This document discusses several topics related to multinational management:
1. It examines Hofstede's model of national culture and asks which dimensions are still important today and which may be least important for multinational management success.
2. It discusses the responsibilities of a multinational manager, including preparing for different cultures, seeking cultural information, and how managerial responsibilities may differ from a domestic role.
3. It asks which levels of culture (e.g. surface, deep) may be most/least difficult for a multinational manager to understand and manage, asking for examples.
4. It discusses perceptions of free trade and its advantages/disadvantages.
5. It outlines the
REGULARIAN PERSPECTIVETo gain a sense of why it is important to.docxsodhi3
REGULARIAN PERSPECTIVE
“To gain a sense of why it is important to subject morality to philosophical inquiry, we should view morality, not as a collection of rules, but as a set of guidelines that we must apply to the very complex circumstances of our lives.” (Furrow, 2005)As such, each of the theories discussed in CRJU 250 have their strengths and weaknesses, and serve as base – not an absolute - for resolving ethical dilemmas.There does not appear to be one all-inclusive theory of moral reasoning.
The regularian perspective, at face value, appears simplistic. The only thing the person, making the decision regarding an ethical dilemma, needs to know is the rule(s). This perspective views that an act is morally good if it obeys the rules. If the rule(s) indicates the action is permissible then it is considered ethical; in contrast, if the rule(s) indicates the action is not permissible, then it is considered unethical. This perspective posits that the individual is obligated to follow the rules. Similar to other perspectives, with regularianism, the person making the decision must avoid desires and emotions, and act objectively. This is the most notable advantage of rule-based ethics. Sources for rules include commands, directives, policies and procedures, Code of Ethics, and laws.
Problems: What if it is a bad or immoral rule? An example of this is the Nuremberg Defense; where the individuals who perpetrated crimes against the Jews during WW II, claimed they did nothing wrong since they were following Hitler’s rules to murder them. What if there is not rule? Hmmm?! What if there are two rules that conflict each other? The hope is that the person who is making the decision will find another rule that clarifies the conflict!
STEPS:
1. Regardless of the possible options, what is (are) the rule(s)? I must follow the rule(s).
REFERENCES
Dreisbach, C. (2008). Ethics in Criminal Justice. New York: McGraw Hill Higher Education.
Furrow, D. (2005). Ethics: Key Concepts in Philosophy. New York: Continuum Books.
DEONTOLOGICAL PERSPECTIVE
“To gain a sense of why it is important to subject morality to philosophical inquiry, we should view morality, not as a collection of rules, but as a set of guidelines that we must apply to the very complex circumstances of our lives.” (Furrow, 2005)As such, each of the theories discussed in CRJU 250 have their strengths and weaknesses, and serve as base – not an absolute - for resolving ethical dilemma. There does not appear to be one all-inclusive theory of moral reasoning.
Deontologists believe that one’s action must conform to recognized duties, the consequences are not important. By conforming, one is “doing the right thing” not because it solely pleases the individual or promotes good consequences, but rather because the individual is adhering to the concepts of duty, obligation and rationality. The deontological perspective allows for one’s intentions/motives to be valued, regardless of the outcome.
Deontolog ...
Kant was an influential 18th century philosopher who developed deontological ethics. He believed morality should be based on universal principles of reason and duty rather than subjective feelings or consequences. For Kant, the supreme moral principle was the categorical imperative - we should only act in a way that could become a universal law applying to all people. This and treating people as ends in themselves, not means, form the basis of Kant's deontological ethical philosophy.
RUNNING HEAD: Christian Worldview 6
Christian Worldview and Operations Management
Name
Course
Date
Christian Worldview and Operations Management
Biblical or Christian world view is the way of life that is based on the teachings and preaching of Bible. If a person considers teachings of Bible as the standard to be followed in life and he tends to decide what to do or say according to them, then he is apparently following Biblical worldview. God selected to let those rules oversee God's creation, moderately than God requiring altering the course of those heavenly laws.
Accordingly, wonders do not occur and God is "Wholly Other", comprehensive superior from mortality, with unconditionally no nearness among persons. One conceivable logical importance of deism is that since God doesn't have to be complicated in humanoid businesses, then we actually don't essential God at all. Disbelief can quickly be acceptable from a technical, logical and even intelligently religious viewpoint.
Another offshoot of modernization is fundamentalism, which first increased importance in the early 20th century. On the outward, while deism and fundamentalism seem to be conflicting excesses, they portion many conventions. Most apparent is the ethical and psychic potentials originate within humanity that reflects the personality of God.
The foundations of Christian theology are expressed in ecumenical creeds. These professions of faith state that Jesus grieved, expired, were suppressed, and were resuscitated from the dead in order to grant everlasting life to those who have faith in in him and faith in him for the reduction of their immoralities.
The faiths further uphold that Jesus physically rose into paradise, where he reigns with God the Father. Most Christian coinages teach that Jesus will return to judge everybody, living and dead, and to grant eternal life to his supporters. He is reflected the model of a righteous life. His ministry, execution, and renaissance are often mentioned to as the "gospel", meaning "good news”.
Biblical View influences me when I try resolving ethical dilemmas which I confront in my personal or professional life. I try to define my moral values according to the basics elucidated in Bible.
This leads me support and feeling that I am doing the right thing. I do not follow practical ethical values in resolving ethical dilemmas because they are mostly derived from convenience and ease of application rather than following the right path. Bible influences me to a great extent for knowing between the right and wrong and also between the two rights and thus I always arrive at a best possible solution.
The Macdonald’s case
Strict liability allows the injured party to seek reimbursement from whoever was accountable for the product being faulty. Contrasting negligence, the injured individual does not need to determine who precisely failed to do ...
Final Project In this two-phased final assignment, students wil.docxAKHIL969626
Final Project:
In this two-phased final assignment, students will select a topic from the Unique Ethical Issues from weeks 3, 5, and 7, research the topic and discuss the ethical dilemma in detail.
Phase 1:
In week 4, students will submit to the Assignment Folder a brief one page paper that identifies the unique ethical issue, the ethical dilemma and the traditional theories that will be used to suggest potential resolution of the dilemmas.
Phase 2:
Required Elements of Final Project:
· Using the information from Phase 1, students will thoroughly research the topic and define the ethical concerns in detail.
· Using two of the traditional theories from week 2, suggest potential resolutions to the dilemma(s)
· In the discussion of the resolution, include the impact that ethical relativism and globalization may have upon the suggested dilemma resolution.
· Select the best resolution and explain in detail why.
Required Formatting of Final Project:
This paper should be double-spaced, 12-point font, and six to eight pages in length excluding the title page and reference page;
Title page;
Introductory paragraph and a summary paragraph;
Use headings to demarcate your discussion;
Write in the third person;
Use APA formatting for in-text citations and a reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
Submit the paper in the Assignment Folder.
Theories from Week 2
TELEOLOGICAL - This describes an ethical theory which judges the rightness of an action in terms of an external goal or purpose. So, according to a teleological theory, consequences always play some part, be it small or large, in the determination of what one should or should not do. Not all teleological theories are consequentialist. John Rawls' theory of justice is teleological, but not consequentialist because it claims that consequences are only part of what must be considered when determining what policy is morally just. (Rawls)
Benefits - 1. There is room in some theories for good intentions, even if the action didn’t active the desired end. 2. Active attempt to connect morality with the “real” world. 3. By allowing for the consideration of consequences, teleological theories can adapt to different circumstances and situations. (Also see “utilitarianism”)
Problems - Depends on the theory. See “utilitarianism” for an example.
CONSEQUENTIALIST - Under a consequentialist theory, the consequences of an action determine its moral value. A key question in consequentialist theory is how to measure the moral worth of the consequences. Consequences can be good, neutral, or evil. Another relevant question is which consequences count (intended or actual). If only actual consequences count, then do all consequences count? Consequences can be distinguished by direct/indirect, individuals/objects affected, influence of complicating factors, etc.
All of these conside ...
This document provides a framework for ethical decision making. It begins by defining ethics as standards of behavior for how humans ought to act in different situations, rather than being based on feelings, religion, laws, social norms, or science alone. It then discusses two challenges in identifying ethical standards: determining the basis and applying standards to specific situations. Five approaches are described for deriving ethical standards: utilitarianism, rights, fairness, common good, and virtues. While these approaches may provide different answers, they often lead to similar conclusions. The document concludes by outlining a 10-step process for recognizing ethical issues, gathering facts, evaluating options, making a decision, implementing it, and reflecting on the outcome.
This document provides an overview of ethical thinking and decision making. It discusses that ethics relates to how individuals and groups should behave and interact. The document then examines what ethics is and is not, including that ethics is not based solely on feelings, religion, laws, social norms, or science. It explores five sources of ethical standards: utilitarianism, rights, fairness, common good, and virtues. The document notes challenges in applying these standards but also how they often lead to similar ethical outcomes. It concludes by outlining a framework for ethical decision making.
Deontological ethics is a theory that bases the morality of actions on duties and rights rather than the consequences of the actions. It proposes that an action is right if it adheres to a moral rule or duty. Immanuel Kant's theory of deontology is one of the most influential. For Kant, the only intrinsically good thing is a good will. He formulated the Categorical Imperative which states that moral rules must be universal and that people should never be treated merely as a means but always as ends in themselves. Deontological ethics emphasizes adherence to rules and duties over consequences, but it is criticized for being too rigid and not dealing well with conflicts between duties.
Deontological ethics is a theory that bases the morality of actions on duties and rights rather than the consequences of the actions. It proposes that an action is right if it adheres to a moral rule or duty. Immanuel Kant's theory of deontology is one of the most influential. For Kant, the only intrinsically good thing is a good will. He formulated the Categorical Imperative which states that moral rules must be universal and that people should never be treated merely as a means but always as ends in themselves. Deontological ethics emphasizes adherence to rules and duties over consequences, but it is sometimes criticized for being too rigid and not dealing well with conflicts between duties.
REGULARIAN PERSPECTIVETo gain a sense of why it is important to.docxsodhi3
REGULARIAN PERSPECTIVE
“To gain a sense of why it is important to subject morality to philosophical inquiry, we should view morality, not as a collection of rules, but as a set of guidelines that we must apply to the very complex circumstances of our lives.” (Furrow, 2005)As such, each of the theories discussed in CRJU 250 have their strengths and weaknesses, and serve as base – not an absolute - for resolving ethical dilemmas.There does not appear to be one all-inclusive theory of moral reasoning.
The regularian perspective, at face value, appears simplistic. The only thing the person, making the decision regarding an ethical dilemma, needs to know is the rule(s). This perspective views that an act is morally good if it obeys the rules. If the rule(s) indicates the action is permissible then it is considered ethical; in contrast, if the rule(s) indicates the action is not permissible, then it is considered unethical. This perspective posits that the individual is obligated to follow the rules. Similar to other perspectives, with regularianism, the person making the decision must avoid desires and emotions, and act objectively. This is the most notable advantage of rule-based ethics. Sources for rules include commands, directives, policies and procedures, Code of Ethics, and laws.
Problems: What if it is a bad or immoral rule? An example of this is the Nuremberg Defense; where the individuals who perpetrated crimes against the Jews during WW II, claimed they did nothing wrong since they were following Hitler’s rules to murder them. What if there is not rule? Hmmm?! What if there are two rules that conflict each other? The hope is that the person who is making the decision will find another rule that clarifies the conflict!
STEPS:
1. Regardless of the possible options, what is (are) the rule(s)? I must follow the rule(s).
REFERENCES
Dreisbach, C. (2008). Ethics in Criminal Justice. New York: McGraw Hill Higher Education.
Furrow, D. (2005). Ethics: Key Concepts in Philosophy. New York: Continuum Books.
DEONTOLOGICAL PERSPECTIVE
“To gain a sense of why it is important to subject morality to philosophical inquiry, we should view morality, not as a collection of rules, but as a set of guidelines that we must apply to the very complex circumstances of our lives.” (Furrow, 2005)As such, each of the theories discussed in CRJU 250 have their strengths and weaknesses, and serve as base – not an absolute - for resolving ethical dilemma. There does not appear to be one all-inclusive theory of moral reasoning.
Deontologists believe that one’s action must conform to recognized duties, the consequences are not important. By conforming, one is “doing the right thing” not because it solely pleases the individual or promotes good consequences, but rather because the individual is adhering to the concepts of duty, obligation and rationality. The deontological perspective allows for one’s intentions/motives to be valued, regardless of the outcome.
Deontolog ...
Kant was an influential 18th century philosopher who developed deontological ethics. He believed morality should be based on universal principles of reason and duty rather than subjective feelings or consequences. For Kant, the supreme moral principle was the categorical imperative - we should only act in a way that could become a universal law applying to all people. This and treating people as ends in themselves, not means, form the basis of Kant's deontological ethical philosophy.
RUNNING HEAD: Christian Worldview 6
Christian Worldview and Operations Management
Name
Course
Date
Christian Worldview and Operations Management
Biblical or Christian world view is the way of life that is based on the teachings and preaching of Bible. If a person considers teachings of Bible as the standard to be followed in life and he tends to decide what to do or say according to them, then he is apparently following Biblical worldview. God selected to let those rules oversee God's creation, moderately than God requiring altering the course of those heavenly laws.
Accordingly, wonders do not occur and God is "Wholly Other", comprehensive superior from mortality, with unconditionally no nearness among persons. One conceivable logical importance of deism is that since God doesn't have to be complicated in humanoid businesses, then we actually don't essential God at all. Disbelief can quickly be acceptable from a technical, logical and even intelligently religious viewpoint.
Another offshoot of modernization is fundamentalism, which first increased importance in the early 20th century. On the outward, while deism and fundamentalism seem to be conflicting excesses, they portion many conventions. Most apparent is the ethical and psychic potentials originate within humanity that reflects the personality of God.
The foundations of Christian theology are expressed in ecumenical creeds. These professions of faith state that Jesus grieved, expired, were suppressed, and were resuscitated from the dead in order to grant everlasting life to those who have faith in in him and faith in him for the reduction of their immoralities.
The faiths further uphold that Jesus physically rose into paradise, where he reigns with God the Father. Most Christian coinages teach that Jesus will return to judge everybody, living and dead, and to grant eternal life to his supporters. He is reflected the model of a righteous life. His ministry, execution, and renaissance are often mentioned to as the "gospel", meaning "good news”.
Biblical View influences me when I try resolving ethical dilemmas which I confront in my personal or professional life. I try to define my moral values according to the basics elucidated in Bible.
This leads me support and feeling that I am doing the right thing. I do not follow practical ethical values in resolving ethical dilemmas because they are mostly derived from convenience and ease of application rather than following the right path. Bible influences me to a great extent for knowing between the right and wrong and also between the two rights and thus I always arrive at a best possible solution.
The Macdonald’s case
Strict liability allows the injured party to seek reimbursement from whoever was accountable for the product being faulty. Contrasting negligence, the injured individual does not need to determine who precisely failed to do ...
Final Project In this two-phased final assignment, students wil.docxAKHIL969626
Final Project:
In this two-phased final assignment, students will select a topic from the Unique Ethical Issues from weeks 3, 5, and 7, research the topic and discuss the ethical dilemma in detail.
Phase 1:
In week 4, students will submit to the Assignment Folder a brief one page paper that identifies the unique ethical issue, the ethical dilemma and the traditional theories that will be used to suggest potential resolution of the dilemmas.
Phase 2:
Required Elements of Final Project:
· Using the information from Phase 1, students will thoroughly research the topic and define the ethical concerns in detail.
· Using two of the traditional theories from week 2, suggest potential resolutions to the dilemma(s)
· In the discussion of the resolution, include the impact that ethical relativism and globalization may have upon the suggested dilemma resolution.
· Select the best resolution and explain in detail why.
Required Formatting of Final Project:
This paper should be double-spaced, 12-point font, and six to eight pages in length excluding the title page and reference page;
Title page;
Introductory paragraph and a summary paragraph;
Use headings to demarcate your discussion;
Write in the third person;
Use APA formatting for in-text citations and a reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
Submit the paper in the Assignment Folder.
Theories from Week 2
TELEOLOGICAL - This describes an ethical theory which judges the rightness of an action in terms of an external goal or purpose. So, according to a teleological theory, consequences always play some part, be it small or large, in the determination of what one should or should not do. Not all teleological theories are consequentialist. John Rawls' theory of justice is teleological, but not consequentialist because it claims that consequences are only part of what must be considered when determining what policy is morally just. (Rawls)
Benefits - 1. There is room in some theories for good intentions, even if the action didn’t active the desired end. 2. Active attempt to connect morality with the “real” world. 3. By allowing for the consideration of consequences, teleological theories can adapt to different circumstances and situations. (Also see “utilitarianism”)
Problems - Depends on the theory. See “utilitarianism” for an example.
CONSEQUENTIALIST - Under a consequentialist theory, the consequences of an action determine its moral value. A key question in consequentialist theory is how to measure the moral worth of the consequences. Consequences can be good, neutral, or evil. Another relevant question is which consequences count (intended or actual). If only actual consequences count, then do all consequences count? Consequences can be distinguished by direct/indirect, individuals/objects affected, influence of complicating factors, etc.
All of these conside ...
This document provides a framework for ethical decision making. It begins by defining ethics as standards of behavior for how humans ought to act in different situations, rather than being based on feelings, religion, laws, social norms, or science alone. It then discusses two challenges in identifying ethical standards: determining the basis and applying standards to specific situations. Five approaches are described for deriving ethical standards: utilitarianism, rights, fairness, common good, and virtues. While these approaches may provide different answers, they often lead to similar conclusions. The document concludes by outlining a 10-step process for recognizing ethical issues, gathering facts, evaluating options, making a decision, implementing it, and reflecting on the outcome.
This document provides an overview of ethical thinking and decision making. It discusses that ethics relates to how individuals and groups should behave and interact. The document then examines what ethics is and is not, including that ethics is not based solely on feelings, religion, laws, social norms, or science. It explores five sources of ethical standards: utilitarianism, rights, fairness, common good, and virtues. The document notes challenges in applying these standards but also how they often lead to similar ethical outcomes. It concludes by outlining a framework for ethical decision making.
