evidence based guidelines).
Primary Diagnosis/Presumptive Diagnosis: Myocardial Infarction
P. This section is not required for the assignments in this course (NURS 6512) but will be required for future courses.
© 2019 Walden University
Page 2 of 2
© 2019 Walden University
Page 1 of 2
Episodic/Focused SOAP Note Template
Patient Information:
Initials, Age, Sex, Race
S.
CC (chief complaint) a BRIEF statement identifying why the patient is here - in the patient’s own words - for instance "headache", NOT "bad headache for 3 days”.
HPI: This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care ...
Example Focused SOAP Note for a patient with chest painS..docx
Example
Focused SOAP Note for a patient with chest pain
S.
CC: “Chest pain”
HPI: The patient is a 65 year old AA male who developed sudden onset of chest pain, which began early this morning. The pain is described as “crushing” and is rated nine out of 10 in terms of intensity. The pain is located in the middle of the chest and is accompanied by shortness of breath. The patient reports feeling nauseous. The patient tried an antacid with minimal relief of his symptoms.
PMH: Positive history of GERD and hypertension is controlled
FH: Mother died at 78 of breast cancer; Father at 75 of CVA. No history of premature cardiovascular disease in first degree relatives.
SH : Negative for tobacco abuse, currently or previously; consumes moderate alcohol; married for 39 years
ROS
General--Negative for fevers, chills, fatigue
Cardiovascular--Negative for orthopnea, PND, positive for intermittent lower extremity edema
Gastrointestinal--Positive for nausea without vomiting; negative for diarrhea, abdominal pain
Pulmonary--Positive for intermittent dyspnea on exertion, negative for cough or hemoptysis
O.
VS: BP 186/102; P 94; R 22; T 97.8; 02 96% Wt 235lbs; Ht 70”
General--Pt appears diaphoretic and anxious
Cardiovascular--PMI is in the 5th inter-costal space at the mid clavicular line. A grade 2/6 systolic decrescendo murmur is heard best at the
second right inter-costal space which radiates to the neck.
A third heard sound is heard at the apex. No fourth heart sound or rub are heard. No cyanosis, clubbing, noted, positive for bilateral 2+ LE edema is noted.
Gastrointestinal--The abdomen is symmetrical without distention; bowel
sounds are normal in quality and intensity in all areas; a
bruit is heard in the right para-umbilical area. No masses or
splenomegaly are noted. Positive for mid-epigastric tenderness with deep palpation.
Pulmonary-- Lungs are clear to auscultation and percussion bilaterally
Diagnostic results: EKG, CXR, CK-MB (support with evidenced and guidelines)
A.
Differential Diagnosis:
1) Myocardial Infarction (provide supportive documentation with evidence based guidelines).
2) Angina (provide supportive documentation with evidence based guidelines).
3) Costochondritis (provide supportive documentation with evidence based guidelines).
Primary Diagnosis/Presumptive Diagnosis: Myocardial Infarction
P. This section is not required for the assignments in this course (NURS 6512) but will be required for future courses.
© 2014 Laureate Education, Inc.
Page 2 of 2
© 2014 Laureate Education, Inc.
Page 1 of 2
Episodic/Focused SOAP Note Template
Patient Information:
Initials, Age, Sex, Race
S.
CC (chief complaint) a BRIEF statement identifying why the patient is here - in the patient’s own words - for instance "headache", NOT "bad headache for 3 days”.
HPI: This is the symptom analysis section of your note. Thorough documentation in this section is essential for patient care, coding, a.
Financial & Managerial Accounting Assignment 1 – Financial S.docx
Financial & Managerial Accounting
Assignment 1 – Financial Statement Analysis
Financial & Managerial Accounting
Assignment 1 – Financial Statement Analysis
Guidelines for assignment
This is an individual assignment
Ground your answer in relevant theory
Plagiarism and reproduction of someone else’s work as your own will be penalized
Make use of references, where appropriate – Use Harvard or APA referencing method.
Late submission are not accepted
Financial & Managerial Accounting
Assignment 1 – Financial Statement Analysis
Structural elements should include an introduction, main body, and a conclusion
Weight – 50%
Word count guidance : part 1 – N/A. Business report wordage should be 2000 +/-10%
Type of assignment: Excel Assessed Work Folder and Business Report
Start / Finish : Week 3 – 4
Learning Outcome Assessed: 1,2,3,4
Submit one single document and not lots of different files.
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______
Age: _______
Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November ...
SOAO NotePatient Initials S.MPt. Encounter Number 2 .docx
SOAO Note
Patient Initials: S.M
Pt. Encounter Number: 2
Date: 10/12/2020
Age: 61
Sex: Female
Allergies: NKA
Advanced Directives: No
SUBJECTIVE
Chief Complaint: "I have a lump on my right breast."
HPI: S.M is a 61-year-old, Hispanic, female who presents to the office alarmed by a painful lump in her right breast that she discovered while showering. S.M reports the pain started 2 days ago while in the shower. The pain is felt when touching the right breast, and it felt on light touch. Current pain level is now 5/10. She does not report any skin changes. Patient denies any history of herbal medicine use and is currently on no medication. Pain gets worse with movement and with lifting weight. Pain is relieved with rest and medication. S.M gets some short relief with pain reliever ibuprofen 200mg that she takes twice a day for the past two days.
Past Medical History
Medication Intolerances: No known drug intolerance
Chronic Illnesses/Major traumas: The patient denies any history of major trauma.
Screening Hx/Immunizations Hx: last mammogram, which was normal, was 2 years ago.