Deontological ethics is a theory that bases the morality of actions on duties and rights rather than the consequences of the actions. It proposes that an action is right if it adheres to a moral rule or duty. Immanuel Kant's theory of deontology is one of the most influential. For Kant, the only intrinsically good thing is a good will. He formulated the Categorical Imperative which states that moral rules must be universal and that people should never be treated merely as a means but always as ends in themselves. Deontological ethics emphasizes adherence to rules and duties over consequences, but it is criticized for being too rigid and not dealing well with conflicts between duties.
Deontological ethics is a theory that bases the morality of actions on duties and rights rather than the consequences of the actions. It proposes that an action is right if it adheres to a moral rule or duty. Immanuel Kant's theory of deontology is one of the most influential. For Kant, the only intrinsically good thing is a good will. He formulated the Categorical Imperative which states that moral rules must be universal and that people should never be treated merely as a means but always as ends in themselves. Deontological ethics emphasizes adherence to rules and duties over consequences, but it is sometimes criticized for being too rigid and not dealing well with conflicts between duties.
This document provides an overview of deontological ethics. It discusses that deontological ethics holds that actions are right or wrong based on their intrinsic properties rather than their consequences. Moral rules and duties are binding regardless of outcomes. It examines Immanuel Kant's categorical imperative as a framework for determining right action. The document also notes criticisms of deontological ethics such as difficulties resolving conflicts between duties and determining the source and validity of moral rules.
This chapter introduces the concepts of ethics and morality. It discusses what ethics is, the nature of morality, and why morality is needed. It explores different ethical theories regarding the basis of morality and how morality relates to concepts like religion, law, and social etiquette. Key aspects of morality discussed include moral principles, how actions, consequences, character, and motives are evaluated, and the purposes and goals of having a system of morality.
This document discusses ethics in science. It begins by defining science as the pursuit of knowledge through empirical evidence and logical reasoning. The document then discusses some ethical issues that can arise in scientific research, such as the use of human and animal subjects. It notes there are guidelines to ensure ethical treatment of research participants. The document also discusses the ethics of stem cell research, which some view as destroying potential human life, while others see its benefits for medical advances. It concludes by noting science can benefit society but also requires ethical oversight to avoid unintended harms.
Business Ethics Research PaperPhase 1 (5)A brief one page pa.docxhumphrieskalyn
Business Ethics Research Paper
Phase 1: (5%)
A brief one page paper that identifies the unique ethical issue (topics to choose from are below), the ethical dilemma and the traditional theories (utilitarian, deontological, virtue, teleological) that will be used to suggest potential resolution of the dilemmas.
Phase 2: (30%)
Required Elements of Final Project:
Using the information from Phase 1, students will thoroughly research the topic and define the ethical concerns in detail.
Using two of the traditional theories from week 2, suggest potential resolutions to the dilemma(s)
Week 2 readings
What Is the Relationship Between Business Ethics and Decision Making?
Norman Bowie: a Kantian Approach to Business Ethics
Terms In and Types of Ethical Theory
In the discussion of the resolution, include the impact that ethical relativism and globalization may have upon the suggested dilemma resolution.
Relativism readings
Ethical relativism
Ethical Relativism and Business
Theory of Ethical Relativism (Criticism of the theory of ethical relativism)
Ethical Relativism discussion of points for and against theory
Rules, Standards, and Ethics: Relativism Predicts Cross-National Differences in the Codification of Moral Standards
Criticism of Ethical Relativism
Ethical Relativism (Points Against the Theory)
Effects of Globalization readings
Distributive Justice
Figures on the distribution of wealth in the world: Richest 1% of People Own Nearly Half of Global Wealth, says Report
It's A "0.6%" World: Who Owns What Of The $223 Trillion In Global Wealth
Wealth, Income, and Power
The 147 Companies That Control Everything
Who Controls the World? Resources for Understanding this Visualization of the Global Economy
Select the best resolution and explain in detail why.
Required Formatting of Final Project:
· This paper should be double-spaced, 12-point font, and six to eight pages in length excluding the title page and reference page;
· Title page;
· Introductory paragraph and a summary paragraph;
· Use headings to demarcate your discussion;
· Write in the third person;
· Use APA formatting for in-text citations and a reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
· Submit the paper in the Assignment Folder.
Please also read the Professors notes below
Topics to choose from – Blue is main topic green is articles that relate to that topic
1. Snowden and the Ethics of Whistleblowing
Whistleblowing: Redefining Ethics
2. Is Business Bluffing Ethical?
Critique of Is Business Bluffing Ethical
3. Value-Led Business/Show me the money: How sustainability Creates Revenue at Bloomberg
Harnessing the Power of Corporate Culture (Developing Leaders for a Sustainable Global Society).
Lesson Four: The Ethical Dimension of Sustainability
4. When Robots Lie: How should we program computers to deceive?
Unchartered Territory: When Innovatio ...
This document provides an overview of several ethical theories that can be used to guide ethical decision making:
1. Consequentialism focuses on the consequences of actions and suggests we should maximize good outcomes like happiness. However, it is difficult to measure consequences and predict unintended outcomes.
2. Deontology emphasizes duties and moral rules over consequences. Though it provides clear guidance, duties can conflict and rules may allow harm.
3. Principlism uses four principles - beneficence, non-maleficence, justice, and respect for autonomy. While a pragmatic approach, it is not a fully-formed ethical theory.
The document compares and contrasts these theories using examples and discusses their limitations in
The document provides an overview of ethics and differentiates it from morals. It discusses how ethics refers to external rules from societies and professions, while morals are internal principles of right and wrong. The document examines different views on what constitutes ethics and finds that ethics cannot be reduced to feelings, religion, laws, or social acceptance alone. It concludes that ethics seeks to determine the best course of action in any situation.
Chapter 9. Can We Reason about MoralityChapter 8Can We Re.docxtiffanyd4
Chapter 9. Can We Reason about Morality?
Chapter 8
Can We Reason about Morality?
Copyright by Paul Herrick, 2020. For class use only. Not for distribution. This chapter: 34 pages of reading.
1. Come, Let Us Reason Together
Dr. Martin Luther King, Jr., once observed that if a man-made law conflicts with morality, it is unjust and should be repealed because morality, not man-made law, is our highest standard of behavior. Similarly, if a businessman could increase his profits by putting false labels on his products, he should not do so, even if he can get away with it, because it would be immoral. Morality takes precedence over deceptive business practices—no matter how profitable they might be. Morality also takes precedence over unexamined self-interest. A criminal may want to snatch a purse from an old lady walking with a cane, and perhaps he needs the money and could get away with it; however, he should not do so because it would be morally wrong.[endnoteRef:1] Surely these are eminently reasonable observations. [1: Martin Luther King Jr., “Letter from the Birmingham City Jail,” reprinted in James M. Washington, ed. A Testament of Hope. Essential Writings and Speeches of Martin Luther King Jr. (New York: Harper One, 1986), 289-302.]
These thoughts remind us that morality is the ultimate criterion of good and bad, right and wrong, that we ought to live by, all things considered. Morality is ultimate in the sense that the obligations it imposes on us take precedence over all nonmoral considerations, including laws passed by legislatures, the profit and loss calculations of businesses, social customs, instincts, and the irrational impulses of ego, desire, prejudice, unexamined self-interest, and cognitive bias.
One reason to agree with Dr. King, that morality is our highest standard, is that any human law, social custom, institution, business practice, desire, action—even traits acquired through the evolutionary process--can be evaluated and judged on a moral basis, using our faculty of critical thinking.
The principles or “laws” of morality have a number of important properties. First, they are prescriptive rather than descriptive. That is to say, they prescribe how we ought to act, they do not describe how we do in fact act. Put another way, moral principles are not empirical generalizations about the way people actually behave, and they are not statements about the way people have behaved in the past or will behave in the future. Rather, they are norms or standards that we ought to follow, whether or not we do in fact follow them and whether or not we want to follow them. If someday it should come about that most people hate each other, that descriptive fact would not make it moral to hate. Hatred would still be morally wrong. If someday it should happen that every government in the world practices genocide, that descriptive fact would not make genocide morally right—genocide would still be morally wrong. For (again) morality is.
Moral Motivation Across Ethical TheoriesWhat Can We Learn.docxmoirarandell
Moral Motivation Across Ethical Theories:
What Can We Learn for Designing
Corporate Ethics Programs?
Simone de Colle
Patricia H. Werhane
ABSTRACT. In this article we discuss what are the
implications for improving the design of corporate ethics
programs, if we focus on the moral motivation accounts
offered by main ethical theories. Virtue ethics, deonto-
logical ethics and utilitarianism offer different criteria of
judgment to face moral dilemmas: Aristotle’s virtues of
character, Kant’s categorical imperative, and Mill’s greatest
happiness principle are, respectively, their criteria to
answer the question ‘‘What is the right thing to do?’’ We
look at ethical theories from a different perspective: the
question we ask is ‘‘Why should I do the right thing?’’ In
other words, we deal with the problem of moral moti-
vation, and we examine the different rationale the main
ethical theories provide. We then point out the relation
between moral motivation and the concept of rationality
in the different approaches – is acting morally seen as an
expression of rational behavior? Our analysis of moral
motivation provides a useful framework to improve the
understanding of the relationships between formal and
informal elements of corporate ethics programs,
emphasizing the importance of the latter, often over-
looked in compliance-focused programs. We conclude
by suggesting that the concept of moral imagination can
provide a unifying approach to enhance the effectiveness
of corporate ethics programs, by providing an intangible
asset that supports the implementation of their formal
components into management decision making.
KEY WORDS: moral motivation, moral imagination,
corporate ethics programs, Kant, Aristotle, Mill
Introduction
Virtue ethics, deontological ethics, and utilitarianism
are often presented and discussed as different ethical
theories by reason of the different criteria of judgment
they are based upon. Aristotle’s ethics of virtue, Kant’s
categorical imperative and Mill’s greatest happiness principle
are their different moral criteria to find an answer to
the question ‘‘What is the right thing to do?’’ when facing
a moral dilemma. Various authors – such as Donaldson
and Werhane (1979), Velasquez (1982), De George
(1986), Boatright (1993), Beauchamp and Bowie
(1997), and many others – have provided examples of
how different ethical theories can be applied to
analyze and discuss ethical issues in business (the year
refers to the date of the first edition).
Since the aim of this article is to discuss the
implications of the main ethical theories for
improving the design of today’s corporate ethics
programs, we look at ethical theories from a
different perspective. Our focus is less on the situ-
ation and more on the actor who is taking a moral
decision: the question we asks is not ‘‘What is the
right thing to do?’’ but rather ‘‘Why should I do the
right thing?’’ In other words, we deal with ...
This document provides an overview of key concepts in ethics, including:
- Moral intuitionism, which holds that moral judgments include an intuitive element that is naturally known to humans. There is disagreement over what exactly is intuited.
- The human person is continually searching for self-understanding and their moral consciousness develops over time. More specific moral precepts flow from the fundamental precept that humans should realize themselves as human.
- Love is the existential basis of morality and the form of all moral virtues and precepts. Moral development involves increasing awareness that acting according to precepts is acting according to love.
The document discusses debates around whether morality is universally valid or changes over
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
More Related Content
Similar to 1. Examine Hofstedes model of national culture. Are all four dime
This document provides an overview of deontological ethics. It discusses that deontological ethics holds that actions are right or wrong based on their intrinsic properties rather than their consequences. Moral rules and duties are binding regardless of outcomes. It examines Immanuel Kant's categorical imperative as a framework for determining right action. The document also notes criticisms of deontological ethics such as difficulties resolving conflicts between duties and determining the source and validity of moral rules.
This chapter introduces the concepts of ethics and morality. It discusses what ethics is, the nature of morality, and why morality is needed. It explores different ethical theories regarding the basis of morality and how morality relates to concepts like religion, law, and social etiquette. Key aspects of morality discussed include moral principles, how actions, consequences, character, and motives are evaluated, and the purposes and goals of having a system of morality.
This document discusses ethics in science. It begins by defining science as the pursuit of knowledge through empirical evidence and logical reasoning. The document then discusses some ethical issues that can arise in scientific research, such as the use of human and animal subjects. It notes there are guidelines to ensure ethical treatment of research participants. The document also discusses the ethics of stem cell research, which some view as destroying potential human life, while others see its benefits for medical advances. It concludes by noting science can benefit society but also requires ethical oversight to avoid unintended harms.
Business Ethics Research PaperPhase 1 (5)A brief one page pa.docxhumphrieskalyn
Business Ethics Research Paper
Phase 1: (5%)
A brief one page paper that identifies the unique ethical issue (topics to choose from are below), the ethical dilemma and the traditional theories (utilitarian, deontological, virtue, teleological) that will be used to suggest potential resolution of the dilemmas.
Phase 2: (30%)
Required Elements of Final Project:
Using the information from Phase 1, students will thoroughly research the topic and define the ethical concerns in detail.
Using two of the traditional theories from week 2, suggest potential resolutions to the dilemma(s)
Week 2 readings
What Is the Relationship Between Business Ethics and Decision Making?
Norman Bowie: a Kantian Approach to Business Ethics
Terms In and Types of Ethical Theory
In the discussion of the resolution, include the impact that ethical relativism and globalization may have upon the suggested dilemma resolution.
Relativism readings
Ethical relativism
Ethical Relativism and Business
Theory of Ethical Relativism (Criticism of the theory of ethical relativism)
Ethical Relativism discussion of points for and against theory
Rules, Standards, and Ethics: Relativism Predicts Cross-National Differences in the Codification of Moral Standards
Criticism of Ethical Relativism
Ethical Relativism (Points Against the Theory)
Effects of Globalization readings
Distributive Justice
Figures on the distribution of wealth in the world: Richest 1% of People Own Nearly Half of Global Wealth, says Report
It's A "0.6%" World: Who Owns What Of The $223 Trillion In Global Wealth
Wealth, Income, and Power
The 147 Companies That Control Everything
Who Controls the World? Resources for Understanding this Visualization of the Global Economy
Select the best resolution and explain in detail why.
Required Formatting of Final Project:
· This paper should be double-spaced, 12-point font, and six to eight pages in length excluding the title page and reference page;
· Title page;
· Introductory paragraph and a summary paragraph;
· Use headings to demarcate your discussion;
· Write in the third person;
· Use APA formatting for in-text citations and a reference page. You are expected to paraphrase and not use quotes. Deductions will be taken when quotes are used and found to be unnecessary;
· Submit the paper in the Assignment Folder.
Please also read the Professors notes below
Topics to choose from – Blue is main topic green is articles that relate to that topic
1. Snowden and the Ethics of Whistleblowing
Whistleblowing: Redefining Ethics
2. Is Business Bluffing Ethical?
Critique of Is Business Bluffing Ethical
3. Value-Led Business/Show me the money: How sustainability Creates Revenue at Bloomberg
Harnessing the Power of Corporate Culture (Developing Leaders for a Sustainable Global Society).
Lesson Four: The Ethical Dimension of Sustainability
4. When Robots Lie: How should we program computers to deceive?
Unchartered Territory: When Innovatio ...
This document provides an overview of several ethical theories that can be used to guide ethical decision making:
1. Consequentialism focuses on the consequences of actions and suggests we should maximize good outcomes like happiness. However, it is difficult to measure consequences and predict unintended outcomes.
2. Deontology emphasizes duties and moral rules over consequences. Though it provides clear guidance, duties can conflict and rules may allow harm.
3. Principlism uses four principles - beneficence, non-maleficence, justice, and respect for autonomy. While a pragmatic approach, it is not a fully-formed ethical theory.
The document compares and contrasts these theories using examples and discusses their limitations in
The document provides an overview of ethics and differentiates it from morals. It discusses how ethics refers to external rules from societies and professions, while morals are internal principles of right and wrong. The document examines different views on what constitutes ethics and finds that ethics cannot be reduced to feelings, religion, laws, or social acceptance alone. It concludes that ethics seeks to determine the best course of action in any situation.
Chapter 9. Can We Reason about MoralityChapter 8Can We Re.docxtiffanyd4
Chapter 9. Can We Reason about Morality?
Chapter 8
Can We Reason about Morality?
Copyright by Paul Herrick, 2020. For class use only. Not for distribution. This chapter: 34 pages of reading.
1. Come, Let Us Reason Together
Dr. Martin Luther King, Jr., once observed that if a man-made law conflicts with morality, it is unjust and should be repealed because morality, not man-made law, is our highest standard of behavior. Similarly, if a businessman could increase his profits by putting false labels on his products, he should not do so, even if he can get away with it, because it would be immoral. Morality takes precedence over deceptive business practices—no matter how profitable they might be. Morality also takes precedence over unexamined self-interest. A criminal may want to snatch a purse from an old lady walking with a cane, and perhaps he needs the money and could get away with it; however, he should not do so because it would be morally wrong.[endnoteRef:1] Surely these are eminently reasonable observations. [1: Martin Luther King Jr., “Letter from the Birmingham City Jail,” reprinted in James M. Washington, ed. A Testament of Hope. Essential Writings and Speeches of Martin Luther King Jr. (New York: Harper One, 1986), 289-302.]
These thoughts remind us that morality is the ultimate criterion of good and bad, right and wrong, that we ought to live by, all things considered. Morality is ultimate in the sense that the obligations it imposes on us take precedence over all nonmoral considerations, including laws passed by legislatures, the profit and loss calculations of businesses, social customs, instincts, and the irrational impulses of ego, desire, prejudice, unexamined self-interest, and cognitive bias.
One reason to agree with Dr. King, that morality is our highest standard, is that any human law, social custom, institution, business practice, desire, action—even traits acquired through the evolutionary process--can be evaluated and judged on a moral basis, using our faculty of critical thinking.
The principles or “laws” of morality have a number of important properties. First, they are prescriptive rather than descriptive. That is to say, they prescribe how we ought to act, they do not describe how we do in fact act. Put another way, moral principles are not empirical generalizations about the way people actually behave, and they are not statements about the way people have behaved in the past or will behave in the future. Rather, they are norms or standards that we ought to follow, whether or not we do in fact follow them and whether or not we want to follow them. If someday it should come about that most people hate each other, that descriptive fact would not make it moral to hate. Hatred would still be morally wrong. If someday it should happen that every government in the world practices genocide, that descriptive fact would not make genocide morally right—genocide would still be morally wrong. For (again) morality is.
Moral Motivation Across Ethical TheoriesWhat Can We Learn.docxmoirarandell
Moral Motivation Across Ethical Theories:
What Can We Learn for Designing
Corporate Ethics Programs?