OBGYN: Menarche at 10; LMP 2 weeks ago; last PAP 2019/Normal; GTPAL: 11001 score; no previous history of STDs. S.M is sexually active, have had 2 sexual partners in the past. S.M used condoms with previous partners. No previous gyn diagnoses or procedures done in the past.
Hospitalizations/Surgeries: Hospitalized once for delivery
Family History: There is no history of malignancy in first-degree relatives. She has one sister, age 58, who is in good health. Mother died at age 70; father died at age 64, from unknown causes.
Social History: S.M is married with one child. No use of alcohol; drinks wine socially; drinks one cup of coffee sometime to start her day at work. Never uses drugs.
Review of System
Constitutional: No significant gain/loss weight, no chills, no malaise or fatigue; no night sweats, no exercise intolerance. She does not report any skin changes. She has not experienced fever, weight loss, headache, nausea, vomiting, dizziness, or bone pain.
Skin: Denies rashes, pigmentation changes, lesions, or hair or nail changes.
Eyes: denies vision changes, diplopia, blurred vision, reports wearing eyeglasses.
Ears: Denies loss of hearing, ear pain, drainage, sensation of ears feeling full, ringing in the ear, or ear trauma.
Nose/Mouth/Throat: Denies sore throat, hoarseness, difficulty swallowing, postnasal
drip. No report of mouth or lips sore, bleeding gums, ulcerations or lesions of tongue or
mucosa; no dentures or dental appliances, or missing teeth reported.
Breast: Refers to right breast pain, or discomfort to right breast. Reports some brownish nipple discharges when squeezing the nipple and denies any breast trauma.
Heme/Lymph/Endo: Denies history of anemia, no bruising, no abnormal bleeding, and no swollen glands.
Cardiovascular: Denies chest pain, palpitations, orthopnea, edema, claudicati.
Comprehensive SOAP ExemplarPurpose To demonstrate what each s
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP note should include. Remember that Nurse Practitioners treat patients in a holistic manner and your SOAP note should reflect that premise.
Patient Initials: _______ Age: _______ Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65 year old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last three days. She reported that the “cold feels like it is descending into her chest”. The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4, last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over the counter Ibuprofen 200mg -2 PO as needed
6.) Over the counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and an hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstrating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65 and the other with prostate CA, dx at age 62. She has 1 daughter, in her 50’s, healthy, living in nearby neighborhood.
Lifestyle:
She is a retired; widowed x 8 years; lives in the city, moderate crime area, with good public transportation. She college graduate, owns her home and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center and she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue since the illness starte ...
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
SOAP NOTE SAMPLE FORMAT FOR MRC
Name: LP
Date:
Time: 1315
Age: 30
Sex: F
SUBJECTIVE
CC:
“I am having vaginal itching and pain in my lower abdomen.”
HPI:
Pt is a 30y/o AA female, who is a new patient that has recently moved to Miami. She seeks treatment today after unsuccessful self-treatment of vaginal itching, burning upon urination, and lower abdominal pain. She is concerned for the presence of a vaginal or bladder infection, or an STD. Pt denies fever. She reports the itching and burning with urination has been present for 3 weeks, and the abdominal pain has been intermittent since months ago. Pt has tried OTC products for the itching, including Monistat and Vagisil. She denies any other urinary symptoms, including urgency or frequency. She describes the abdominal pain as either sharp or dull. The pain level goes as high as 8 out of 10 at times. 200mg of PO Advil PRN reduces the pain to a 7/10. Pt denies any aggravating factors for the pain. Pt reports that she did start her menstrual cycle this morning, but denies any other discharge other that light bleeding beginning today. Pt denies douching or the use of any vaginal irritants. She reports that she is in a stable sexual relationship, and denies any new sexual partners in the last 90 days. She denies any recent or historic known exposure to STDs. She reports the use of condoms with every coital experience, as well as this being her only form of contraceptive. She reports normal monthly menstrual cycles that last 3-4 days. She reports dysmenorrhea, which she also takes Advil for. She reports her last PAP smear was in 7/2016, was normal, and reports never having an abnormal PAP smear result. Pt denies any hx of pregnancies. Other medical hx includes GERD. She reports that she has an Rx for Protonix, but she does not take it every day. Her family hx includes the presence of DM and HTN.
Current Medications:
Protonix 40mg PO Daily for GERD
MTV OTC PO Daily
Advil 200mg OTC PO PRN for pain
PMHx:
Allergies:
NKA & NKDA
Medication Intolerances:
Denies
Chronic Illnesses/Major traumas
GERD
Hospitalizations/Surgeries
Denies
Family History
Father- DM & HTN; Mother- HTN; Older sister- DM & HTN; Maternal and paternal grandparents without known medical issues; 1 brother and 3 other sisters without known medical issues; No children.
Social History
Lives alone. Currently in a stable sexual relationship with one man. Works for DEFACS. Reports occasional alcohol use, but denies tobacco or illicit drug use.
ROS
General
Denies weight change, fatigue, fever, night sweats
Cardiovascular
Denies chest pain and edema. Reports rare palpitations that are relieved by drinking water
Skin
Denies any wounds, rashes, bruising, bleeding or skin discolorations, any changes in lesions
Respiratory
Denies cough. Reports dyspnea that accompanies the rare palpitations and is also relieved by drinking water
Eyes
Denies corrective lenses, blurring, visual changes of an.
Comprehensive SOAP ExemplarPurpose To demonstrate what each sec.docx
Comprehensive SOAP Exemplar
Purpose: To demonstrate what each section of the SOAP Note should include. Remember that nurse practitioners treat patients in a holistic manner, and your SOAP Note should reflect that premise.