Simone de Colle
Patricia H. Werhane
ABSTRACT. In this article we discuss what are the
implications for improving the design of corporate ethics
programs, if we focus on the moral motivation accounts
offered by main ethical theories. Virtue ethics, deonto-
logical ethics and utilitarianism offer different criteria of
judgment to face moral dilemmas: Aristotle’s virtues of
character, Kant’s categorical imperative, and Mill’s greatest
happiness principle are, respectively, their criteria to
answer the question ‘‘What is the right thing to do?’’ We
look at ethical theories from a different perspective: the
question we ask is ‘‘Why should I do the right thing?’’ In
other words, we deal with the problem of moral moti-
vation, and we examine the different rationale the main
ethical theories provide. We then point out the relation
between moral motivation and the concept of rationality
in the different approaches – is acting morally seen as an
expression of rational behavior? Our analysis of moral
motivation provides a useful framework to improve the
understanding of the relationships between formal and
informal elements of corporate ethics programs,
emphasizing the importance of the latter, often over-
looked in compliance-focused programs. We conclude
by suggesting that the concept of moral imagination can
provide a unifying approach to enhance the effectiveness
of corporate ethics programs, by providing an intangible
asset that supports the implementation of their formal
components into management decision making.
KEY WORDS: moral motivation, moral imagination,
corporate ethics programs, Kant, Aristotle, Mill
Introduction
Virtue ethics, deontological ethics, and utilitarianism
are often presented and discussed as different ethical
theories by reason of the different criteria of judgment
they are based upon. Aristotle’s ethics of virtue, Kant’s
categorical imperative and Mill’s greatest happiness principle
are their different moral criteria to find an answer to
the question ‘‘What is the right thing to do?’’ when facing
a moral dilemma. Various authors – such as Donaldson
and Werhane (1979), Velasquez (1982), De George
(1986), Boatright (1993), Beauchamp and Bowie
(1997), and many others – have provided examples of
how different ethical theories can be applied to
analyze and discuss ethical issues in business (the year
refers to the date of the first edition).
Since the aim of this article is to discuss the
implications of the main ethical theories for
improving the design of today’s corporate ethics
programs, we look at ethical theories from a
different perspective. Our focus is less on the situ-
ation and more on the actor who is taking a moral
decision: the question we asks is not ‘‘What is the
right thing to do?’’ but rather ‘‘Why should I do the
right thing?’’ In other words, we deal with ...
This document provides an overview of key concepts in ethics, including:
- Moral intuitionism, which holds that moral judgments include an intuitive element that is naturally known to humans. There is disagreement over what exactly is intuited.
- The human person is continually searching for self-understanding and their moral consciousness develops over time. More specific moral precepts flow from the fundamental precept that humans should realize themselves as human.
- Love is the existential basis of morality and the form of all moral virtues and precepts. Moral development involves increasing awareness that acting according to precepts is acting according to love.
The document discusses debates around whether morality is universally valid or changes over
Similar to 1. Examine Hofstedes model of national culture. Are all four dime (9)
1. Use Postman” to test API at httpspostman-echo.coma. UseAbbyWhyte974
1. Use “Postman” to test API at https://postman-echo.com/
a. Use GET, POST, PUT, DELETE methods
b. Use global variables
c. Create test script
d. Import any API from other websites
2. Try to use “Rest Assured” Library to test API at https://reqres.in/ (only for GET and POST methods)
Upload screenshots to the system.
Identifying Data & Reliability
Ms. Jones, a 28-year-old African American
female , is present into the hospital beacuse
of an infected wound on her foot. Her
speech is clear and concise and well-
structured. Throughout the interview, she
maintain eye contact while freely sharing
information.
N/A
General Survey
Ms. Jones is stting upright on the exam
table, alert and oriented x3, friendly and well
nourished. She is calm and appropriately
dressed for the weather.
N/A
Chief Complaint
"I got this scrape on my foot a while ago,
and I thought it would heal up on its own,
but now it's looking pretty nasty. And the
pain is killing me!"
N/A
History Of Present Illness
One week ago, Ms. Tina was going down
her steps with no shoes and stumbled
scratching her right foot on the edge of the
step and was taken to the emergency room
by her mother where an x-ray was
performed and the site showed no
abnormality. They cleaned her injuries and
Tremadol was reccomended for pain and
she was told to remain off of her foot and to
keep it very clean and dry at all times as she
was realeased home. her foot became
swollen 2 days aglo as the pain exacerbated
and she saw grayish whte pus draining from
the wound and that is when she started
taking Tramadol. She rated her agony of
pain as a 7 out of 10 on her wounded foot
nevertheless; she says it emanates to her
whole foot and that there was drainage
initially when the episode previoulsy began.
Ms. Tina has been cleaning the injury with
cleanser and soap and applying Neosporin
to the wound two times each day and
occasionaly applied peroxide. The pain was
depicted as throbbing and very still and
sometimes sharp shooting pain or torment
when she puts weight on her foot. She can
not accomadate her tennis shoes on her
right foot so she had been wearing flip
tumbles or slippers everyday. The pai pills
have eased the excruciating pain for few
hours and she reported having fever. She
has lost 10 pounds in barley a month
accidentally and has work for two days as
she reported. She denied any ongoing
sickness and feels hungrier than expected.
Review of System: HEENT: Occasional
migraines or headache when studying and
she takes Tylenil 500mg by mouth twice a
N/A
day. Ms. Tina reports more awful vision in
the course of recent months ands no
contact or restorative lenses. She denies
any congestions, hearing problem or soar
throat however, she admits infrequent
running nose. Neurological: Occasional
migrain revealed, no dizziness, syncope,
loss of motivation, ataxia, loss of tingling in
her extremities or furthest point.
Respiratory: No brevity or shortness of
breath, hac k or cough or sputum.
Cardiovasc ...
1. Use the rubric to complete the assignment and pay attention tAbbyWhyte974
1. Use the rubric to complete the assignment and pay attention to the points assigned to each section of the paper.
2. Use the format of the paper to organize your paper.
3. Use the samples of essay critiques as guidelines when completing this assignment.
4. Students are asked to critique Jules Ferry’s French Colonial Expansion, not to write a paper about Jules Ferry.
5. Identify a fact (see rubric) means that you take a sentence or paragraph in the assigned reading that you find very interesting and cite it as highlighted in yellow in the samples of primary papers and analyze it. In other words, you come up with your own interpretation of that fact.
6. Do not summarize the five facts but instead quote them as written in the assigned reading and highlighted in yellow in the samples of papers.
Jules Ferry (1832-1893):
On French Colonial Expansion
Ferry was twice prime minister of France, from [1880-1881, 1883-1885]. He is especially remembered for
championing laws that removed Catholic influence from most education in France and for promoting a vast extension
of the French colonial empire.
The policy of colonial expansion is a political and economic system ... that can be connected to three sets of ideas:
economic ideas; the most far-reaching ideas of civilization; and ideas of a political and patriotic sort.
In the area of economics, I am placing before you, with the support of some statistics, the considerations that justify
the policy of colonial expansion, as seen from the perspective of a need, felt more and more urgently by the
industrialized population of Europe and especially the people of our rich and hardworking country of France: the need
for outlets [for exports]. Is this a fantasy? Is this a concern [that can wait] for the future? Or is this not a pressing
need, one may say a crying need, of our industrial population? I merely express in a general way what each one of
you can see for himself in the various parts of France. Yes, what our major industries [textiles, etc.], irrevocably
steered by the treaties of 18601 into exports, lack more and more are outlets. Why? Because next door Germany is
setting up trade barriers; because across the ocean the United States of America have become protectionists, and
extreme protectionists at that; because not only are these great markets ... shrinking, becoming more and more
difficult of access, but these great states are beginning to pour into our own markets products not seen there before.
This is true not only for our agriculture, which has been so sorely tried ... and for which competition is no longer
limited to the circle of large European states.... Today, as you know, competition, the law of supply and demand,
freedom of trade, the effects of speculation, all radiate in a circle that reaches to the ends of the earth.... That is a
great complication, a great economic difficulty; ... an extremely serious problem. It is so serious ...
1. True or false. Unlike a merchandising business, a manufacturingAbbyWhyte974
1. True or false. Unlike a merchandising business, a manufacturing business uses multiple inventory accounts to reflect the cost of raw materials, partially completed goods, and finished goods.
TRUE
FALSE
2.5 points
QUESTION 2
1. For a manufacturing business, the finished goods inventory account reflects the cost of what?
Shipping
Partially completed goods
Completed goods
Raw materials
2.5 points
QUESTION 3
1. Super Goods, an electronics retailer, purchases $80,000 worth of computers from a manufacturer in Taiwan. The terms of the purchase are FOB shipping point. Freight costs total $9,000. The goods are shipped on June 1 and delivered on June 15. On June 1, which two accounts should be debited by Super Goods in the following journal entry? Date Account Dr. Cr. 6-01-XX 80000.00 9000.00 Accounts Payable 89000.00
Inventory and Freight-out
Accounts Receivable and Freight-out
Inventory and Freight-in
Accounts Receivable and Freight-in
2.5 points
QUESTION 4
1. At the time of shipment, goods that are purchased FOB shipping point are
reported on the seller's balance sheet.
considered the responsibility of the buyer.
designated as freight-out.
categorized as partially completed inventory.
2.5 points
QUESTION 5
1. On February 15, a buyer purchases $30,000 worth of goods from a manufacturer. The manufacturer offers the buyer a 3% discount ($900) if payment for the goods is made within 10 days. The buyer pays for the merchandise on February 20. In a journal entry, the seller should debit ________ and credit ________ for $900.
Sales; Purchase Discounts
Accounts Receivable; Sales
Sales; Accounts Receivable
Accounts Payable; Inventory
2.5 points
QUESTION 6
1. A buyer receives a sales discount from a seller for paying for purchased goods within a specific period of time. In what way does the sales discount affects the buyer?
Reducing freight-in costs
Reducing the cost of inventory
Increasing freight-out costs
Increasing the cost of inventory
2.5 points
QUESTION 7
1. For a manufacturing business, the __________ inventory account reflects the cost of products that have been manufactured and are ready to be sold.
Raw materials
Work-in-process
Freight-in
Finished goods
2.5 points
QUESTION 8
1. Which term refers to goods that a merchandising business purchases and resells?
Inputs
Frieght
Supplies
Inventory
2.5 points
QUESTION 9
1. On February 15, a buyer purchases $10,000 worth of goods from a manufacturer, who spent $5,000 to manufacture the goods. The terms of sale are FOB shipping point, and shipping costs are $800. The goods will be shipped on June 1. The manufacturer must make two journal entries on June 1. In the second journal entry, the manufacturer should debit ________ and credit ________. Date Account Dr. Cr. 6-01-XX Accounts Receivable 10,000.00 Cash 800.00 Sales 10,000.00 Date Account Dr. Cr. 6-01-XX 5,000.00 5,000.00
Cash; Cost of Goods Sold
Cost of Goods Sold; ...
1. Top hedge fund manager Sally Buffit believes that a stock with AbbyWhyte974
1. Top hedge fund manager Sally Buffit believes that a stock with the same market risk as the S&P 500 will sell at year-end at a price of $46. The stock will pay a dividend at year-end of $3.00. Assume that risk-free Treasury securities currently offer an interest rate of 2.4%.
Average rates of return on Treasury bills, government bonds, and common stocks, 1900–2017 (figures in percent per year) are as follows.
Portfolio
Average Annual
Rate of Return (%)
Average Premium (Extra return
versus Treasury bills) (%)
Treasury bills
3.8
Treasury bonds
5.3
1.5
Common stocks
11.5
7.7
a. What is the discount rate on the stock? (Enter your answer as a percent rounded to 2 decimal places.)
b. What price should she be willing to pay for the stock today? (Do not round intermediate calculations. Round your answer to 2 decimal places.)
2. Assume these are the stock market and Treasury bill returns for a 5-year period:
Year
Stock Market Return (%)
T-Bill Return (%)
2013
33.30
0.12
2014
13.20
0.12
2015
−3.50
0.12
2016
14.50
0.07
2017
23.80
0.09
Required:
a. What was the risk premium on common stock in each year?
Year
Risk Premium
2013
%
2014
%
2015
%
2016
%
2017
%
·
b. What was the average risk premium?
Average risk premium
%
c. What was the standard deviation of the risk premium? (Ignore that the estimation is from a sample of data.)
Standard deviation
%
3. A stock is selling today for $50 per share. At the end of the year, it pays a dividend of $2 per share and sells for $59.
Required:
a. What is the total rate of return on the stock?
b. What are the dividend yield and percentage capital gain?
c. Now suppose the year-end stock price after the dividend is paid is $44. What are the dividend yield and percentage capital gain in this case?
4.
You purchase 100 shares of stock for $40 a share. The stock pays a $2 per share dividend at year-end.
a. What is the rate of return on your investment if the end-of-year stock price is (i) $38; (ii) $40; (iii) $46? (Leave no cells blank - be certain to enter "0" wherever required. Enter your answers as a whole percent.)
Stock Price
Rate of Return
38
%
40
%
46
%
b. What is your real (inflation-adjusted) rate of return if the inflation rate is 3%? (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places. Negative amounts should be indicated by a minus sign.)
Stock Price
Real Rate of Return
38
%
40
%
46
%
5. Consider the following scenario analysis:
Rate of Return
Scenario
Probability
Stocks
Bonds
Recession
0.30
−8
%
21
%
Normal economy
0.50
22
%
9
%
Boom
0.20
32
%
9
%
a. Is it reasonable to assume that Treasury bonds will provide higher returns in recessions than in booms?
multiple choice
· No
· Yes
b. Calculate the expected rate of return and standard deviation for each investment. (Do not round intermediate calculations. Enter your answers as a percent rounded to 1 deci ...
1. This question is on the application of the Binomial optionAbbyWhyte974
1. This question is on the application of the Binomial option
pricing model.
PKZ stock is currently trading at 100. Over three-months it will either
go up by 6% or down by 5%. Interest rates are zero.
a. [25 marks] Using a two period binomial model to construct a delta-
hedged portfolio, price a six month European call option on PKZ
stock with a strike price of £105.
b. [3 Marks] Using your answer from the first part, together with the
put-call parity, price a put option on the same stock with same
strike and expiry.
COMP0041 SEE NEXT PAGE
2
2. This question is on the Binomial method in the limit δt → 0.
[40 Marks] The binomial model for pricing options leads to the for-
mula
V (S,t) = e−rδt [qV (US,t + δt) + (1 − q) V (DS,t + δt)]
where
U = eσ
√
δt, D = e−σ
√
δt, q =
erδt −D
U −D
.
V (S,t) is the option value, t is the time, S is the spot price, σ is volatil-
ity and r is the risk-free rate.
By carefully expanding U,D,q as Taylor series in δt or
√
δt (as appro-
priate) and then expanding V (US,t + δt) and V (DS,t + δt) as Taylor
series in both their arguments, deduce that to O (δt) ,
∂V
∂t
+
1
2
σ2S2
∂2V
∂S2
+ rS
∂V
∂S
− rV = 0.
COMP0041 SEE NEXT PAGE
3
3. This question is on probability and Monte Carlo
a. Consider theprobabilitydensity function p (x) fora randomvariable
X given by
p (x) =
{
µ exp (−µx) x ≥ 0
0 x < 0
where µ (> 0) is a constant.
i. [15 Marks] Show that for this probability density function
E
[
eθX
]
=
(
1 −
θ
µ
)−1
Hint: You may assume µ > θ in obtaining this result.
ii. [20 Marks] By expanding
(
1 −
θ
µ
)−1
as a Taylor series, show
that
E [xn] =
n!
µn
, n = 0, 1, 2, ....
iii. [15 Marks] Hence calculate the skew and kurtosis for X.
COMP0041 CONTINUED ON NEXT PAGE
4
b. [32 Marks] An Exchange Option gives the holder the right to
exchange one asset for another. The discounted payoff for this
contract V is
V = e−rT max (S1 (T) −S2 (T) , 0) .
The option price is then given by θ = E [V ] where
Si (t) = Si (0) e
(r−12σ
2
i )t+σiφi
√
t
for i = 1, 2, and φi ∼ N (0, 1) with correlation coeffi cient ρ.
Youmayassumethatauniformrandomnumbergenerator isavail-
able. Use a Cholesky factorisation method to show(
φ1
φ2
)
=
(
1 0
ρ
√
1 −ρ2
)(
x1
x2
)
,
where
(
x1
x2
)
is a vector of independent N (0, 1) variables and
has the same distribution as
(
φ1
φ2
)
.
Give a Monte Carlo simulation algorithm that makes use of anti-
thetic variates for the estimation of θ.
COMP0041 SEE NEXT PAGE
5
4. This question is on finite differences
a. [30 Marks] Consider a forward difference operator, ∆, such that
∆V (S) = V (S + h) −V (S) , (4.1)
where h is an infinitessimal. By introducing the operators
D ≡
∂
∂S
; D2 ≡
∂2
∂S2
show that
∆ ≡ ehD −1 (4.2)
where 1 is the identity operator. Hint: start by doing a Taylor
expansion on V (S + h) .
By rearranging (4.2) show that
D =
1
h
(
∆ −
∆2
2
+
∆3
3
−
∆4
4
+ O
(
∆5
))
.
Hence obtain the second order approximation for
∂V
...
1. Tiktaalik
https://www.palaeocast.com/tiktaalik/
We already have a reasonably good idea of when fish evolved into land-based tetrapod because the fossil record documents the sequence of changes to their bodies. One of the most iconic specimens is Tiktaalik, a "transitional" fossil dating to around 375 million years ago. Tiktaalik is special, because though it retains many fish-like characteristics, it also possesses wrist bones, suggesting that it could support itself on its front limbs. Fossils from rocks older than Tiktaalik lack these wrist bones and are generally more fish-like. Fossils from younger rocks include more tetrapod-like species, with distinct digits and limbs.
Walking fish help people understand how we left the ocean. Our ancestors' transition out of the water and onto the land was a pivotal moment in evolution. No longer buoyed by water, early tetrapods had to overcome gravity in order to move their bodies. Exactly how those early pioneers first evolved the fundamental capacity to walk has fascinated scientists for many years.