Patient Initials: _______
Age: _______
Gender: _______
SUBJECTIVE DATA:
Chief Complaint (CC): Coughing up phlegm and fever
History of Present Illness (HPI): Sara Jones is a 65-year-old Caucasian female who presents today with a productive cough x 3 weeks and fever for the last 3 days. She reported that the “cold feels like it is descending into her chest.” The cough is nagging and productive. She brought in a few paper towels with expectorated phlegm – yellow/brown in color. She has associated symptoms of dyspnea of exertion and fever. Her Tmax was reported to be 102.4 last night. She has been taking Ibuprofen 400mg about every 6 hours and the fever breaks, but it returns after the medication wears off. She rated the severity of her symptom discomfort at 4/10.
Medications:
1.) Lisinopril 10mg daily
2.) Combivent 2 puffs every 6 hours as needed
3.) Serovent daily
4.) Salmeterol daily
5.) Over-the-counter Ibuprofen 200mg -2 PO as needed
6.) Over-the-counter Benefiber
7.) Flonase 1 spray each night as needed for allergic rhinitis symptoms
Allergies:
Sulfa drugs - rash
Past Medical History (PMH):
1.) Emphysema with recent exacerbation 1 month ago – deferred admission – RX’d with outpatient antibiotics and hand held nebulizer treatments.
2.) Hypertension – well controlled
3.) Gastroesophageal reflux (GERD) – quiet, on no medication
4.) Osteopenia
5.) Allergic rhinitis
Past Surgical History (PSH):
1.) Cholecystectomy 1994
2.) Total abdominal hysterectomy (TAH) 1998
Sexual/Reproductive History:
Heterosexual
G1P1A0
Non-menstruating – TAH 1998
Personal/Social History:
She has smoked 2 packs of cigarettes daily x 30 years; denied ETOH or illicit drug use.
Immunization History:
Her immunizations are up to date. She received the influenza vaccine last November and the Pneumococcal vaccine at the same time.
Significant Family History:
Two brothers – one with diabetes, dx at age 65, and the other with prostate CA, dx at age 62. She has one daughter in her 30s, healthy, living in nearby neighborhood.
Lifestyle:
She is retired, has been widowed x 8 years, and lives in the city in a moderate crime area with good public transportation. She is a college graduate, owns her home, and receives a pension of $50,000 annually – financially stable.
She has a primary care nurse practitioner provider and goes for annual and routine care twice annually and as needed for episodic care. She has medical insurance but often asks for drug samples for cost savings. She has a healthy diet and eating pattern. There are resources and community groups in her area at the senior center that she attends regularly. She enjoys bingo. She has a good support system composed of family and friends.
Review of Systems:
General: + fatigue .
Nursing Care Plan Including Diagnosis and Intervention.pdf
Nursing Care Plan Including Diagnosis and Intervention.pdf
Bilateral Pulmonary Hydatid Cysts with Ruptured & Infected Hydatid Cyst of Le...
Bilateral Pulmonary Hydatid Cysts with Ruptured & Infected Hydatid Cyst of Left Lung - A Case Presentation
Operations:
First Operation:
VATS Enucleation of Hydatid Cyst of Lung (Right side)
Second Operation:
VATS followed by minimally invasive open Enucleation and Capitonnage of Hydatid Cyst of Lung (Left side)
Similar to 1) Naïve T cells have the potential to differentiate into several (20)
Soap Note 2 Chronic ConditionsSoap Note Chronic Conditions (
Soap Note 2 Chronic ConditionsSoap Note Chronic Conditions (
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
Comprehensive SOAP ExemplarPurpose To demonstrate what each s.docx
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
1[Shortened Title up to 50 Characters]16Week 9 Assignment.docx
1[Shortened Title up to 50 Characters]16Week 9 Assignment.docx
1[Shortened Title up to 50 Characters]2Week 9 Assignment.docx
1[Shortened Title up to 50 Characters]2Week 9 Assignment.docx
Analyze the subjective portion of the note. List additional inform.docx
Analyze the subjective portion of the note. List additional inform.docx
EpisodicFocused SOAP Note Exemplar Focused SOAP Note for a pati.docx
EpisodicFocused SOAP Note Exemplar Focused SOAP Note for a pati.docx
Example Focused SOAP Note for a patient with chest painS..docx
Example Focused SOAP Note for a patient with chest painS..docx
Financial & Managerial Accounting Assignment 1 – Financial S.docx
Financial & Managerial Accounting Assignment 1 – Financial S.docx
SOAO NotePatient Initials S.MPt. Encounter Number 2 .docx
SOAO NotePatient Initials S.MPt. Encounter Number 2 .docx
Comprehensive SOAP ExemplarPurpose To demonstrate what each s
Comprehensive SOAP ExemplarPurpose To demonstrate what each s
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
SOAP NOTE SAMPLE FORMAT FOR MRCName LPDateTime 1315.docx
Comprehensive SOAP ExemplarPurpose To demonstrate what each sec.docx
Comprehensive SOAP ExemplarPurpose To demonstrate what each sec.docx
Nursing Care Plan and Diagnosis for Chronic Pain.pdf
Nursing Care Plan and Diagnosis for Chronic Pain.pdf
Nursing Care Plan Including Diagnosis and Intervention.pdf
Nursing Care Plan Including Diagnosis and Intervention.pdf
Bilateral Pulmonary Hydatid Cysts with Ruptured & Infected Hydatid Cyst of Le...
Bilateral Pulmonary Hydatid Cysts with Ruptured & Infected Hydatid Cyst of Le...