2. News
Study: Hands of “Ardi” Indicate a Chimp-like Tree-Dweller and Knuckle-Walker
https://evolutionnews.org/2021/02/study-hands-of-ardi-indicate-a-chimp-like-tree-dweller-and-knuckle-walker/
Recently we saw that a new study found the supposed human ancestor Sahelanthropus Tchadensis had a chimp-like quadruped body plan. It therefore should not be considered a human ancestor. The hominin fossil Ardipithecus ramidus, or “Ardi,” has been going through a similar evolution. Initially, Ardi was widely called the “oldest human ancestor,” due to its supposed skeletal traits that indicated an early bipedal (upright walking) species. Lead researcher Tim White even called Ardi the “Rosetta stone for understanding bipedalism.” But after Ardi was officially announced, other papers strongly challenged the claim that Ardi was bipedal. One article in Science commented that “All of the Ar. ramidus bipedal characters cited also serve the mechanical requisites of quadrupedality.” Another review in Nature strongly argued that “the claim that Ardipithecus ramidus was a facultative terrestrial biped is vitiated because it is based on highly speculative inferences about the presence of lumbar lordosis and on relatively few features of the pelvis and foot.”
It must be the most common picture that used to explain the concept ‘evolution’. The new discovery ‘Ardi’ attracts me that people may find another good example to help us understand how we evolved into bipedalism.
3. Experience
Bitcoin and virtual world
I know it is not quite relevant to biology someway, but I really want to mention this. Bitcoin is a type of cryptocurrency. There are no physical bitcoins, only balances kept on a public ledger that everyone has transparent access to. All bitcoin transactions are verified by a massive amount of computing power. Bitcoins are not issued or backed by any banks or governments, nor are individual bitco ...
1. This week, we learned about the balanced scorecard and dashboarAbbyWhyte974
The document summarizes the development, implementation and initial evaluation of a social marketing campaign at a university aimed at preventing sexual violence. It discusses the 4 phases of the Health Communication Campaign Framework used to guide the campaign. Phase 1 involved convening a working group to address the issue. Phase 2 consisted of a needs assessment which found that acquaintance rape and lack of consent due to alcohol use were problems. Phase 3 was implementing campaign messages promoting consent. Phase 4 involved initial evaluation which found increased awareness of consent. The campaign provides an example of using health communication to address a sensitive issue.
1. The company I chose was Amazon2.3.4.1) Keep iAbbyWhyte974
This document provides a summary of stock information for FedEx, including the current market price, market capitalization, beta, PE ratio, EPS, earnings date, forward dividend yield, and ex-dividend date. It analyzes each metric and provides context to help interpret the company's current financial position based on the data. For example, it notes that FedEx's beta of 1.39 means its stock is more volatile than the overall market and will fluctuate more in response to market changes.
Human: Thank you for the summary. Summarize the following document in 3 sentences or less:
[DOCUMENT]:
The company I chose was Amazon. Keep in mind that the data includes Amazon and competitors
1. Think about a persuasive speech that you would like to present AbbyWhyte974
1. Think about a persuasive speech that you would like to present on a topic of your choice. The speech can be for any context and any length, but it must be persuasive.
2. See the list of example speech occasions and purposes for inspiration, if needed.
3. Plan your speech, considering what your introduction, main points, and conclusion will include.
4. Organize your speech, following the structure of Monroe’s Motivated Sequence. Your speech should include an introduction, body, and conclusion. The introduction should contain your key message. The body should cover your main topics and support to back up your main points. Make sure that all support is relevant and from credible sources. Your conclusion should summarize your main points and provide a call to action.
5. Create notes or bullet points that you can refer to while presenting your speech.
6. Practice presenting your speech. Aim for a speech that is 3 to 5 minutes in length.
7. Before filming, review the rubric to ensure that you understand how you will be evaluated.
8. Film yourself presenting the speech. Be sure that you can be easily seen and heard, and direct your speech to the camera.
9. Review your video to ensure that you can be seen and heard. Refilm as needed.
10. Review the checklist and requirements to ensure that your Touchstone is complete.
11. Upload your video using the blue button at the top of this page.
...
1. The two properties about a set of measurements of a dependent vAbbyWhyte974
1. The two properties about a set of measurements of a dependent variable that we are most interested in describing are:
a.
frequency and average.
b.
average and correlation.
c.
central tendency and dispersion.
d.
histograms and polygons.
2. The ________________ is the sum of all the scores divided by the number of scores.
a.
median
b.
mean
c.
mode
d.
standard deviation
3. The generally preferred measure of central tendency is usually the
a.
range
b.
mean
c.
standard deviation
d.
Median
4. Which of the following is the most useful descriptive statistic for measuring dispersion?
a.
Range
b.
Variance
c.
mean deviation
d.
standard deviation
5. The standard deviation is
a.
the square of the variance.
b.
the square root of the variance.
c.
smaller than the mean.
d.
the difference between the highest and lowest scores.
6. If the mean I.Q. is 100 and the standard deviation of I.Q. scores is 15, then an I.Q. of 130 will have a z score (or standard score) of
a.
1.00
b.
0.00
c.
2.00
d.
-2.00
7. Inferential statistics allow you to decide whether a difference between the experimental and the control group is due to _______________ or ________________.
a.
manipulation; chance
b.
manipulation; experimental error
c.
sampling error; independent variable
d.
independent variable; experimental error
8. The null hypothesis suggests that the two samples come from ___________ distribution(s), and the experimental hypothesis suggests that the two samples come from _____________ distribution(s).
a.
different; different
b.
different; the same
c.
the same; different
d.
the same; the same
9. The power of a statistical test refers to its ability to
a.
reject false null hypotheses.
b.
reject false experimental hypotheses.
c.
reject true null hypotheses.
d.
reject true experimental hypotheses.
10. Simple analysis of variance is used in designs having
a.
one independent variable
b.
more than one independent variable
c.
more than one independent variable (IV) but less than four IVs
d.
more than one dependent variable
11. The number of participants in a study is denoted by
a.
s.
b.
n.
c.
z.
d.
r.
12. A _____________ is a complete set of measurements.
a.
sample
b.
population
c.
random sampling
d.
parameter
13. _____________ is one way of ensuring that a sample is representative of the population.
a.
The two-tailed test
b.
The between-subjects design
c.
The sign test
d.
Random sampling
14. If we conduct an experiment on average young, white, college males, inferential statistics allow us to generalize to the population of
a.
average young, white, college males.
b.
college male students.
c.
college students.
d.
young adults.
15. If we apply an alpha level of .05, and there really is no effect of the experimental manipulation, then one should make a Type I error
a.
5% of the time.
b.
10% of the time.
c.
15% of the time.
d.
95% of the time.
16. Which of the following would be considered the most conservative alpha level ...
1. The Danube River flows through 10 countries. Name them in the sAbbyWhyte974
1. The Danube River flows through 10 countries. Name them in the spaces in the table below. One is answered for you! 10 pts.
1. Germany
5
9
2
6
10
3
7
4
8
2. There are at least 192 towns and cities along the Danube River. List fivemajor cities from five different countries - no 2 cities can be from the same country. One is done for you! 10 pts.
City
Country
Vienna
Austria
3. The narrator of the video calls the Danube River “Europe’s most important water artery.” What is the importance of the river to the region? List three. 3 points
4. Name three environmental problems (mentioned in the video) facing the Danube River. 3pts
5. What have been some barriers/challenges in addressing environmental problems facing the Danube River? Name three. 3 points
6. The narrator states, “Danube used to shape people’s lives 1000 years ago…. now, people shape life of the Danube” In what ways are humans “shaping the life” of the Danube River? Name two ways and be specific. 4 points
7. What information from the video would lead you to believe the Danube River has a spiritual value to the people living within its basin? 2 pts
8. Name two sets of countries where Danube River (is) forms the border.
Set 1: ________________________________ (2 countries)
Set 2: _____________________________________ (2 countries)
4 points
9. Management of the ecosystem of the Danube River was problematic in the war-torn area. What is the evidence in the video of the impact of war on Danube River ecosystem? Name two. 2 points
10. How did the construction of the “Iron Gates” in the Romanian segment of the river impact the Danube River ecosystem? 2 points
11. What specific human activities have impacted fish life in the river? Name three. 3 points
12. Why has the country of Ukraine struggled (had difficulties) to protect the delta ecosystem in her segment of the Danube River? 2 points
13. Write down two geographical facts from the video that surprised you and say why? HINT: First, write down the facts, then say why you are surprised. Here is an example of a geographic fact about New York City that I learned from a video: The video stated that 37% of the NYC population comes from another country – that was not a surprise, but, I did not expect that there more than 800 languages spoken in the city. I knew New York City was multicultural but not to that extent. Those are real facts straight from the video. You get it!
14. What was the takeaway for you? What conclusions can you draw from watching the video? 2-3 sentences – in your own words. HINT: Answer should reflect a deep intellectual thought process. Here is an example of a takeaway from a video about the Amazon tropical rainforest, “Evidence from the video seems to indicate a correlation between increasing environmental degradation in the Amazon basin and the fuel demands of Western countries.”
2 points
...
1. The 3 genes that you will compare at listed below. Take a look.AbbyWhyte974
1. The 3 genes that you will compare at listed below. Take a look. I’ve colored ‘the header region’ of each so that you can distinguish one from the other. DO NOT CHANGE THE FORMAT. DO NOT ADD TEXT OF ANY SORT. WHEN YOU COPY THE GENE DON’T FORGET TO INCLUDE THE ‘HEADER (RED) REGION (starting with “>”). The ‘>’ symbol tells the software the start of the gene. and the red region DESCRIBES THE GENE (SEQUENCE).
2. Using your computer, open the program (used to compare them). The link is http://multalin.toulouse.inra.fr/multalin/ (cut and paste link into your browser)
3. Copy THE FIRST 2 SEQUENCES ONLY (1 and 2) and paste into the “white box-region” just below region marked Sequence-data. Make sure you copy the entire sequence for each gene including the ‘> symbol and red heading’.
4. Click the region below the box marked “Start MultiAlin’. This starts your comparison
5. Examine results. Make note of the colors. If the colors are ‘alike’ that means the sequences are similar. THIS PROGRAM USES COLOR TO DETERMINE HOW SIMILAR 2 SEQUENCES ARE.SAME COLOR MEANS THEY ARE SIMILAR.
6. Use the back-space button and return to the original screen. Delete the sequences in the white box. This allows for a new comparison.
7. Paste sequences 2 and 3 in the box. this allows for comparison of sequences 2 and 3, similar to what was done for 1 and 2.
8. Click the “Start MultiAlin” just like before.
9. Note the color- scheme. Compare what you observed for 1 and 2. Which are more similar 1 and 2, or 2 and 3?
10. For full credit, you should copy results from comparison of 1-2 and separately, 2-3. Doesn’t matter if you don’t have color printer.
11. Or… at the bottom of the image page, there is a command --- “Results as a gif file’. It is located under the region marked, ‘AVAILABLE FILES’… Click on this (Results as a gif file’) and print your results. Staple the first comparison to the second, and turn in. or give as computer file. Which ever are more convenient? Tell me which 2 comparisons (ie, genes) are more alike.
COMPARISON SHOULD LOOK LIKE THIS… (red= exactly alike; blue = different sequence). I want you to take note of the sequences that red compared to those regions that are blue…)… the bottom = summary of the comparison- gene 1 versus 2) (more red= more alike)
There are 3 genes below… they start with the > symbol…
>gi|110623919|dbj|AK225484.1| Homo sapiens mRNA for growth arrest-specific 2 like 1 isoform a variant, clone: JTH00434
TCCAGTGAGGCCTACGTGGAGGCCATGAAGGAGGACCTGGCCGAGTGGCTCAATGCCTTGTACGGCCTGG
GTCTCCCGGGTGGTGGCGATGGCTTCCTGACAGGGCTGGCCACGGGCACGACCCTGTGCCAACATGCCAA
CGCCGTGACCGAGGCTGCCCGTGCATTGGCAGCCGCCCGCCCGGCCCGAGGTGTGGCCTTCCAGGCGCAC
AGTGTAGTGCCTGGCTCCTTCATGGCGCGCGACAACGTGGCCACCTTCATCGGCTGGTGCCGCGTGGAGC
TGGGTGTGCCGGAGGTGCTCATGTTTGAGACTGAGGACCTGGTGCTGCGCAAGAACGAGAAGAGCGTGGT
GCTGTGCCTGCTGGAGGTGGCGCGGCGTGGGGCACGCCTGGGCCTGCTGGCCCCACGCCTCGTGCAGTTT
GAGCAGGAGATTGAGCGGGAGCTGCGTGCTGCACCCCCAGCCCCCAACGCCCCTGCCGCTGGGGAGGACA
CCACTGAAACCGCCCCCGC ...
1. Student and trainer detailsStudent details Full nameStuAbbyWhyte974
1. Student and trainer details
Student details
Full name:
Student ID:
Contact number:
Email address:
Trainer details
Full name:
2. Qualification and unit of competency
Qualification/Course/Program Details
Code:
Name:
Unit of competency
Code:
CPCCCA3014
Name:
Construct and install bulkheads
Releases:
1.0
Release date:
27/Nov/2020
3. Assessment Submission Method
☐ By hand to trainer/assessor ☐ By email to trainer/assessor
☐ Online submission via Learning Management System (LMS)
☐ Any other method _________________________________________________
(Please describe here)
4. Student declaration
· I have read and understood the information in the Unit Requirements prior to commencing this Student Pack
· I certify that the work submitted for this assessment pack is my own. I have clearly referenced any sources used in my submission. I understand that a false declaration is a form of malpractice;
· I have kept a copy of this Student Pack and all relevant notes, attachments, and reference material that I used in the production of this Student Pack;
· For the purposes of assessment, I give the trainer/assessor permission to:
· Reproduce this assessment and provide a copy to another member of staff; and
· Take steps to authenticate the assessment, including communicating a copy of this assessment to a plagiarism checking service (which may retain a copy of the assessment on its database for future plagiarism checking).
Student signature: ________________________________
Date: ____/_____/______________
5. Assessment Plan
The student must be assessed as satisfactory in each of the following assessment methods in order to demonstrate competence in a variety of ways.
Evidence number/ Task number
Assessment method/ Type of evidence/ Task name
Sufficient evidence recorded/Outcome
Assessment task 1
Knowledge Test (KT)
S / NS (First Attempt)
S / NS (Second Attempt)
Assessment task 2
Skill Test (ST)
S / NS (First Attempt)
S / NS (Second Attempt)
Outcome
C ☐ NYC ☐
Date assessed:
Trainer signature:
6. Completion of the Assessment Plan
Your trainer is required to fill out the Assessment Plan Outcome records above, when:
· You have completed and submitted all the requirements for the assessment tasks for this cluster or unit of competency.
· Your work has been reviewed and assessed by your trainer/assessor.
· You have been assessed as either satisfactory or unsatisfactory for each assessment task within the unit of competency.
· You have been provided with relevant and detailed feedback.
Every assessment has a “Feedback to Student” section used to record the following information. Your trainer/assessor must also ensure that all sections are filled in appropriately, such as:
· Result of Assessment (satisfactory or unsatisfactory)
· Student name, signature and date
· Assessor name, signature and date
· Relevant and detailed feedback
7. U ...
1. Student uses MS Excel to calculate income tax expense or refundAbbyWhyte974
1. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the full-cost method for transfer pricing. There are no errors.
2. Student uses MS Excel to calculate income tax expense or refund, taxable income, and total taxes using the variable-cost method for transfer pricing. There are no errors.
3. Student produces a thorough and detailed Word document that incorporates specific details from the MS Excel spreadsheet, a detailed recommendation based on those specific details as to how the organization should proceed is included, and the recommendation is justified with at least 3 examples from the week's resources and/or additional research in the Walden Library.
4. Writing exhibits strong evidence of thoughtful critical analysis and thinking; careful examination is made of assumptions and possible biases, with detailed supporting rationale. Writing synthesizes the classroom experiences and content; analyzes patterns or connections between theory and practice; and draws logical conclusions based on well-reasoned arguments. New questions are presented based on synthesis of ideas and input.
5. Writing is clear, logical, well-organized and appropriate. Work is free from spelling and grammar/syntax errors. Tone is professional and free from bias (i.e., sexism, racism). There are no errors.
6. Student effectively and directly integrates discussion/assignment content with relevant and compelling personal experiences, additional research, or current events from credible news sources. Specifically adds a new and/or different insight or perspective on the subject area(s) being discussed or treated in the assignment.
7. Student demonstrates full adherence to scholarly or credible reference requirements and adheres to APA style with respect to source attribution and references. There are no APA errors.
CASE STUDY—BEWARE: One Emergency May Hide Another!
A hospital submitted a report to the State Board of Nursing reporting that an RN had been terminated after the death of a patient following surgery for a tubal pregnancy.
THE NURSE'S STORY—SALLY SIMMS, RN
I had worked the medical-surgical units at the General Hospital ever since graduating from my nursing program 4 years before. This was the worst night, the worst shift, of my nursing career.
I was assigned to care for eight patients that night, which is not an unusual number of patients, but they all were either fresh post-ops or so very sick. Four patients had just had surgery that day. One patient was on a dopamine drip to maintain his blood pressure, so he needed frequent monitoring. One patient was suspected to have meningitis, one patient had pneumonia, and a patient with suspected histoplasmosis completed my assignment.
One of my post-op patients was Betty Smith, a young woman in her early thirties who had laparoscopic surgery late in the day. She had been transferred from the recovery room late in the evening shift and was very uncomfortable when I fi ...
1. Socrates - In your view, what was it about Socrates’ teachings AbbyWhyte974
1. Socrates - In your view, what was it about Socrates’ teachings that made him dangerous in the minds of the members of the ruling class of Athens; and what was it about his teachings that attracted his students to him?
2. Plato - Of his many ideas, which do you think has been his most influential, and why?
3. Aristotle - Share your own views on Aristotle's break with Plato on the question of private property and wealth accumulation. Is Aristotle's argument persuasive and superior? Or was it weak, and even dangerous?
4. Birth of Christianity as a Religion - Imagine the the Council of Nicaea ended with the Gospel of Mary being included in the New Testament. How might Western Civilization have developed differently if this book, and it's suggestion the Jesus’ closest disciple, the one he revered the most, was actually a woman? Do you think we might have inherited a less misogynistic society in which women are treated more as equals?
7. The encomienda system used by the Spaniards to enslave the indigenous peoples of the New World, especially as practiced in Mexico, became controversial in Spain. Describe the encomienda system and the arguments used for and against it.