More from AbbyWhyte974
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik httpswww.palaeocast.comtiktaalikW
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboar
1. This week, we learned about the balanced scorecard and dashboard reporting, performance measurement, sources of revenues for different types of healthcare organizations, and financial and strategic planning initiatives. For your Unit 3 Complete assignment, write a narrative essay (minimum 1,200 words) in which you first discuss the use of the income statement, in general, for decision-making. Then, calculate the net operating income and operating margin for this year and last year using the table information below and discuss what these figures mean for the company (i.e. what ‘story’ do they tell the reader). Use at least three scholarly sources and remember to demonstrate a thorough understanding of the READ and ATTEND sections in your essay. Cite your sources using APA format.
Table 3
HEALTH CAMPAIGNS:
CREATING & EVALUATING
Day 33
Review
Ch. 8 Review
Activity
Homework
AGENDA:
1.
2.
3.
4.
Public Health
Public health: prevention of disease and illness among groups of people.
Creation of public policy regarding health issues and tracks diseases
_________________
Public health services (CDC)
(Lillie; Mattson & Hall, 2011)
Health Campaigns
Health campaign
Seeks to promote public health
Targets beliefs, attitudes, or behaviors
________- acceptance of something as
true or not
______- positive or negative feeling
about something
________-actions
____________
Goes beyond health education to involve
health information and environmental
support/resources for health
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
4 phases of the health campaign process
1. Establish a working group and ____________
2. Strategic planning from____________
3. _________________ and evaluation
4. ______________on process evaluation and outcome
evaluation
(Lillie; Mattson & Hall, 2011)
Messaging Model for Health COM Campaigns
(Mattson & Hall, 2011, p. 253)
Phase 1: Establish a
Working Group
_________: core team for
strategic planning and advising
Includes stakeholders, health
experts, organizational
officials, community partners
_________: orgs and
businesses who have an interest in
the campaign
Provide resources:
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
Strategic plan: campaign goal and
plan of action
_______ analysis:
S_______ and
w______of campaign team
(internal to team)
O_____ and t______
(external to campaign)
Ex. grassroots support or
resistant audience
__________: research to
form strategies, select target
audiences, and develop marketing
strategies
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Needs assessment: process to
understand and determine a
community’s/population’s
health issues
Pre-campaign gather info from
Key informants
community forum
survey
_________: already
existing statistics
(Lillie; Mattson & Hall, 2011)
Phase 2: Strategic
Planning
CONT.
Messaging process: after determining
baseline attitudes, beliefs, and behavi ...
1. The company I chose was Amazon2.3.4.1) Keep i
1. The company I chose was Amazon
2.
3.
4.
1) Keep in mind that the data includes Amazon and competitors
2) Example(For reference only)
Table showing FedEx’s stock quote
Item
Value
Interpretation and brief explanation
Current market price
$274.48
This is the price of FedEx stock that it sells for on the free stock market at as of now. Anyone wishing to purchase the company’s stock will have to pay the $274.48. This market value will habitually vary all through the exchange day as investors sell and buy the Fed Ex stock. The price will increase if more traders want to buy it and decrease or drop as traders begin selling more of the company’s stock.
Market capitalization
$72.076 Billion
This the stock price multiplied by the number of equity shares outstanding. So it is the price above multiplied by the number of FedEx’s hares outstanding
Beta
1.39 (5 year Monthly)
Beta is a measure of how a separate asset shifts when the general stock market decreases or increases(Beta, 2011). In simple it is measure of a risk associated with an asset's risk in relation to the whole market (for instance, the S&P500 index). It is a measure of FedEx’s stock relative volatility. FedEx’s beta is more than meaning it is less stable. If S&P 500 Index has a base of let’s say 1 and this index changes by 3% then the stock of FedEx will as well change by 4.17% (1.39 X 3%).
PE Ratio
40.41
In general, a great P/E ratio shows that investors anticipate for greater pays. Though, a security with a great P/E ratio is not certainly a superior investment than one with a lesser P/E ratio (Park, 2020). On the other hand, when a corporation's security has a small P/E ratio, it might have an indication that the stock is underestimated. In light of FedEx’s PE ratio of 40.41 its means that the stock was trading at around 40 times the earnings. This ratio is more than the overall ration in the S&P 500 Index meaning the company share is not overvalued.
EPS
$6.79
This is computed by dividing the net earnings attributable to the shareholders by the number of outstanding equity shares. This point outs the amount a corporation makes from each share. This item is important in determining the stock prices particularly when calculating the P/E ratio. $6.79 shows that each FedEx common stock earns around $6.79.
Earning date
December 16th 2020
This is the date of when a company will release its next financial reports. So, FedEx will have its next financial statements released on 16th December 2020. On this day there are expected large movements of its underlying.
Forward Dividend Yield
2.60 (0.93%)
This forward yield is an approximation of a year's dividend stated as a ratio of the present stock price. The year's expected dividend is determined by taking a security’s most latest actual dividend disbursement and annualizing it. The forward dividend yield is computed by dividing a year's value of future dividend disbursements by a stock's present share price. It is a corporation's pr ...
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStu
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refund
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to perform
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Respond to your classmates’ question and post. Submission to y
1. Respond to your classmates’ question and post. Submission to your classmates must meet a minimum requirement of 50 Curiosity Points to count for credit.
1. What is the thesis of your Response?
1. Defend your Response in 200 words or less
PEERS QUESTION AND POST:
How does having a growth mindset affect students?
When having a growth mindset, you will always believe that there is room to grow. You will not be comfortable and complacent. With a growth mindset, you are always wanting to become better. It helps students know that they are not stuck and that they can achieve any goal they want. I believe that having that growth mindset gives students motivation to want to do better and be better.