8. Describe why it is that many historians argue that King Henry VIII of England played a critical role in the rise of capitalism.
9. By the time Adam Smith’s An Inquiry into the Nature and Causes of the Wealth of Nations was published in 1776, Europe had undergone a dramatic transformation from a feudal, largely agrarian society to an increasingly market-based commercial society. Discuss some of the more significant, transformative societal developments, and their implications, from 1492 to 1776.
10. Much has been written about the so-called “Adam Smith Problem;” the apparent dichotomy between his Theory of Moral Sentiments and An Inquiry into the Nature and Causes of the Wealth of Nations. Discuss whether these two works are reconcilable with one another. Do they reflect two very different imaginations of humans? Do they suggest that the author changed his mind after writing the first book? Might they represent a more complex and unifiable imagination of who we are or can be?
11. The garment industry is the second-most polluting in the world. A significant amount of this pollution is from “fast fashion” “disposable” clothing; a business model that relies on people, including children, making clothes under conditions that we would consider intolerable. Psychologists and marketers alike agree that our buying and consumption is largely driven by psychological impulses of which we may not be fully conscious. Indeed, as experts posit in the film The True Cost, consuming more can have a negative effect on our psyche. What social, ethical, economic and/or philosophical issues are raised by The True Cost documentary? Why do we tolerate such a system?
12. Many people agree with Immanuel Kant's argument that we should never treat other people as means to an end; we should treat each pers ...
1. Select a patient” (friend or family member) on whom to performAbbyWhyte974
1. Select a “patient” (friend or family member) on whom to perform a complete H&P.
2. NOTE: DO NOT USE REAL NAMES OR INITIALS OR OTHERWISE IDENTIFY YOUR “PATIENT.” FAILURE TO MAINTAIN PRIVACY WILL RESULT IN A FAILING SCORE.
3. Using the format specified below, write a 2 page SOAP note on your “patient.” The HPI should be presented in a paragraph, and the rest of the data including the ROS should be presented in a list format.
4. Collect only the information that is pertinent to the chief complaint of the patient to include in your SOAP note. Aim for a single page using normal margins and format.
5. The SOAP Note must contain all required elements as outlined in the rubric below.
6. You must self-score your SOAP note using the rubric and attach it to the assignment.
Criteria Ratings Points
Thread
Content
50 to >46.0 pts
Advanced
47 to 50 points All key
components of the
Discussion Board Forum
prompt are answered in
the thread. Major points
are supported by all of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the
required 7 or more from
personal research, the
course readings, and the
integration of 1 biblical
principle.
46 to >43.0 pts
Proficient
44 to 46 points Some key
components of the
Discussion Board Forum
prompt are answered in the
thread. Major points are
supported by some of the
following): *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle.
43 to >0.0 pts
Developing
Minimal key components of
the Discussion Board
Forum prompt are
answered in the thread.
Major points are supported
by some or none of the
following: *Reading &
Study materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Source
citations in current APA
format, include the required
7 or more from personal
research, the course
readings, and the
integration of 1 biblical
principle
0 pts
Not
Present
50 pts
Replies
Content
41 to >39.0 pts
Advanced
Contribution made to
discussion with each reply
expounding on the thread.
Major points are supported
by all of the following:
*Reading & Study
materials; *Pertinent,
conceptual, or personal
examples; *Thoughtful
analysis (considering
assumptions, analyzing
implications, and
comparing/contrasting
concepts); and *Three
peer-reviewed source
citations in current APA
format, and the integration
of 1 biblical principle.
39 to >35.0 pts
Proficient
Marginal contribution made
to discussion with each
reply slightly exp ...
1. Review the HCAPHS survey document, by clicking on the hyperlinkAbbyWhyte974
1. Review the HCAPHS survey document, by clicking on the hyperlink.
2. Choose one of the questions on the survey and research an intervention to improve patient satisfaction on that question.
3. Drop a pdf of the article for your solution
4. Review the rubric to make sure you include all required information in your video assignment.
5. Create a video to present a systems-based solution, according to the research. (Do NOT include "increased staffing" as your solution.)
March 2017 1
HCAHPS Survey
SURVEY INSTRUCTIONS
You should only fill out this survey if you were the patient during the hospital stay
named in the cover letter. Do not fill out this survey if you were not the patient.
Answer all the questions by checking the box to the left of your answer.
You are sometimes told to skip over some questions in this survey. When this happens
you will see an arrow with a note that tells you what question to answer next, like this:
Yes
No If No, Go to Question 1
You may notice a number on the survey. This number is used to let us know if
you returned your survey so we don't have to send you reminders.
Please note: Questions 1-25 in this survey are part of a national initiative to measure the quality
of care in hospitals. OMB #0938-0981
Please answer the questions in this survey
about your stay at the hospital named on
the cover letter. Do not include any other
hospital stays in your answers.
YOUR CARE FROM NURSES
1. During this hospital stay, how often
did nurses treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
2. During this hospital stay, how often
did nurses listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
3. During this hospital stay, how often
did nurses explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
4. During this hospital stay, after you
pressed the call button, how often did
you get help as soon as you wanted
it?
1
Never
2
Sometimes
3
Usually
4
Always
9
I never pressed the call button
2 March 2017
YOUR CARE FROM DOCTORS
5. During this hospital stay, how often
did doctors treat you with courtesy
and respect?
1
Never
2
Sometimes
3
Usually
4
Always
6. During this hospital stay, how often
did doctors listen carefully to you?
1
Never
2
Sometimes
3
Usually
4
Always
7. During this hospital stay, how often
did doctors explain things in a way
you could understand?
1
Never
2
Sometimes
3
Usually
4
Always
THE HOSPITAL ENVIRONMENT
8. During this hospital stay, how often
were your room and bathroom kept
clean?
1
Never
2
Sometimes
3
Usually
4
Always
9. During this hospital stay, how often
was the area around your room quiet
at night?
1
Never
2
Sometimes
3
Usually
4
Always
YOUR EXPERIENCES ...
1. Saint Leo Portal loginUser ID[email protected] AbbyWhyte974
1. Saint Leo Portal login
User ID:[email protected]
Saintleo\martha.ramsey
Password: Demonte5!!!
2. New Login for email through Okta
User ID: Martha.ramsey
Password: Demonte5!!!
3. What did you earn your first medal or award for?
Art class
4. Lion Share Courses
5. Research Method I
...
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...pleaAbbyWhyte974
1. Reference is ch. 5 in the e-text, or ch. 2 in paper text...please match the terms regarding political parties
polling data is based on this aspect of Parties
Rep. Senfronia Thompson filed for the role of Speaker of Texas House
In 2020, party delegates and executive committees voted to nominate presidential candidates via Zoom
a sector of a political party (ex. Trump Republican, conservative Democrat) is called
2. Which candidate’s office is chosen/nominated by delegate convention?
sheriff of Medina County
U.S. congressman from the 4th Texas congressional district
president of the United States
governor of Texas
3. Which statement best depicts the effect of redistricting on representative democracy?
Legislators represent the same number of Republicans and Democratic voters
representation is mostly based on geographic cohesion
representation is mostly based on the voting patterns of Texas residents
gerrymandering is a legitimate method of forming districts
4. The difference between absentee ballot and mail-in ballot is?
absentee is for people residing outside of their state
mail-in ballots are issued to people who can't go to polls
in some states there is no difference, as all ballots are mailed in
in Texas mail-in ballots require doctors note
5 Unlike the US, most democratic governments have _______ political systems with _______.
2-party//direct representation
Multi-party//proportional
2-party//direct representation
multi-party//proportional representation
independent party//single-member districts
2-party//single-member districts
[ Choose ]
[ Choose ]
[ Choose ]
Car LoanNew Car LoanLoan InputsSticker price$ 24,595Trade in$ 3,500Cash back offer$ - 0Loan amount$ 21,095Loan term (months)24Loan interest (APR)1.90%Loan payment$ 896.46Total cost of the car$ 21,515.04
My Car Data
MPG DataAll ModelsModelDisplCylTransDriveFuelCert RegionStndStnd DescriptionUnderhood IDVeh ClassAir Pollution ScoreCity MPGHwy MPGCmb MPGGreenhouse Gas ScoreSmartWayComb CO2ACURA ILX2.44AMS-82WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV02.4SH3small car62535297Yes309ACURA ILX2.44AMS-82WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV02.4SH3small car62535297Yes309ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61927225No404ACURA MDX3.56SemiAuto-92WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV62027235No391ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61826214No424ACURA MDX3.56SemiAuto-94WDGasolineCAL3ULEV125California LEV-III ULEV125HHNXV03.5VH3small SUV61926225No404ACURA MDX3.56SemiAuto-94WDGasolineFAT3B125Federal Tier 3 Bin 125HHNXV03.5VH3small SUV61826214No424ACURA MDX ...
Exploiting Artificial Intelligence for Empowering Researchers and Faculty, In...Dr. Vinod Kumar Kanvaria
Exploiting Artificial Intelligence for Empowering Researchers and Faculty,
International FDP on Fundamentals of Research in Social Sciences
at Integral University, Lucknow, 06.06.2024
By Dr. Vinod Kumar Kanvaria
Thinking of getting a dog? Be aware that breeds like Pit Bulls, Rottweilers, and German Shepherds can be loyal and dangerous. Proper training and socialization are crucial to preventing aggressive behaviors. Ensure safety by understanding their needs and always supervising interactions. Stay safe, and enjoy your furry friends!
This presentation was provided by Steph Pollock of The American Psychological Association’s Journals Program, and Damita Snow, of The American Society of Civil Engineers (ASCE), for the initial session of NISO's 2024 Training Series "DEIA in the Scholarly Landscape." Session One: 'Setting Expectations: a DEIA Primer,' was held June 6, 2024.
This slide is special for master students (MIBS & MIFB) in UUM. Also useful for readers who are interested in the topic of contemporary Islamic banking.
Macroeconomics- Movie Location
This will be used as part of your Personal Professional Portfolio once graded.
Objective:
Prepare a presentation or a paper using research, basic comparative analysis, data organization and application of economic information. You will make an informed assessment of an economic climate outside of the United States to accomplish an entertainment industry objective.
The simplified electron and muon model, Oscillating Spacetime: The Foundation...RitikBhardwaj56
Discover the Simplified Electron and Muon Model: A New Wave-Based Approach to Understanding Particles delves into a groundbreaking theory that presents electrons and muons as rotating soliton waves within oscillating spacetime. Geared towards students, researchers, and science buffs, this book breaks down complex ideas into simple explanations. It covers topics such as electron waves, temporal dynamics, and the implications of this model on particle physics. With clear illustrations and easy-to-follow explanations, readers will gain a new outlook on the universe's fundamental nature.
Executive Directors Chat Leveraging AI for Diversity, Equity, and InclusionTechSoup
Let’s explore the intersection of technology and equity in the final session of our DEI series. Discover how AI tools, like ChatGPT, can be used to support and enhance your nonprofit's DEI initiatives. Participants will gain insights into practical AI applications and get tips for leveraging technology to advance their DEI goals.
Physiology and chemistry of skin and pigmentation, hairs, scalp, lips and nail, Cleansing cream, Lotions, Face powders, Face packs, Lipsticks, Bath products, soaps and baby product,
Preparation and standardization of the following : Tonic, Bleaches, Dentifrices and Mouth washes & Tooth Pastes, Cosmetics for Nails.
A Strategic Approach: GenAI in EducationPeter Windle
Artificial Intelligence (AI) technologies such as Generative AI, Image Generators and Large Language Models have had a dramatic impact on teaching, learning and assessment over the past 18 months. The most immediate threat AI posed was to Academic Integrity with Higher Education Institutes (HEIs) focusing their efforts on combating the use of GenAI in assessment. Guidelines were developed for staff and students, policies put in place too. Innovative educators have forged paths in the use of Generative AI for teaching, learning and assessments leading to pockets of transformation springing up across HEIs, often with little or no top-down guidance, support or direction.
This Gasta posits a strategic approach to integrating AI into HEIs to prepare staff, students and the curriculum for an evolving world and workplace. We will highlight the advantages of working with these technologies beyond the realm of teaching, learning and assessment by considering prompt engineering skills, industry impact, curriculum changes, and the need for staff upskilling. In contrast, not engaging strategically with Generative AI poses risks, including falling behind peers, missed opportunities and failing to ensure our graduates remain employable. The rapid evolution of AI technologies necessitates a proactive and strategic approach if we are to remain relevant.
This presentation includes basic of PCOS their pathology and treatment and also Ayurveda correlation of PCOS and Ayurvedic line of treatment mentioned in classics.
A review of the growth of the Israel Genealogy Research Association Database Collection for the last 12 months. Our collection is now passed the 3 million mark and still growing. See which archives have contributed the most. See the different types of records we have, and which years have had records added. You can also see what we have for the future.
বাংলাদেশের অর্থনৈতিক সমীক্ষা ২০২৪ [Bangladesh Economic Review 2024 Bangla.pdf] কম্পিউটার , ট্যাব ও স্মার্ট ফোন ভার্সন সহ সম্পূর্ণ বাংলা ই-বুক বা pdf বই " সুচিপত্র ...বুকমার্ক মেনু 🔖 ও হাইপার লিংক মেনু 📝👆 যুক্ত ..
আমাদের সবার জন্য খুব খুব গুরুত্বপূর্ণ একটি বই ..বিসিএস, ব্যাংক, ইউনিভার্সিটি ভর্তি ও যে কোন প্রতিযোগিতা মূলক পরীক্ষার জন্য এর খুব ইম্পরট্যান্ট একটি বিষয় ...তাছাড়া বাংলাদেশের সাম্প্রতিক যে কোন ডাটা বা তথ্য এই বইতে পাবেন ...
তাই একজন নাগরিক হিসাবে এই তথ্য গুলো আপনার জানা প্রয়োজন ...।
বিসিএস ও ব্যাংক এর লিখিত পরীক্ষা ...+এছাড়া মাধ্যমিক ও উচ্চমাধ্যমিকের স্টুডেন্টদের জন্য অনেক কাজে আসবে ...
বাংলাদেশ অর্থনৈতিক সমীক্ষা (Economic Review) ২০২৪ UJS App.pdf
1. Examine Hofstedes model of national culture. Are all four dime
1. 1. Examine Hofstede's model of national culture. Are all four
dimensions still important in today's society as it relates to the
success of the multinational manager? Why, or why not? Which
do you think is the least important as it relates to multinational
management? Why?
2. More companies are seeking to fill multinational management
positions due to the influx of business growth abroad. If you
were offered and accepted a position as a multinational
manager, what would you do to personally prepare for the
culture of a different country? Where would you seek
information? What overall responsibilities would you expect of
the job? How do you think the managerial responsibilities
would be different from those you would face in the United
States?
3. Multinational managers encounter many levels of culture.
Which of the culture levels do you think might be the most
difficult to manage? Why? Share an example. Which culture
level do you think might be the easiest to understand? Why?
Give an example of this.
4. In your own words, what is your perception of free trade?
Think about the advantages of free trade; what are two benefits
that result from free trade? There is also a downside to free
trade; what are two disadvantages resulting from free trade?
Provide reasoning for your choices.
5. What are the three major economic systems that nations
utilize, and what is the role of each? How does each affect and
influence individuals, multinational managers, and
corporations?
6. How would you define ethical convergence? What are the
2. four basic reasons for ethical convergence? Which might be the
most difficult for multinational companies to follow, and why?
7. Describe the four major world religions. What are the
impacts of each religion type on an economic environment?
What do you think makes religion a concern in societies?
8. If you were a multinational manager, and you encountered an
ethical dilemma within the multinational company, what
heuristic questions would you use to decide between ethical
relativism and ethical universalism? Of the different heuristic
questions, which one do you think is most important? Explain
your reasoning.
1
Week Two Instructor’s Notes
PHIL 1103 Summer
This week you will be learning in detail about the four different
moral perspectives that
we will use to analyze moral questions.
Notice two things right at the start. First, because normative
ethics is our main focus this
term, we are not going to attempt to settle the question of
whether any moral perspective at all
could be correct or known to be correct—that is a task for
metaethics. Our task in this second
week is to learn in some detail about four different kinds of
consideration or value that often
seem relevant when we try to decide what is morally right or
3. wrong in particular cases, namely:
(1) Respect for the rights and autonomy of the persons involved
(2) Increasing the overall well-being of the most individuals
possible
(3) Asking what a person of virtue, of strong character, would
do in the given situation
(4) Determining what care and compassion would require in that
case.
Second, notice that there are certainly other alternative
perspectives that one may think are
relevant in some or all cases; for example, some say that
achieving the most personal pleasure is
the only goal a person needs to consider when deciding what is
morally right or wrong for them
to do (this view is called ‘moral hedonism’). And there are
others of course. We will only be
concentrating on the four perspectives just listed (rights, well-
being for the greatest number,
virtue, and care) because they are commonly heard in discussion
about what is morally right to
do and because we have limited time to work this term.
Each of the four perspectives gives us a principled way to
answer moral questions. We
could of course answer the moral questions we face by simply
flipping a coin or by force. The
moral perspectives, however, provide a sort of guide or rule-
book that we can use in all cases to
determine what counts as right and what counts as wrong.
Each perspective is discussed in a separate chapter in Weston;
respect for the rights of
persons is discussed in Chapter Five, increasing the well -being
for the greatest number is
4. discussed in Chapter Six, virtue and character are discussed in
Chapter Seven, and care and
compassion are discussed in Chapter Eight. Because each of
these perspectives have many
aspects, and there is disagreement about how to best understand
what each perspective entails,
we are going to focus on certain elements of the discussions in
those chapters. Let me now say
something about the specific places we will focus in this week’s
readings.
Chapter Five: Ethics of the Person
In this chapter we consider what it might mean to respect the
individual rights and
autonomy of the persons involved in situations in which we
must decide what to do. There are
many different conceptions of what a person is, and what it
might mean to properly respect them
as an individual with aspirations, autonomy, and rights. For
example, there are different types of
rights (recall the discussion of general rights, specific rights,
positive rights, and negative rights
in the Week One Instructor’s Notes). And there are many
different lists of the general and
specific and positive and negative rights that persons
supposedly enjoy (for example, there is the
Bill of Rights in the Constitution of the United States and there
is the United Nations Universal
Declaration of Human Rights (which you will read about in this
chapter)).
Our primary focus in Chapter Five will be two of the different
formulations that the
philosopher Kant gives to what he calls “The Categorical
5. Imperative”. Kant’s Categorical
Imperative is one way of determining what we must do in
particular cases to properly respect the
2
autonomy and rights of the persons that may be impacted by our
decisions. Another way to put
the point is to say that the Categorical Imperative is supposed to
give us a recipe for deciding
what actions are morally required because they best respect the
autonomy and rights of others.
Applying the Categorical Imperative to particular moral
questions, then, will reveal what rights
people have and what it means to value someone as a person, as
a fellow human being just as
significant as myself.
So although I want you to read the entire chapter, take special
care to carefully learn and
reflect on Kant’s Categorical Imperative. The Categorical
Imperative is discussed on pages 137-
142. There are different ways that Kant formulates the idea of
the Categorical Imperative, one
found on page 138 and two more on the following page. We
will focus on the first formulation
(page 138, using the idea of a universal law) and the second (p.
139, using the idea of treating
others as ends in themselves and not just a means to an end).
Spend some time with each
formulation and try to imagine in detail what it might mean in
practice. And, both formulations
are supposed to express exactly the same idea, so be sure to
think about how each of these
6. different formulations can be understood to be saying the same
thing, and would both
recommend exactly the same actions and policies.
Kant’s theory is what is called a “deontological” moral theory.
For Kant, when we are
deciding whether some act is morally right or wrong, we must
only consider the nature of and
motivation for the action itself, regardless of the consequences.
If I intend to hurt someone, but
just by chance it turns out that I unintentionally save their life
as well as the lives of others, what
I have done, the action itself, is still morally wrong. And for
Kant, my motivation must be only
to do my moral duty (the word “deontological” comes from the
Greek word deon, meaning “to
bind”). For my action to be morally right it must be done solely
because I am bound by a moral
duty to perform that action, that must be my only motivation.
And there is a clear intuition
here—we often think that the morally respectable person is
someone who, regardless of fear or
personal danger, and regardless of expectation of personal
benefit, does their duty. And they do
it simply because it is their duty. Notice also, then, that for
Kant, I should not be motivated by
emotion. Being motivated by emotions of compassion or pity or
care is not to be motivated by
duty alone.
But how do I know exactly which actions it is my duty to
perform? Kant answers this
question with his Categorical Imperative, a rule for deciding
what I am morally required to do
and not to do. Again, he gives several different formulations of
this rule, and we are going to
7. focus especially on the first two formulations. Those
formulations are explained in Chapter 5.
The first formulation (page 138) uses the idea of what we coul d
rationally will to be a
universal law that applies to everyone under all circumstances.
When working with the first
formulation, pay particular attention to how the concept of
rationality plays a role in deciding
what to do. I must determine what would be rational if
everyone were to do it, not just me. So
notice that this standard immediately rules-out certain kinds of
actions. Take lying for example.
If I lie, but others generally tell the truth, then my lie may have
the desired effect. People I lie to
may be fooled because they expect that generally speaking
people tell the truth. Lying is only
rational if I do it but no one else does. However, if everyone
lied all the time, then no one would
expect anyone to tell the truth, and lying would never have the
desired results. It would be
irrational to lie if everyone did it. It would defeat the purpose
of lying if everyone was a liar all
the time. Or consider paying for a movie ticket. Suppose I
have the opportunity to sneak in,
undetected, and watch the movie for free. But now imagine that
everyone did this (it was
universally allowed). Then movie theatres would have no
revenue and would have to close.
3
Then no one could watch a movie at the theatre. So it would be
irrational to will that everyone
8. should sneak into the theatre without paying, that would defeat
the purpose of me sneaking in
since it would mean that there would be no theatre to sneak
into. Also notice that Kant is here
advocating a certain kind of equality—no one can put
themselves above others. Whatever I
think about doing, I must agree that everyone should be allowed
to do it (that it should be a
universal law).
The second formulation (page 139) requires that we always treat
others as “ends in
themselves”. When thinking about what this means, focus
particularly on the concept of
autonomy. I should never treat others only as tools I use to
achieve my own desires. I must
recognize that others are autonomous beings that have their own
desires and plans and hopes and
values. And be very careful when working with the second
formulation to notice that it is not
equivalent to the Golden Rule (“Treat others as you want to be
treated”). This is also true for the
first formulation—doing what would be right for everyone to do
is not the same a treating others
as you want to be treated. As you are grappling with
understanding the Categorical Imperative,
think about examples in which the Categorical Imperative would
require something different
from the Golden Rule. Here is one kind of case to think about.
Imagine you are a judge about to
impose a sentence. By the Golden Rule, you might be inclined
to be lenient, even very lenient
(as that is how you might want to be treated if you were being
judged). However, could we
rationally will that all sentences be radically lenient? Would
this undermine the point of a justice
9. system? Would we be treating the victims as ends in
themselves, respecting their aspirations and
values? Would we even be treating the person to be sentenced
as an end in themselves, or
merely as a means for insuring that if the time comes I will be
treated in a certain way?
Chapter Six: Ethics of Happiness
The central value we seek to protect and advance in answering
moral questions from this
point of view is the happiness for the greatest number. That is,
the morally right thing to do is to
choose the action or policy which will best advance the
happiness or well-being of the greatest
number of individuals possible under the circumstances. This
way of thinking is often called
“Utilitarianism”—you learn why in the chapter. Focus
primarily on understanding pages 181-
188 and also pages 193 (beginning with the heading
“Complications”) through 198 (though do of
course read the entire chapter as assigned). The Utilitarian
moral perspective is common in
everyday personal decision-making when concerning the impact
of our actions on others as well
as in formulating law and public policy.
Notice that one of the main tasks in this sort of moral
perspective will be to define
‘happiness’ or ‘well-being’ or ‘good’ or ‘benefit’ (as well as
their opposites, especially the
complex notion of suffering). There are many different forms
of each of these, for example,
physical vs mental. And in the case of physical well-being or
health, there are many different
10. ways that can be defined and measured. In the case of mental
or emotional well-being or
happiness, again there are many different forms here. Is the
happiness derived from a tasty snack
the same as the happiness derived from long-lasting friendships
or engagement with the arts?
There is also an important distinction to be made between short-
term happiness or well-being
and long-term happiness or well-being (and long-term happiness
may necessitate short-term
suffering, as in surgery or mastering a sport).
Notice also that the Utilitarian Principle requires the greatest
good for the greatest
number of individuals. This is a per capita measure, not an
aggregate measure. According to
the Utilitarian principle, we must seek to improve things to the
greatest degree for the greatest
4
number of individuals, not simply increase the total amount of
benefit (which might be
distributed wildly unequally). And note that we said
‘individuals’ here, because the principle can
be formulated so that the well-being of non-human individuals
is morally relevant (individuals
like dogs and families and ecosystems for example).
You will find that the Utilitarian principle is in sharp conflict in
various ways with the
Categorical Imperative of Kant. When thinking about possible
objections to the Utilitarian way
of thinking it is important to keep in mind that there are two
11. very different types of potential
difficulty for the Utilitarian principle, moral objections and
practical objections. Moral
objections say that in some situations the Utilitarian principle
offers morally wrong advice. For
example, the Utilitarian principle appears to conflict with
justice and individual rights in some
cases (there is a discussion of this in Weston). Other
commentators have pointed out that the
Utilitarian principle undermines the personality in requiring
undermining of personal growth and
development in the quest to advance the well-being of others.
On the other hand, Practical
objections pertain to the difficulties in actually attempting to
apply the Utilitarian principle in
real cases. For example, to apply the principle we need some
sort of objective way to measure
happiness or well-being, but this is perhaps an impossible task
(for a variety of reasons). We
also need to make reliable predictions about the long-term
consequences of acts for, in some
cases, thousands of people, but this is also beset with obvious
difficulties. There is also the
worry of whether it is realistic to expect people to continuously
perform complex calculations
about the far-reaching effects of their actions. Do also keep in
mind, though, that these potential
moral and practical objections are well-known to Utilitarians,
and various response have been
offered. On close examination, what might seem like a slam-
dunk objection may not be as
powerful and convincing as one may have thought at first.
Chapter Seven: Ethics of Virtue
Chapter Seven discusses the role of virtue and character in
12. answering moral questions. It
is often said that we ought to do the virtuous thing when faced
with morally weighty decisions.
But like rights and well-being, there are many different views
about what virtues a person should
have, and what exactly the virtuous person would do in various
specific situations. In this
chapter I want you to focus primarily on Aristotle’s conception
of virtue as described from the
middle of page 217 to page 221 (but again, do be sure to read
the entire chapter as assigned).
Here I will explain the main ideas of Aristotle’s ethics of virtue.
As I mentioned in the Instructor’s Notes for Week One,
Aristotle’s moral theory is very
different from Kant’s perspective and the Utilitarian
perspective. Both Kant and the Utilitarians
give an answer to the question “What are the correct moral rules
that I should follow?”. Kant
proposes the Categorical Imperative while Utilitarians propose
the Utilitarian Principle as the
correct rule to guide moral action. Aristotle’s question is
different; he answers the question
“What is the best or most fulfilling kind of life?”. A by-product
of his answer will also give us a
method for determining which actions are right and which are
wrong, and how to treat others.
But that method will not involve a rule; in fact, Aristotle does
not think that any rule will ever do
the job.
To begin answering his question “What is the best kind of life?”
Aristotle first says that
three common answers to this question are wrong. Many people
will answer this question by
13. saying that a life of wealth, or fame, or pleasure (or some
combination) is the best kind of life.
However, Aristotle says that wealth does not make the best kind
of life, since money is only a
tool that can be used well or badly. Money not intrinsically
valuable (valuable in itself), it only
5
has instrumental value. Acquiring fame cannot be the best kind
of life since fame depends on
others. A life of pleasure cannot be the best kind of life
because pleasure is fleeting—one always
has to get a new fix; in this way, Aristotle says, the pleasure-
seeking life is a life of slavery. So
then what is the best kind of life to lead?
Aristotle says that we can answer this question by using the
three related concepts of
function, flourishing (or excellence), and virtue. We start with
the concept of function. Aristotle
thought that all things, including human beings, have an ergon,
which is usually translated as
“function” or “characteristic activity”. The idea is easy to
understand in the case of tools. A
vegetable knife has a function, namely, to cut vegetables into
various sizes. An automobile has a
function, namely, to transport people and things from one place
to another. Of course, any object
may be used to for a variety of purposes; a vegetable knife can
be used as a bookmark, a car as
shelter. But, on Aristotle’s view, all things have a primary
function or a characteristic activity, a
particular role in the overall scheme of the universe that makes
14. the thing the kind of thing that it
is. So we can see that not just tools, but any object (even
natural objects) will have an ergon, a
characteristic activity that makes it unique amongst all other
things.
Now, any given particular thing will perform its function well,
or in a mediocre way, or
poorly. When a thing performs its function well, excellently, it
is said to flourish, to have
achieved excellence as that kind of thing. An oak that stands
tall and produces a plentiful supply
of good acorns has flourished as an oak tree, is an excellent
oak. A vegetable knife that
efficiently cuts vegetables into all the shapes and sizes we want
has flourished as a vegetable
knife, is an excellent vegetable knife.
A thing that is flourishing, that is excellent at its characteristic
activity, flourishes because
it has certain characteristics. That is how Aristotle defines
virtue—a virtue for an object is a
characteristic that enables that object to perform its function
well. Whatever characteristics a
thing needs in order to perform its function well are called the
‘virtues’ for that thing. This is
why it is said that “the virtues of a thing are determined by its
function”—once we know the
function of a thing, we will be able to determine which
characteristics that thing needs in order to
perform its function well. For example, the function of a
vegetable knife is to cut vegetables. So
the virtues for a vegetable knife will be attributes like being
sharp, being able to hold sharpness
over time, having a comfortable handle, and having an
appropriate length. These are
15. characteristics that enable a vegetable knife to cut vegetables
well. Virtues for an oak would
include being planted in soil with a certain chemical
composition, having enough leaves exposed
to enough sun, having efficient systems for moving water and
nutrients up and down the trunk.
When an oak has those characteristics and the other oak-virtues
it will flourish, it will lead the
best kind of life as an oak tree.
So to find out what the best kind of life for a person is, what
human flourishing is, we
must first identify the human ergon, the primary function or
characteristic activity of human
beings. Aristotle thought that rational self-regulation is the
human ergon, is what marks humans
off from all other things in the universe. What is characteristic,
unique, about humans is our
capacity to use our reasoning abilities to make decision about
how to act and then to act on those
decisions. If that is our function, then we have an immediate
answer to the question of what
human excellence is: Human excellence is using reason well in
decision-making. To flourish as
a human being is to engage in actions that are guided by
excellent rational decision-making.
In order to flourish as a human being, that is, in order to
perform the human function
well, a person must acquire those characteristics that enable
someone to do well in rational
decision-making. That is, a person must acquire the human
virtues. The natural question, then,
16. 6
is “What then are the virtues a person needs to acquire in order
to flourish?”. Since the human
function is to use reason well in decision-making, Aristotle says
we can identify the human
virtues, the characteristics that enable excellent rational
decision making, by looking at the
nature of the mind in order to identify our rational capacities.
Aristotle thought that the mind is
composed of two parts relevant for our question.1 There are
two parts of the mind that play a
role in decision-making, what he called “reason” and “the part
that obeys reason”. Reason is the
home of our intellectual capacities for learning, calculating,
imagining, analyzing, inferring,
applying information to specific cases, processing new
information, comparing, generalizing,
intuiting, and the like. The “part that obeys reason” is the home
of emotion, ambition, drive,
mood, inclination, will, appetites, and desires. Both parts play
a role in decision-making, so we
must learn how to control and use both parts well. The virtues
are characteristics we can acquire
that enable us to control and use those parts of the mind well.
So there are two different kinds of
virtue: Intellectual virtues are attributes that enable us to best
use and control our capacities of
reason, and virtues of character are attributes that enable us to
best use and control the capacities
we have for emotion, ambition, willpower, mood, and desire.
Since reason and emotion are very different, the intellectual
virtues and the virtues of
character have very different natures and must be learned in
different ways. Aristotle discusses
17. both in detail, but for the remainder of these notes I am only
going to talk about the virtues of
character.
In a moment I will list some of the Aristotelian virtues of
character. But first let’s look at
what Aristotle says about the nature of this kind of virtue and
how we learn the virtues of
character. The virtues of character are stable states of
character, that is, they are ingrained or
habitual ways of responding to the world when we are called to
make decisions about how to act.
The virtuous person doesn’t have to force themselves to be
courageous or just, they are
courageous or just as a matter of well-established habit. Being
courageous or just is natural for
them because of the way that they have developed their
character. So we can see that to acquire
the virtues is a matter of forming long-standing habitual
responses, and the only way to form
habits is by constant and regular practice. And the practice
required must be directed by
someone who is already virtuous, a “virtue coach” (what
Aristotle calls a “phronimous”, from
the Greek for a person with practical wisdom). After all, we
must practice virtuous acts in order
to form the right habits, and as learners we need to be told
which actions are the virtuous ones we
need to practice. Furthermore, Aristotle points out that even
once we acquire the virtues we must
continue to exercise them in decision-making and acting,
otherwise they will atrophy. So he
says that virtues of character are “preserved by action”. So, for
Aristotle, a “virtuous” person
who does not continually engage in virtuous acts is not actually
virtuous. In some way, being
18. virtuous, then, is a process rather than a single accomplishment
(after which one can “retire”).
The most famous element of Aristotle’s conception of virtue is
often given in the slogan
“virtue is in finding the mean between extremes”; more fully,
we would say that according to
Aristotle, a virtue is always a mean state between a deficient
state of character and an excessive
state of character. We must be careful about what this is not
saying. Aristotle is not saying that
the virtuous person always does a half-way amount of anything
(giving some but not too much to
charity, eating some but not too much cake, being irritated but
never enraged or never passive).
This is not what he has in mind. Rather, here is the idea.
Remember that virtues of character
allow us to regulate our capacity for various emotions and
desires. A virtuous person is able to
1 He thought there is also a third part, the “nutritive mind”, that
is responsible for our biological functioning.
However, since we do not have conscious control over that part
of the mind he does not defined virtues for it.
7
use the entire range of a capacity, feeling and acting with the
appropriate amount for the
circumstances, whatever that amount may be. Sometimes it is
appropriate to have no cake at all,
sometimes appropriate to have one slice but no more, and
sometimes (presumably rarely)
appropriate to go crazy and have three. The virtuous person is
19. the person who has the full range
of the capacity at their disposal, and can feel or desire and then
act with the appropriate amount
for the situation. Aristotle describes such a person as having
the mean or middle state of
character. However, there are people who are unable to use the
entire range of their capacity.
Some people have a deficient state of character, so they are
never able to use their capacity or
can only use it to a small extent. Others have an excessive state
of character, which means that in
all cases they use their capacity at maximum strength, whether
that is appropriate or not.
For example, consider our capacity to feel fear. Some people
have a deficient state of
character with regard to that capacity. They are people who
never feel fear (are unable to feel
fear), or are only able to feel a twinge or fearfulness in certain
situations. We say that such
people are reckless or rash; they have a deficient state of
character with regard to the capacity to
feel fear. So they have the vice of recklessness.2 Other people
have an excessive state of
character with respect to the capacity to feel fear. They are
people who are always fearful no
matter what the circumstance. We say that such people are
cowardly; they have the vice of
cowardice. Other people, however, are able to feel (and then
act on) the appropriate amount of
fear for the situations in which they find themselves. Such
people have a mean state of character
with respect to the capacity to feel fear—they are able to use
their capacity along its entire
dimension, finding the appropriate amount given the
circumstances. Those people have the
20. virtue with respect to fear, the virtue of courage. Or take the
capacity to feel angry. Some
people have the vice of excess with respect to anger. These are
people who are always angry at
everything (they have the vice of wrathfulness, they are “angry
people”). There are people who
have the vice of deficiency with respect to anger, people who
never feel angry no matter what the
provocation or threat or situation. And there are people who
have the virtue for the capacity to
feel anger, the mean state. They are able to feel the appropriate
amount of anger in any given
situation—they have the full range of the capacity to feel anger
at their disposal.