- Gabriella Enriquez
https://biglifejournal.com/blogs/blog/teach-growth-mindset-kids-activities
Procedia Engineering 69 ( 2014 ) 830 – 837
Available online at www.sciencedirect.com
1877-7058 © 2014 The Authors. Published by Elsevier Ltd. Open access under CC BY-NC-ND license.
Selection and peer-review under responsibility of DAAAM International Vienna
doi: 10.1016/j.proeng.2014.03.060
ScienceDirect
24th DAAAM International Symposium on Intelligent Manufacturing and Automation, 2013
Thinking Styles and Product Development Project Types:
How to Match Them?
Anja Orcik*, Petar Vrgovic, Zeljko Tekic
Faculty of Technical Sciences, University of Novi Sad, Trg Dositeja Obradovica 6, 21000 Novi Sad, Serbia
Abstract
Focusing on the characteristics of different thinking styles and different product development project types, we suggest that
people should adapt their thinking strategies according to the challenge they face and choose a thinking style that is a best match
for the type of project they are working on. Even though people can perform well in more than one thinking style, they can be
more successful if they adequately choose the most appropriate one for solving the problem in front of them. Considering that
different thinking styles have different ideas and conclusions as results, we propose how to match them to a specific product
development project type that has a certain degree of change in the product as a deliverable. For further research, these findings
open the possibility to define the most appropriate creative problem solving methods and techniques that spur and support a
specific style of thinking.
© 2014 The Authors. Published by Elsevier Ltd.
Selection and peer-review under responsibility of DAAAM International Vienna.
Keywords: Thinking styles; Brain Dominance Instrument; Product development projects; Problem solving
1. Introduction
Product development has been defined as one of the riskiest, yet most important endeavours of the modern
corporation [1]. To respond to the changing environment and stay competitive in long-term, companies need to
provide quality, variety, novelty and functionality of products for their customers [2]. This requires constant
improvement of existing products, as we ...
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected]
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
More from AbbyWhyte974 (20)
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use Postman” to test API at httpspostman-echo.coma. Use
1. Use the rubric to complete the assignment and pay attention t
1. Use the rubric to complete the assignment and pay attention t
1. True or false. Unlike a merchandising business, a manufacturing
1. True or false. Unlike a merchandising business, a manufacturing
1. Top hedge fund manager Sally Buffit believes that a stock with
1. Top hedge fund manager Sally Buffit believes that a stock with
1. This question is on the application of the Binomial option
1. This question is on the application of the Binomial option
1. This week, we learned about the balanced scorecard and dashboar
1. This week, we learned about the balanced scorecard and dashboar
1. Think about a persuasive speech that you would like to present
1. Think about a persuasive speech that you would like to present
1. The two properties about a set of measurements of a dependent v
1. The two properties about a set of measurements of a dependent v
1. The Danube River flows through 10 countries. Name them in the s
1. The Danube River flows through 10 countries. Name them in the s
1. The 3 genes that you will compare at listed below. Take a look.
1. The 3 genes that you will compare at listed below. Take a look.
1. Student and trainer detailsStudent details Full nameStu
1. Student and trainer detailsStudent details Full nameStu
1. Student uses MS Excel to calculate income tax expense or refund
1. Student uses MS Excel to calculate income tax expense or refund
1. Socrates - In your view, what was it about Socrates’ teachings
1. Socrates - In your view, what was it about Socrates’ teachings
1. Select a patient” (friend or family member) on whom to perform
1. Select a patient” (friend or family member) on whom to perform
1. Respond to your classmates’ question and post. Submission to y
1. Respond to your classmates’ question and post. Submission to y
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Review the HCAPHS survey document, by clicking on the hyperlink
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...plea
Recently uploaded
The French Revolution Class 9 Study Material pdf free download
The French Revolution, which began in 1789, was a period of radical social and political upheaval in France. It marked the decline of absolute monarchies, the rise of secular and democratic republics, and the eventual rise of Napoleon Bonaparte. This revolutionary period is crucial in understanding the transition from feudalism to modernity in Europe.
For more information, visit-www.vavaclasses.com
How to Make a Field invisible in Odoo 17
It is possible to hide or invisible some fields in odoo. Commonly using “invisible” attribute in the field definition to invisible the fields. This slide will show how to make a field invisible in odoo 17.
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
Acetabularia Information For Class 9 .docx
Acetabularia acetabulum is a single-celled green alga that in its vegetative state is morphologically differentiated into a basal rhizoid and an axially elongated stalk, which bears whorls of branching hairs. The single diploid nucleus resides in the rhizoid.
Best Digital Marketing Institute In NOIDA
Safalta Digital marketing institute in Noida, provide complete applications that encompass a huge range of virtual advertising and marketing additives, which includes search engine optimization, virtual communication advertising, pay-per-click on marketing, content material advertising, internet analytics, and greater. These university courses are designed for students who possess a comprehensive understanding of virtual marketing strategies and attributes.Safalta Digital Marketing Institute in Noida is a first choice for young individuals or students who are looking to start their careers in the field of digital advertising. The institute gives specialized courses designed and certification.
for beginners, providing thorough training in areas such as SEO, digital communication marketing, and PPC training in Noida. After finishing the program, students receive the certifications recognised by top different universitie, setting a strong foundation for a successful career in digital marketing.
Unit 8 - Information and Communication Technology (Paper I).pdf
This slides describes the basic concepts of ICT, basics of Email, Emerging Technology and Digital Initiatives in Education. This presentations aligns with the UGC Paper I syllabus.
The approach at University of Liverpool.pptx
How libraries can support authors with open access requirements for UKRI funded books
Wednesday 22 May 2024, 14:00-15:00.
Azure Interview Questions and Answers PDF By ScholarHat
Azure Interview Questions and Answers PDF By ScholarHat
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Event Link:-
https://meetups.mulesoft.com/events/details/mulesoft-mysore-presents-exploring-gemini-ai-and-integration-with-mulesoft/
Agenda
● Java 17 Upgrade Overview
● Why and by when do customers need to upgrade to Java 17?
● Is there any immediate impact to upgrading to Mule Runtime 4.6 and beyond?
● Which MuleSoft products are in scope?
For Upcoming Meetups Join Mysore Meetup Group - https://meetups.mulesoft.com/mysore/
YouTube:- youtube.com/@mulesoftmysore
Mysore WhatsApp group:- https://chat.whatsapp.com/EhqtHtCC75vCAX7gaO842N
Speaker:-
Shubham Chaurasia - https://www.linkedin.com/in/shubhamchaurasia1/
Priya Shaw - https://www.linkedin.com/in/priya-shaw
Organizers:-
Shubham Chaurasia - https://www.linkedin.com/in/shubhamchaurasia1/
Giridhar Meka - https://www.linkedin.com/in/giridharmeka
Priya Shaw - https://www.linkedin.com/in/priya-shaw
Shyam Raj Prasad-
https://www.linkedin.com/in/shyam-raj-prasad/
Synthetic Fiber Construction in lab .pptx
Synthetic fiber production is a fascinating and complex field that blends chemistry, engineering, and environmental science. By understanding these aspects, students can gain a comprehensive view of synthetic fiber production, its impact on society and the environment, and the potential for future innovations. Synthetic fibers play a crucial role in modern society, impacting various aspects of daily life, industry, and the environment. ynthetic fibers are integral to modern life, offering a range of benefits from cost-effectiveness and versatility to innovative applications and performance characteristics. While they pose environmental challenges, ongoing research and development aim to create more sustainable and eco-friendly alternatives. Understanding the importance of synthetic fibers helps in appreciating their role in the economy, industry, and daily life, while also emphasizing the need for sustainable practices and innovation.
Overview on Edible Vaccine: Pros & Cons with Mechanism
This ppt include the description of the edible vaccine i.e. a new concept over the traditional vaccine administered by injection.
Introduction to AI for Nonprofits with Tapp Network
Dive into the world of AI! Experts Jon Hill and Tareq Monaur will guide you through AI's role in enhancing nonprofit websites and basic marketing strategies, making it easy to understand and apply.
2024.06.01 Introducing a competency framework for languag learning materials ...
http://sandymillin.wordpress.com/iateflwebinar2024
Published classroom materials form the basis of syllabuses, drive teacher professional development, and have a potentially huge influence on learners, teachers and education systems. All teachers also create their own materials, whether a few sentences on a blackboard, a highly-structured fully-realised online course, or anything in between. Despite this, the knowledge and skills needed to create effective language learning materials are rarely part of teacher training, and are mostly learnt by trial and error.
Knowledge and skills frameworks, generally called competency frameworks, for ELT teachers, trainers and managers have existed for a few years now. However, until I created one for my MA dissertation, there wasn’t one drawing together what we need to know and do to be able to effectively produce language learning materials.
This webinar will introduce you to my framework, highlighting the key competencies I identified from my research. It will also show how anybody involved in language teaching (any language, not just English!), teacher training, managing schools or developing language learning materials can benefit from using the framework.
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...Nguyen Thanh Tu Collection
https://app.box.com/s/hqnndn05v4q5a4k4jd597rkdbda0fniiHow libraries can support authors with open access requirements for UKRI fund...
How libraries can support authors with open access requirements for UKRI funded books
Wednesday 22 May 2024, 14:00-15:00.
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance
TESDA TM1 REVIEWER FOR NATIONAL ASSESSMENT WRITTEN AND ORAL QUESTIONS WITH A...
TESDA TM1 REVIEWER FOR NATIONAL ASSESSMENT WRITTEN AND ORAL QUESTIONS WITH ANSWERS.
Biological Screening of Herbal Drugs in detailed.
Biological screening of herbal drugs: Introduction and Need for
Phyto-Pharmacological Screening, New Strategies for evaluating
Natural Products, In vitro evaluation techniques for Antioxidants, Antimicrobial and Anticancer drugs. In vivo evaluation techniques
for Anti-inflammatory, Antiulcer, Anticancer, Wound healing, Antidiabetic, Hepatoprotective, Cardio protective, Diuretics and
Antifertility, Toxicity studies as per OECD guidelines
Operation Blue Star - Saka Neela Tara
Operation “Blue Star” is the only event in the history of Independent India where the state went into war with its own people. Even after about 40 years it is not clear if it was culmination of states anger over people of the region, a political game of power or start of dictatorial chapter in the democratic setup.
The people of Punjab felt alienated from main stream due to denial of their just demands during a long democratic struggle since independence. As it happen all over the word, it led to militant struggle with great loss of lives of military, police and civilian personnel. Killing of Indira Gandhi and massacre of innocent Sikhs in Delhi and other India cities was also associated with this movement.