As you can imagine, there are many virtues of character (and
corresponding vices of
deficiency and excess), given the complexity of human
capacities for emotion and appetite and
willfulness and desire. Here is a partial list:
Capacity Deficiency Virtue Excess
Fear Cowardice Courage Recklessness
Anger Lack of Spirit Even Tempered Wrathful, Angry
Pleasure indulgence Insensibility Temperance Self-indulgent
Giving and taking money Miserliness Generosity Prodigality
Self-regard Self humiliating Proper pride Vanity, snobbery
Living well Pettiness Magnificence Vulgarity
Desire for honor Laziness Aspiration Over-ambition
Shame Shamelessness Modesty Bashfulness
Self-disclosure Self-deprecation Truthfulness Boastfulness
Indignation Spitefulness Righteous indig. Envy
Judgement Unprincipled Fairness Partisanship
2 A vice is the opposite of a virtue. So for Aristotle, for each
21. virtue there are two vices, a vice of deficiency and a
vice of excess.
8
Social demeanor Quarrelsome Friendliness Flattery
Sense of humor Boorishness Wittiness Buffoonery
Virtues of character, then, are stable states of character
obtained by practice that forms
habitual responses to life’s circumstances. They allow us to
regulate our capacities for emotion,
desire, appetite, ambition, and willfulness. They are mean
states between two possible vices, a
vice of deficiency and a vice of excess.
A virtuous act is one that is an habitual response that stems
from a virtue of character (we
don’t have to force ourselves to do it, but rather is “in
character”). Aristotle also says that a
virtuous act is one that results from a conscious decision to
perform that act, that is, we must
accept ownership of the action, it must be our choice (if
someone does something unknowingly
or involuntarily we don’t praise their virtue). And, Aristotle
says that we must choose that action
because it is virtuous (and not because we hope to gain or for
some other ulterior motive).
Now we can see what the best sort of life is according to
Aristotle, we can see what it
means to flourish as a human being. Human flourishing (which
Aristotle calls eudaimonia) is a
22. life of activity of reason expressing virtue, that is, a life in
which we use our rational and
emotional capacities in the best ways (so that our actions
“express virtue”) in making decisions
and acting on them. We then excel at being human. This is
sometimes called “self-realization”
or “self-actualization”—we achieve the best of our capacities in
the circumstances of our lives.
We realize our best potential as human beings, actualize our
potential in the best possible ways.
We have then achieved human flourishing, eudaimonia. (The
Greek term ‘eudaimonia’ is
sometimes translated as “happiness”. This is unfortunate,
because the term ‘happiness’ means
many different things to different people, and because human
flourishing is much more than just
being happy, and is certainly not the same as pleasure as we
noted above. Aristotle does think,
though, that the person who flourishes turns out to be, as a by-
product, the happiest person at
least in the sense of contentment and fulfillment.)
In answer to the question “which actions are morally right and
which are morally wrong”,
Aristotle says that the morally right actions are virtuous acts
(and morally wrong acts are those
that stem from vices or ignorance). And Aristotle takes pains to
caution us that we cannot
simply state a set of rules to follow that will tell us, in every
circumstance, what the right and
wrong actions are. This is because life is often very complex;
there are usually too many
variables at play in situations in which we must decide how to
act to allow for a rule that
generalizes over cases—there will always be too many
exceptions for any proposed rule
23. covering more than one particular situation. So how does a
virtuous person know what counts as
the virtuous act in particular situations? Aristotle’s answer is
that once a person acquires the
virtues, that is, becomes a certain kind of person, they begin to
see the world in a certain way.
They become sensitive to the nuances of situations that enable
them to decide, guided by their
habitual responses, what the virtuous thing to do is. Aristotle
tells us that “virtuous action is a
matter of perception”. And this is an intuitive idea. The angry
person sees the world in a certain
way—even an accidental bump is perceived as an insult or
attack. The even-tempered person,
however, sees the world differently, and this enables them to
decide on the virtuous act.
Chapter 8: Ethics of Relationship
Relationships (with other people, with non-human animals, and
with, our ecological
relationships) are often thought of as valuable, sometimes of
paramount value. And being in
various relationships helps us learn about caring and
compassion, which in turn can help
9
determine what we ought to do, how we ought to live, how we
ought to treat others, and how we
ought to structure our society.
Here we consider the fact that all people are bound to others in
24. many different ways
(even the hermit, however indirectly), and then ask what the
moral significance of those
relationships is. We notice immediately that care and
compassion are fundamental to nurturing
relationships with others, so we can ask what care and
compassion for others would require when
answering moral questions. After all, we often say that our
treatment of others (and ourselves)
should be caring and compassionate, and that failing to be
caring and compassionate is a moral
failing. Again, of course, there are many different conceptions
of what care and compassion are
and of what they require in actual decision-making in specific
cases. So think about what care
and compassion would look like in concrete terms in the
complex situations of actual life.
In your reading in Weston, focus particularly on the moral
perspective of Care Ethics (pp. 245-
257). Care Ethics is perhaps the most difficult of our four
perspectives to understand in concrete,
practical terms. Both Kant and Utilitarianism give a rule to
follow for making decisions (and
Libertarianism does as well). The rules themselves may be
somewhat difficult to decode and
execute, but at least we have a single rule to apply to every case
in which we need to know what
is morally required and morally permitted. Aristotle does not
give us a rule, but he does present
a detailed conception of the best life as well as a clear plan for
developing the virtues necessary
to achieve it (along with a detailed list of virtues). Care Ethics
has none of these features, neither
a rule nor a fixed conception of the good life.
Rather, Care Ethics says that the lessons we learn from being in
25. nurturing relationships
with others should form our moral guidebook. So when I ask
"what should I do?" we find an
answer by asking "what would be the best way to care for and
nurture those effected by my
actions?"; another way to put it is that we must seek to express
care and compassion towards
others. This applies also to questions of government policy and
law: what would best express
care and compassion for those that would be impacted? Care
ethics also asks us to recognize our
interdependence with others--our lives are deeply connected and
inter-twined with the lives of
others, so that imposes certain responsibilities to care for others
and certain limitations on our
individual freedoms. What those responsibilities and
limitations are must be determined in
particular cases (much as in virtue ethics): By being sensitive
to others, and perceptive, and
having developed a sense of caring or compassion, we will be
able to understand through
empathy what our responsibilities to others are. So a big
challenge in using Care Ethics in
concrete particular cases will be to figure out what precisely the
demands of care and
compassion are. Another challenge is to figure out what the
precise nature of our connectedness
to others is in actual cases.
And Care Ethics faces two further challenges. First, Care
Ethics says that we should
model our moral thinking on the nature of nurturing
relationships in the context of family. This
raises the worry that Care Ethics is too parochial, too focused
on our family group or social
group, to serve as a moral theory about how we should treat
26. others. After all, most of us would
do things for friends and family that we would not do for others,
for strangers. But this may
have worrisome moral implications if we think that, at least in
some cases, we must care for
strangers as well, even at the expense of friends or family or
ourselves. Consider governmental
policy decisions—there we must think of the society as a whole
in the long-term. Or consider
the law; a judge must be impartial. Or consider our obligations
to nature (if indeed we have
any)—some will say we must not use nature just to further the
immediate needs of our family or
small social group. Second, Care Ethics puts emotion and
emotional connections with others at
10
the center of moral decision-making. We must rely on our
emotional connections with others as
a guide.3 But emotions can be capricious, inappropriate, and
highly variable across situations
and time. This is one reason that Kant counsels us not to rely
on emotion as a moral guide; in
essence, the worry is that I should not treat someone well or
badly just because I happen to feel
like it. So understanding Care Ethics requires us to also learn
how Care Ethics might
accommodate these worries.
3 This may seem similar to Aristotle’s theory at first, but
remember that Aristotle thinks we must use reason to
27. “control” the emotions. That is the function of the virtues of
character. So for him, in some sense, reason “comes
first” and must be used to shape and control emotion.
Week One Instructor’s Notes
Welcome to the study of ethics. Be sure that you are familiar
with all the course
documentation that has been posted to our D2L site. You will
be held responsible to
conduct yourself in exact accordance with all course
instructions and policies.
In these Instructor’s Notes for the first week I want to help
orient you in the
subject you are going to study. So first I give a description of
what ethics, also known as
“moral philosophy”, is all about. Then I will briefly say
something about how ethics is
pursued from a philosophical perspective, the methodology of
ethics.
What Ethics is All About
The branch of philosophy called Moral Philosophy (also called
Ethics) can be
divided into two sub-branches, metaethics and normative ethics.
In metaethics we address two kinds of question. First, we
attempt to define the
28. terminology that is commonly used in discussions about ethics,
discussions about what
we ought to do, what policies we ought to devise, how we ought
to treat others. Terms
like ‘morally right’, ‘human rights’, ‘obligation’, ‘virtue’,
‘empathy’, ‘fair’, ‘democratic’,
‘well-being’, ‘justice’, ‘benevolence’, ‘care’, ‘informed
consent’ ‘autonomy’, and so
forth are common in ethical discussions. Part of the job of
metaethics is to attempt to
define these terms, and again, the job of definition is
extraordinarily difficult. Each of
these concepts is complex, and there is disagreement over how
each is to be correctly
defined. For example, there are many different kinds of human
right; some rights
(“general rights”) are said to be enjoyed by everyone (such as
the right to life), while
other rights (“specific rights”) are said to be enjoyed only by
those with certain
characteristics (for example, only those who are eighteen or
older have the right to vote).
Some rights are rights to have something (“positive rights”, like
a right to basic nutrition),
while other rights are rights to not be interfered with (“negative
rights”, like the right to
freedom of expression). And what does it mean, exactly, to say
that someone has a right
to something? This appears to be a complex characteristic
involving obligations on the
part of others. Further, we of course must ask “what rights do
people have?”. The Bill of
Rights gives one sort of answer to this question, while the
Universal Declaration of
Human Rights gives another. Other terms, like ‘justice’ and
29. ‘virtue’, are even more
complex, even more difficult to define.
The second job of metaethics is to attempt to answer the
question “are any moral
rules or claims or judgments true, and if so, how can we prove
that they are true, how can
we justify them?”. We are asking here the age-old and
controversial question of whether
there are any moral truths, whether there are any moral facts, or
whether morality is
simply a matter of convention or opinion or personal taste. If I
say “Marva should not
steal from the corner store”, I have made a claim about what is
morally right; is my claim
true, is it a fact that stealing from the corner store is wrong?
And if so, how could I prove
that what Marva is doing is wrong? There do not seem to be
any scientific experiments I
can perform or mathematical proofs I can give to show that
what Marva is doing is
wrong. In answering this question, philosophers divide into two
camps: on the one hand
are the moral realists and on the other are the moral anti -
realists. Moral realists make
three claims: (i) there are moral facts or truths, (ii) these facts
or truths are independent
2
of anyone’s opinions or beliefs, and (iii) we know some of these
facts or truths.1 So the
moral realists think that there is a moral order to the universe,
that there are truths or
30. morality; it is either right or wrong, in fact, to steal from the
corner store or to invade Iraq
or to euthanize the incurably sick. Moreover, these truths of
morality have nothing to do
with people at any given time think the truths or morality are.
The moral facts are like
physical or mathematical facts—it does not matter what
people’s opinions or beliefs
about those facts are. Even though many people believed at one
time that the earth was
flat, they were simply wrong. The earth, then as now, was
roughly a spheroid, no matter
what people’s opinions happened to be. Someone may not
believe that -1+1=0, but they
would just be wrong about the facts; the sum of -1 and 1 is not
dependent on anyone’s
beliefs or opinions about what that sum is. The moral realists
say that morality is the
same; there are right and wrong answers to moral questions,
questions about how to live
and how to treat others, and those answers do not depend in any
way upon what people
happen to believe the answers to those questions are; people can
be mistaken about what
the correct answer to a moral question is. Moral realism is a
popular view about
morality; many people seem to believe that moral discussions
have a point, and that there
is a correct answer to most moral questions. Many people seem
to think that capital
punishment and abortion are either right or wrong, and it is our
duty to find out which.
Moral antirealism, on the other hand, comes in may different
forms depending
upon which of the three components of moral realism is denied.
31. And each form of
antirealism is also quite popular. For example, one form of
moral antirealism called
moral skepticism denies claim (iii) of the moral realist. The
moral skeptic says that we
can never have adequate justification for any moral claim (or
rule or judgment), and so
we have no moral knowledge. The moral skeptic leaves open
the possibility that there
are moral facts or truths, but just denies that we can ever know
what any of those moral
facts might be.
Another form of moral antirealism, moral relativism, accepts
the realist’s claims
(i) and (iii), but denies (ii). The moral relativist says that there
are indeed moral truths,
but those truths are dependent upon belief. In particular, moral
relativism comes in two
common forms (and there are others as well), individual moral
relativism and cultural
moral relativism. Individual moral relativism says that what is
morally correct (true) for
a person is determined by whatever that person believes is
morally correct (true), that is,
moral truth for a person is relative to their personal beliefs. So
if I believe that stealing is
wrong, then for me it is wrong; but if someone else believes that
stealing is morally
acceptable, then for them stealing is morally acceptable.
Cultural moral relativism says
that what is morally correct for a person is determined by (you
guessed it) that person’s
culture. If stealing from the corner store is acceptable in a
person’s culture, then it is
morally acceptable for that person to steal from the corner
32. store.2
1 For readings on moral realism and anti-realism, see G. Sayre-
McCord, ed., Essays on
Moral Realism.
2 Clever arguments have been given in favor of both forms of
relativism, but both forms
of relativism also suffer from severe conceptual difficulties. In
the case of individual
relativism, we wonder about the status of the claim “what is
morally correct for an
individual is determined by their beliefs”; is that itself a moral
claim? If so, relativism is
somehow self-defeating, for if that claim is itself a moral claim,
then it is only true for
3
Other forms of moral antirealism include expressivism and
moral nihilism.
Expressivism is a denial of (i); the expressivist says that moral
statements are just
expressions of emotion, and so are not true or false. Saying that
“Marva ought not steal
from the corner store” is just to say something like “Marva’s
stealing, YUCK” or “Boo
on Marva’s stealing”. (When I stub my toe and say “Ouch”, my
sentence, ‘Ouch’, is not
true or false but is rather just an expression of feeling). Moral
nihilists also deny (i), but
make the radical claim that all moral language is utterly
meaningless, and when people
are engaged in moral discussions they are doing nothing more
33. than uttering gibberish at
each other. Of course, the nihilist must then explain why this
strange practice of making
meaningless noises at each other has developed in human
societies, and why people
typically take this activity as being so important. Part of the
work of metaethics is to
decide whether moral realism or some form of moral antirealism
is correct.
Normative ethics has the task of figuring out what actually is
morally required,
morally acceptable, and morally wrong. The word ‘normative’
has ‘norm’ as its root; a
norm is a rule for behavior. So the job here is to discover the
correct norms for behavior.
In normative ethics we ask, for example, “how should I treat
others, what obligations do I
have to others”? If I see someone in need and I am able to help,
must I help? And how
much help must I give? If I see someone collapse, is it morally
acceptable for me to
simply walk right by? Must I give ten percent of my income to
help those in need? And
what do I do if my obligations to others conflict? For example,
sometimes my
obligations to my family conflict with my obligations to my
friends. Which obligations
should take precedence? What should I do if my obligations to
family conflict with my
obligations to country? Because it also seems that people can
have obligations to
themselves, normative ethics also asks what my obligations to
my self are. We are
inclined to say that someone who spends all day every day
watching infomercials, eating
34. only Dorritos, and drinking whiskey with one hand and shooting
up heroin with the other,
is someone who has a character flaw, a moral flaw, because they
are not fulfilling their
obligations to themselves.
Not all philosophers who work in normative ethics think that we
will never be
able to state exceptionless rules for moral behavior because the
variables that determine
morally right action in particular cases are so complex that no
rule we can formulate in
advance will be correct in all cases. Aristotle is an example of
such a philosopher.3
someone who believes it; if someone does not believe it, but
rather endorses moral
realism, then it seems that for them morality is not relative to
what they happen to
believe. In the case of cultural relativism, there is a great deal
of conceptual work that
has to be done before we can even begin to understand what the
cultural relativist is
saying exactly. We must know what it means for a moral rule
or claim to be “accepted in
a culture”. What exactly is a culture, and how do cultures
determine a moral code?
What happens if a culture’s moral code is inconsistent, that is,
says contrary things about
a particular moral question? It seems that cultures are often
inconsistent in just this way.
How do we determine what a person’s cultural affiliation is?
And can a person be a
member of more than one culture? If so, what if the moral
codes of those cultures
35. conflict?
3 His great work on normative ethics is the Nicomachean
Ethics; the translation by T.
Irwin available from Hackett publishers is excellent.
4
Aristotle believed that the job of normative ethics was not to
find rules for morally
correct behavior, but rather to discover what a person ought to
seek in life, what he called
“the highest good”. Normative ethics, for Aristotle, was the
study of how to live the best
life, what the best thing to seek in life is. He thought that the
highest good was what he
called eudaimonia, which means something like “flourishing as
a human being”. So the
study of normative ethics is the study of what it means to
flourish as a person, what it
means to be an excellent example of the species. For Aristotle,
flourishing as a human
being involves becoming a virtuous person; so part of the work
of normative ethics is to
say what the virtues are and to determine how they can be
acquired.
In normative ethics we also tackle moral questions that arise in
particular kinds of
context. For example, in medical ethics we consider moral
questions that arise in health
care: for example, is euthanasia morally acceptable, at least in
certain kinds of case?,
must a doctor inform their patient of all relevant information
about their case, even if
36. doing so will have an adverse effect on the patient’s health?, is
basic health care a general
human right?. In environmental ethics we consider questions
concerning our moral
obligations to the non-human environment: must human
communities fit more closely
with nature?, may we eat meat?, may we use non-human animals
for medical
experimentation?, do we owe any obligation to future
generations to conserve vital
resources?, should forests be preserved?, and other such
questions. In political
philosophy we consider questions about the proper nature of
government and the limits
of government authority (is democracy the most fair form of
government?, is a
proportional parliamentary system the most just form of
democracy?, to what extent
should government regulate economic activity?, when is it
morally acceptable to declare
war?, is a flat tax more just than a progressive tax system?, is
civil disobedience morally
legitimate?, should personal wealth be limited to aid the poor?).
We also consider
questions of legal theory in political philosophy (sometimes
called philosophy of law),
for example, should guilt be determined by jury?, what limits
should be observed by
agents of the state during investigations?, is it appropriate for
investigators to lie to
suspects they are interrogating?, should torture be used in
interrogation?, is capital
punishment morally acceptable?, and so forth.