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptxMohd Adib Abd Muin, Senior Lecturer at Universiti Utara Malaysia
This slide is prepared for master's students (MIFB & MIBS) UUM. May it be useful to all.Recently uploaded (20)
The French Revolution Class 9 Study Material pdf free download
The French Revolution Class 9 Study Material pdf free download
Advantages and Disadvantages of CMS from an SEO Perspective
Advantages and Disadvantages of CMS from an SEO Perspective
Unit 8 - Information and Communication Technology (Paper I).pdf
Unit 8 - Information and Communication Technology (Paper I).pdf
Azure Interview Questions and Answers PDF By ScholarHat
Azure Interview Questions and Answers PDF By ScholarHat
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Mule 4.6 & Java 17 Upgrade | MuleSoft Mysore Meetup #46
Overview on Edible Vaccine: Pros & Cons with Mechanism
Overview on Edible Vaccine: Pros & Cons with Mechanism
Introduction to AI for Nonprofits with Tapp Network
Introduction to AI for Nonprofits with Tapp Network
2024.06.01 Introducing a competency framework for languag learning materials ...
2024.06.01 Introducing a competency framework for languag learning materials ...
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...
BÀI TẬP BỔ TRỢ TIẾNG ANH GLOBAL SUCCESS LỚP 3 - CẢ NĂM (CÓ FILE NGHE VÀ ĐÁP Á...
How libraries can support authors with open access requirements for UKRI fund...
How libraries can support authors with open access requirements for UKRI fund...
A Survey of Techniques for Maximizing LLM Performance.pptx
A Survey of Techniques for Maximizing LLM Performance.pptx
TESDA TM1 REVIEWER FOR NATIONAL ASSESSMENT WRITTEN AND ORAL QUESTIONS WITH A...
TESDA TM1 REVIEWER FOR NATIONAL ASSESSMENT WRITTEN AND ORAL QUESTIONS WITH A...
Chapter 3 - Islamic Banking Products and Services.pptx
Chapter 3 - Islamic Banking Products and Services.pptx
1) Naïve T cells have the potential to differentiate into several
- 1. 1) Naïve T cells have the potential to differentiate into several types of effector cells. In the space below, describe the roles and activities of each of these cells: TH1 cells TH2 cells TH17 cells TFH cells 2) Use the following diagram to compare and contrast systemic immunity and mucosal immunity. Systemic Both Systemic and Mucosal Mucosal ordinary surface epithelia Why is there a need for these differences in the first place? CDC Sexually Transmitted Diseases Case Study. Read the patient case study below General: The patient is a young seventeen-year-old female who came
- 2. to the clinic with complaint of abdominal pain. Chief Complaint: Kim reports "I've been having pain in my stomach for several weeks." She describes the pain as being sharp and being constant. She stated the pain often occurs on both sides of her lower abdominal. She has been experiencing the pain for the past two weeks. The pain has gotten worse since then. Reliability and Source of History: The patient is alert and oriented and able to answer most of the questions. Source & Reliability of History: O – "I have been having pain in my stomach for several weeks now.” she stated that the pain has lasted for two weeks without any relief. L – Both sides of her lower stomach D – The patient reported that she has been having this bilateral lower stomach pain for the last two weeks, However, the symptoms got worse since the pain started ago. C – She stated that since the onset of the pain, her pain has remained constant without any relieve and aggravating factor. The pain is firm regardless of the time or day or event. She further stated that her symptoms get worse. The patient states that she is unaware of what caused the pain or how the pain started; however, she stated that taking pills could relieve her stomach pain and stop her bleeding A – She stated that the pain remains constant. She also stated that she is unaware of what caused the pain or how the pain started. R – She stated that the pain remains steady and does not go away or radiate to other areas. T- she reported feeling uncomfortable doing her regular shores due to the pain. Past Medical history: Patient is asthmatic; however, her asthma is under control. She knows known history of any other condition or
- 3. never been hospitalized. Family History: She is the second in a family of four who are all alive and healthy. There is no history of any chronic condition in the family. Social History: Patient is a regularly active young woman; she is single and does moderately active exercise. However, she stated that her daily activity and chores has recently reduced due to her recent symptoms of pain. She also stated to have no appetite secondary to her recent pain. She also stated that her stress level may be related with her college. She has no history of alcohol, smoking, or had never smoked in her life. She has not used any illicit drug. She is very safe with rules like using her seatbelt and sunscreen. She also stated to have a smoke alarm in her room, overly cautious. She has never been pregnant or been diagnosed with any other sexually transmitted diseases. She denies having multiple sex partner or being on contraceptive recently. Medications: The patient is on inhaler (albuterol) which is a short-acting beta-agonist. She takes this to relieve her asthma condition. Allergies: NKDA Review of System Vital Signs: Patient blood pressure was 100/60, Resp: 18, Pulse 100, Temp: 100.3, Oxygen saturation 97%. The patient height is 5 ft; 3inches, her weight was 135 Ibs. General: The patient is alert and oriented, she appears to be relaxed and without any distress noted except being worried about the pain which she states “if I take a pill, that should relieve my pain and bleeding.”( Kim, 2020)
- 4. Skin: Patient denies any skin issues, rashes, or itching. The patient reports the use of sunscreen whenever needed, especially when outside in the sun. Hair/nails: Patient reports no change in her nails or hair loss. Head: Patient denies any headaches, or any history of head injury, or dizziness Eyes: Patient stated to have a clear vision. denies any pain, or dryness, stated She doesn’t wear any glasses. Ears: Patient denies any ear problems, no hearing aids with hearing, denies any pain, vertigo, tinnitus, discharge, or any history of infections Nose and sinus: patient denies having any sinus infection during the assessment. Mouth and throat: The patient denied any mouth problems or infection, denies any bleeding from the gums, no sore throat. Neck: The patient denies any pain or stiffness. Breasts: The patient denies any breast pain Respiratory system: The patient denies any trouble breathing, coughing, or talking. Denies any history of lung disorder Cardiovascular: the patient reports lower abdominal pain. Peripheral Vascular: Patient denies any leg cramps, varicose veins, denies any history of blood clots, swelling, coldness, or numbness Gastrointestinal: she denies any changes in her diet. She also stated that the pain did not start with food nor does she get relieve from food. Urinary: Patient denies any difficulty during urination, denies any burning sensation, nocturia, polyuria, hesitancy, straining Genitals: Patient denials any Genital issue/Past or Present STD. Sexual health: The patient reports Normal sexual habits. No Multiple partners. She’s not married. Musculoskeletal system: Patient denies any muscle or joint pains, stiffness, arthritis, gout, back pain, swelling, redness, stiffness, ROM Neuro: Patient stated to have no dizziness, blackouts, seizures, weakness, paralysis, numbness, tingling, tremors in her
- 5. extremities. Psyche: The patient denies any sign of depression,nervousness, anxiety, or abnormal mood changes Hematologic: The patient reported slight vaginal bleeding Endocrine: The patient denies any history of diabetes diagnosis or issues in her family. Functional Assessment: Immunization: Her immunization is up to date Activity/Exercise: The patient reports she exercise frequently however she has not been able to do that due to her stomach pain. Sleep/Rest: The patient reports not awakening at night, regardless of her symptoms. Constitutional: The patient Denies fever, chills. However, her temp was 100.3 Cardiovascular: lower stomach pain. No complaint of chest pain. Neurological: Denies slurred speech; the patient was able to communicate clearly, alert, oriented x Nutrition: The patient nutrition seems regular.
- 6. Work: College Student Spirituality: Parents were both Christian Safety Concerns: The patient report feeling worried about her college, however no other pain. Psycho/Social history: The patient stated she never smoke in her life, she denies use of any other drug use, EtOH, drugs, smoking, vaping. The patient denies any suicidal ideation or depression. ASSIGNMENT REQUIRED. You will then formulate your differential diagnoses list, develop a plan of care, and submit a written clinic note documenting your care of this patient. Your differential diagnoses list should consist of 4 diagnoses, including 1 of which is your final diagnosis. Please briefly describe your rationale and reasoning for why you would include or rule out a diagnosis in your working diagnosis list. What information from the subjective or physical examination is indicative of that diagnosis? Provide 6 research nursing and medical references for your rationale. This paper should be 10 to 12 pages long. _____________________________________________________ ___________________ Hint 1 (Patient primary diagnoses is pelvic inflammatory disease) other secondary diagnoses are anemia, Hint 2 (patient treatment plan which should include the up to
- 7. date a Combination of antibiotics to treat---- C.Trachomatis, N.Gonorrhoeae, Vaginal anaerobes and enteric gram negative rods. Hint 3—this are the labs that you should order for the patient. 1. Hematologic/37/peripheral blood smear 2. Immunology /43 MHAT (Micro-hemagglutination Treponema) 3. Immunology/69/VDRL, Blood 4. Blood H-Z /09/iron, fe 5. Blood H-Z/10/Iron-binding capacity (TIBC) 6. Blood H-Z/01/Hepatitis panel:HBs, HBCcAG, HA, antiHBS, antiHA, antiHBc 7. Blood H-Z/12/Lactic Dehydrogenase (LDH) 8. Blood A-G/13/ALT(SGPT) 9. Blood A-G/12/Lactic Dehydrogenase (LDH) 10. Other/40/Laparoscopy 11. Urea breath test (Non-invasive 12. Hematologic complete blood count with differential CBC/Diff 13. Urine----Hydroxycorticosteroids 14. Urine----Urinalysis, Routine (UA) 15. Ultrasound----Pelvis 16. Urine----Human Chorionic Gonadotropin (pregnancy test, routine or equivalent) 17. Ultrasound-----Trans-Vaginal Ultrasound or equivalent 18. Microbiology---Chlamydia Culture Required 1. Collaborative –Gynecologist /obstetrician (because a laparoscopy may be necessary). 2. Counseling ---individual 3. Antimicrobial----Antibacterial----center for disease control should be followed.
- 8. 4. Procedure---insert IV 5. Nursing Care—intravenous fluids Treatment 1. Combination of antibiotics ----against C.Trachomatis, N.Gonorrhea, Vaginal anaerobes and enteric gram negative rods. 2. Intravenous Fluids ---should be administered because patient is severe ill, She has fever 3. She will need to be Npo ---just incase abdominal surgery is needed/ any patient in whom surgery or laparoscopy may be required for diagnosis of treatment so patient should be NPO until the question is resolved. 4. Narcotic Analgesic ---needed for pain control once the diagnosed as been established. 5. Abstinence----is the recommended form of contraception for adolescents. However oral or intramuscular contraceptives can be prescribed in addition to barrier methods if requested by the patient. Recommended: 1. Diet---Npo 2. Endocrine---Contraceptives 3. Education—disease process/ counseling about STD 4. Education—preventative health 5. Activity----Active range of motion or equivalent 6. Bed Rest----is recommended in this patient to assist with pain control and prevent worsening of symptoms. 1. Ultrasound—pelvis 2. Urine---human chorionic gonadotropin (pregnancy test) Follow-up · A follow-up visit to monitor the abdominal and genital exam findings is necessary to assess the response to therapy · Abdominal and Bimanual examinations should be done in
- 9. follow-up to assess this patient’s response to therapy · A follow up ultrasound may be indicated to ensure the disease process has completely resolved. · Any adverse reaction to medication is vital and important