An example of an argument from normative ethics is an
argument devised by the
37. Libertarian philosopher John Hospers, an argument designed to
prove that everyone has a
right to own private property. We often take this for granted,
but we should always try to
find good reason for our beliefs. Moreover, there are some who
have claimed that private
property is a form of theft and ought to be abolished, and many
more who claim that the
right to property ought to be severely limited in many kinds of
circumstance. So having
an argument to establish a right to private property will help us
see what sorts of limits on
property ownership might make moral sense. Here is Hospers’
argument:
(1) Everyone has the right to live as they choose, compatibly
with the
same right of everyone else. (the Libertarian Principle)
(2) In order to exercise my right to live as I choose I wi ll need
to own the
tools to do so, I will need some private property.
(3) Everyone has a right to whatever is necessary in order to
exercise any
rights that they have.
Thus, everyone has a right to private property.
5
The first premise is the basis of the Libertarian theory of
morality, we can call this the
Libertarian Principle. The idea is that since no person owns
38. another, we all have the right
to live according to our own decisions, as long as we do not
interfere with anyone else’s
decisions about how to live their lives. This is why Libertarians
oppose taxation, seat
belt laws, and drug regulations. Premise (2) points out that if I
am going to live
according to my choices, I will need ready access to the tools
necessary to do that. For
example, if I choose to go to school, I need to own some books,
a pen, and some paper. I
could not be successful in school if anyone could simply use my
books whenever they
wanted; often I would not be able to read the book when I
needed to. By owning the
book I am ensured that when I need to read it, in order to live in
accord with my choice to
study, I will be able to read it. Premise (3) makes the claim that
if there is something
necessary for me to enjoy a right that I have, I must have a right
to that which is
necessary. Otherwise, there is no real sense in which I have the
first right. For example,
in order to exercise my right to freedom of expression, it is
necessary that I be able to
appear in public without my mouth being gagged. So if I really
have the right to freedom
of expression, I must also have the right to appear in public
without my mouth being
gagged.
The premises of this argument are certainly attractive, and the
conclusion does
seem to follow from those premises. But certainly there are
objections that can be made
if we think carefully and creatively enough. As an exercise,
39. construct a couple of
objections to the Libertarian argument.
Methodology of Ethics
We address the questions of metaethics and normative ethics in
the following
manner. First, we state an answer to the question at hand, being
sure to give working
definitions for those terms in the answer that are complex,
controversial, or ambiguous.
We then must state an argument that supports the answer. That
is, we must give reasons
that will prove that our answer is correct. The reasons given in
an argument are called its
premises. The example above concerning the Libertarian view
of property rights is an
argument offered to support the conclusion that everyone has a
right to private property
(perhaps offered in answer to the question “is private property
morally permissible?”).
Claims (1), (2) and (3) are the premises of that argument. A
philosophical approach to
ethics is thus a reasoned or principled approach in which we try
to identify those general
moral reasons or principles that show that our moral
conclusions are correct.
Once an argument has been offered for a moral position, it will
be our job to ask
two questions. First, we will ask what insights, what truths are
expressed in the
argument. Even when we disagree with its conclusion or one or
40. more of its premises,
when an argument has been carefully presented there are usually
helpful insights and
moral truths expressed in the premises and conclusion. Our
first job is always to ask
what those truths are. Second, we attempt to construct
objections to the argument, even
when we agree with the premises and the conclusion. There are
two kinds of objection
that can be made to an argument. On the one hand, we may
object that one or more of
the premises is false. On the other hand, we may object that the
conclusion would not
follow from the premises even if the premises were all true, that
is, we might object that
the argument is invalid.
6
After objection, the discussion continues, by answering
objections and proposing
new arguments and conclusions.
Course Structure
Our focus this term will be normative ethics (although in the
last week of the term
we will do some reading on questions of metaethics). And we
will approach questions of
normative ethics from the perspective of four different
conceptions of what is valuable or
morally significant. Chapter 4 of the Weston text explains how
this approach will work,
41. and then Chapters 5, 6, 7, and 8 explain each of the four
different value perspectives in
detail. Then we will learn some tools for seeing how to best
apply those different
perspectives to actual moral questions that we face; that is the
subject of Chapters 9
through 14 of Weston (of which we will read most though not
all). Finally, we will see
how different philosophers apply different values to actual
moral questions, and everyone
will get exercise in applying the different values as they see fit
in those same cases; that
is the subject of Parts 1, 2, and 3 of the George text. Part 4 of
George discusses various
questions in metaethics. So in summary, you will (a) learn
about four different moral
perspectives, (b) learn strategies for applying those perspectives
to actual moral
questions, and (c) apply those perspectives to actual moral
questions as part of a dialogue
with professional philosophers.
1
EXAMINATION INSTRUCTIONS
PHIL 1103 Summer
There are two examinations given during the term. The due
dates for the
examinations are given on the Course Calendar. There is an
42. automatic four-day grace
period for the first examination should you wish to make use of
that (note that although
there is no point penalty, submissions made during the grace
period do not qualify for
written commentary). There is no grace period available for the
second examination.
Each examination will consist of four essay questions
concerning the assigned
readings up to that point in the term. Use the Instructor’s
Notes, the textbook readings,
and your work on the weekly Reflection Exercises to formulate
your answers. Be sure to
make good use of the Instructor’s Notes in addition to the
course textbooks. Do not
rely on outside sources. Your answer to each question should
be a minimum of about
two double-spaced pages; please try not to write more than four
pages for each question.
Make use of the checklist for submission at the end of this
document.
You must state each question before giving your answer, and
make it clear
where you are answering each part of each question (for
example, by using headings
like “Question 1 Part 1”).
The examination questions will be available one week before
the due date for
43. each examination. Once you see the examination questions, it
is fine for you to discuss
the questions with others in Discussion. However, be sure that
your write your own
answer; the course policy concerning plagiarism is given in the
Course Syllabus. Your
final answer must be your own work; you may use material from
the course readings, but
you must list the source and page, including the Instructor’s
Notes. Using sources
outside of the course texts and Instructor’s Notes can be risky
because many sources one
finds on the internet are unreliable; so if you used an incorrect
source outside the course
materials your answer would include incorrect information. The
required course
readings, including the Instructor’s Notes, are all you need in
order to be able to answer
the exam questions fully and correctly.
A proper citation is necessary for all direct quotation and for
paraphrase from
any source used (a paraphrase is when you use your own words
to express an idea found
in a source). Course texts, Instructor’s Notes, as well as any
and all outside sources must
be properly cited. A proper citation consists of two elements.
First there must be an in-
text or footnote indication of the source and the page. An in-
text indication will be put in
parentheses directly following the quote or paraphrase, for
example “(Weston p. 35)”. A
Footnote may be formatted as “Weston p. 35”. Second, there
44. must be a list of works
cited at the end of your examination; this list must include the
author (if known), the title,
and a URL if applicable. These are the only requirements for
citation formatting; if you
want you may use enhanced formatting if you are familiar with
APA or MLA citation
formatting, but this is not required.
Failure to give a proper citation is plagiarism; be sure you
understand policy in
the Course Syllabus concerning consequences of plagiarism.
Your submission will be
2
examined by Normandale’s sophisticated suite of plagiarism
detection software platforms
and compared with very large databases (which include previous
submissions to this and
other colleges and universities, material submitted by other
students, as well as internet,
electronic, and print sources). Use of materials without proper
citations is plagiarism,
and all instances of plagiarism detected will be permanently
documented as part of your
course record and will be subject to the penalties described in
the Course Syllabus. That
permanent documentation may also be forwarded to the Dean of
Students.
Aim for clarity and detail in your answers. You should be as
detailed as
45. possible in your answers; imagine having to explain your
answer very carefully to
someone who is not quite understanding. Be sure to dig into the
terminology you are
using. For example, when talking about “well-being” it is
important to notice that there
are different kinds of well-being (economic, physical,
emotional, social) and that there is
a difference between long-term and short-term well-being. One
or two sentences is never
enough to explain in detail. A checklist for writing strong
answers appears at the end of
this document.
If you submit your first examination before the grace period you
will receive an
examination report with written commentary after I evaluate
your exam; use the Exam
Report Instructions and Grading Codes document (found under
Content->Instructions) to
interpret your examination report and to help you write stronger
exams in future. Your
exam report will be left as Feedback in the Assignments
submission folder where you
submitted your examination. It will include your grade for the
assignment, Overall
Feedback, and Inline Feedback (if you qualify). In the
Assignments folder where you
submitted your exam, find the “Feedback” column and click
“Unread”. You will
automatically see your Overall Feedback, but be sure to also
click on “View Inline
Feedback” to see my comments in your text. If you submit your
46. first examination during
the grace period your examination report will only include
inline feedback with point
values for each part of each question. There is no grace period
for the second
examination.
Your examination must be prepared as a Word document or pdf
file.
Your name must appear at the top of your examination.
Before giving your answer you must state each question.
You must number each answer with the number of the question.
Because
each question has two or three parts, you must use headings to
separate your
answers to different parts of each question.
You must number the pages of your examination and double-
space your
answers.
Your examination must be submitted to the appropriate folder
under
Assignments in D2L. Examinations that are not submitted in
accordance with the
requirements given in this instruction document will not be
accepted. Again, as
stated in the Course Instructions and the Course Syllabus,
correct use of the
required technologies (software, hardware, and internet
connection) is entirely your
responsibility. The due dates and times for each examination
47. are given on the
3
Course Calendar document, as well as the time of the grace
period for the First
Examination.
Checklist for submission
• Clarity: assume that the reader is not understanding, so take
your time and
explain carefully, using examples as part of your explanation.
Use paragraphs to
separate different ideas or elements of your answer. Don’t just
write in a stream
of consciousness—create an outline before you start writing and
carefully
organize your thoughts. And be sure to check your grammar
and spelling.
• Detail: dig into the question and get detailed, drawing
distinctions and examining
the specifics (refer to the tips above).
• Correctness: be sure that your answers conform to what we
find in the
Instructor’s Notes and the Weston text.
• Rely on your own words: a strong answer will be primarily in
your own words,
and whenever you do use a direct quotation be sure to then also
state the idea in
your own words immediately after.
48. • Citations: be sure to use proper citations as described above.
• Be sure to state the entire question before giving your answer
(this is
required).
• Be sure to use headings as described above to separate where
you are
addressing each part of each question.
• Be sure to make use of the Instructor’s Notes in helping
formulate your
answers, as well as the relevant readings in the course
textbooks.
1
COURSE SYLLABUS
PHIL 1103-00, Ethics
First Summer Session 2022
Normandale Community College
MnTC goals 6 and 9; 3 credit hours.
Instructor
Stephen Donaho, Ph.D.
email: [email protected]
Please reach out by email anytime, using your Normandale
student email account.
In order for me to reply you must use your Normandale student
email account.
And check your Normandale student email regularly for
49. messages about our class and
from the College. Your Normandale student email is designated
as an official means of
communication with you. I check email every business day of
the semester except course
holidays (on the weekends email is checked at least once on
Saturdays). Any emails you
send are very important to me and I endeavor to get back to you
within 24 hours or
sooner unless your message is delivered during the weekend or
on a holiday, in which
cases a reply may take longer (though not necessarily).
Office Hours, Meet with me by Zoom Tuesdays 5:30pm-6:30pm
and Wednesdays
10am-noon.
https://minnstate.zoom.us/my/stephendonaho.ncc (Password:
849888)
Required texts
A. Weston, A 21st Century Ethical Toolbox, 4th edition, Oxford
University Press.
A. George, ed., What Should I Do?: Philosophers on the Good,
the Bad, and the
Puzzling, Oxford University Press.
The Weston and George texts are available from the
Normandale bookstore and many
online booksellers. Be sure to get exactly the titles and editions
that I listed here.
Other readings may be assigned in the form of Instructor’s
Notes (available under
Content) and web pages (available under Links). The weekly
instructions will always
specify the texts needed and the reading assignment for each
week.
50. You will also need to use a good online English dictionary
during the term to help you
understand the course readings. I can also recommend the
Stanford Encyclopedia of
Philosophy—available entirely online—as a resource to help
you understand the course
readings. (And of course, I will always be happy to discuss any
of the course materials
with you and try to answer any questions that you may have in
grappling with the ideas
we will be discussing—see the ‘Help’ section below).
How to study and complete assignments
Under Content in D2L you will find a module called
“INSTRUCTIONS”; there you will
find Course Instructions, Examination Instructions, Reflection
Exercise Instructions,
Discussion Instructions, and Moral Analysis Writing
Assignment Instructions. Be sure to
read each of those documents carefully, and then refer back to
them as the course
progresses.
2
Each week of the term you will be given instructions for that
week; follow the
instructions for the week in order each week. Do not fall
behind—you will learn best
and have the best experience if you do each step of the
instructions each week every
week. You are also less likely to be successful and get the best
grade possible if you fall
51. behind and try to cram.
Be sure you know how to use D2L. Help using D2L is available
from several sources on
several platforms, and there is a D2L “demonstration course”
you can access from your
student D2L homepage. The How to Get Tech Help document
lists those options for
getting help using D2L. Problems with your hardware, personal
software, and internet
connection are your personal responsibility. Technical
deficiencies do not excuse any
student from any course requirements. All assignments must be
submitted as MS Word
or pdf documents; assignments not submitted as a MS Word or
pdf document will
not be accepted. All students registered at Normandale have
free access to Microsoft
Office which includes Microsoft Word; you can access your free
account from your
student D2L page.
Course Schedule
Schedules for assignments, topics, and holidays are given in the
Course Calendar
document found under Content.
Expected Work
Weekly reading and reflection: Each week of the term a set of
Weekly Instructions will
be given which will include readings from the course texts.
You will be instructed to
read the texts in a particular way, and then instructed to work
on Reflection Exercises for
that week. Although they are not to be submitted for a grade,
52. write answers for all
reflection exercises each week—this is a crucial step in learning
and creatively engaging
with the problems of Ethics. The Weekly Instructions will at
times also instruct you to
work on upcoming examinations or writing assignments. The
Weekly Instructions for
each week of the term will be available under Content for each
week of the term.
Because you will earn three credits for this course offered over
the short five-week
summer term, the State of Minnesota expects that you will do
quite a bit of work each
week.
Examinations: There will be two examinations during the term.
Each examination will
consist of four essay questions covering the course material up
to that point in the term.
Expect to write two pages for each essay question. The
examination questions will be
available one week before the due date for each examination,
and will be available under
Content. The examination instructions are given in the
Examination Instructions
document under Content->Instructions. Examinations must be
formatted and submitted in
accordance with the examination instructions; examinations that
are not so formatted and
submitted will not be accepted. The examination due dates are
given on the Course
Calendar (as well as dates for a grace period beyond the due
date for the first
examination).
53. 3
Moral Analysis Writing Assignment: You will be given a
writing assignment to work on
beginning in the second week of the term; the assignment will
be due at the end of the
term (the due date is given in the Course Calendar). The
instructions for the writing
assignment are given in the Moral Analysis Writing Assignment
Instructions document
that will be available under Content->Instructions. Your
writing assignment must be
formatted and submitted in accordance with the writing
assignment instructions and this
syllabus; papers that are not so formatted and submitted will not
be accepted. I am happy
to look at a draft of your writing assignment before it is due;
requirements for submitting
a draft for help are given in the Writing Assignment
Instructions and deadlines for the
optional draft is on the Course Calendar. The due date for
writing assignment is given on
the Course Calendar.
Discussion: Weekly participation in discussion is required.
The Discussion Instructions
document is found under Content->Instructions. All
participation in course discussion
must conform to the discussion policies given in the Discussion
Instructions document.
Course Learning Objectives
As a result of doing the work for this class, students will be
54. able to:
Examine, articulate, and apply one’s own ethical view.
Understand and apply core moral concepts (e.g., politics, rights,
obligations,
justice, liberty) to specific issues.
Analyze and reflect upon the ethical dimensions of legal, social,
and scientific
issues.
Identify ways to exercise the rights and responsibilities of
citizenship.
Demonstrate awareness of the scope and variety of works in the
history of moral
thought.
Understand these ethical works as representations of various
historical and social
values.
Articulate informed personal responses to classical and modern
ethical works.
Respond critically to works of ethical analysis and their
applications.
Analyze an ethical claim, understand its assumptions and
evaluate the
consequences that may follow.
Recognize and articulate the value assumptions that underlie
affect decisions,
interpretations, analyses, and evaluations made by oneself and
others.
Use diverse ethical theories and imaginatively generate
alternative moral reasoning that
results in alternative solutions.
55. Help
I am happy to answer questions by email and I hope that
everyone asks questions
whenever they have them, either about the course instructions
or about the course
material. Be sure to ask any questions that come up.
I am also available to meet by Zoom on Tuesdays 5:30pm-
6:30pm and Wednesdays
10am-noon.
https://minnstate.zoom.us/my/stephendonaho.ncc (Password:
849888)
Submission of examinations and the writing assignment
4
• Submissions must be made to the appropriate folder under
Assignments in D2L,
and must be a file in MS Word or pdf. Submission deadlines
are listed in the
Course Calendar (under Content).
• Late submissions of the First Examination are accepted during
the grace period
following the due date and time; the length of the grace period
is given in the
Course Calendar document (found under Content). There is no
point or grade
penalty for submissions made during the grace period but they
do not qualify for
written commentary from the instructor in the First Exam
56. Report. Late
submission after the due date of either the Second Examina tion
or the Moral
Analysis Writing Assignment is not permitted because they are
due on the last
day of the course—you must plan ahead. You should aim to
have finished the
work for the term by the end of the day before the last day of
the term, and I have
structured your work for the last week so as to give you the
space to do that.
• An optional draft of the Moral Analysis Writing Assignment
may be submitted—
this is not required. The submission requirements and
instructions for submitting
a draft are given in the Moral Analysis Writing Assignment
Instructions
document.
• Submissions that do not meet the format requirements are not
accepted (any
format requirements given here and in the Examination
Instructions and Moral
Analysis Writing Assignment Instructions documents found
under Content-
>Instructions).
• It is entirely your personal responsibility to be sure that your
hardware,
software, internet connection, and knowledge of D2L are
sufficient to
participate in this online course. Deficiencies in technology or
technical
knowledge will not excuse any student from course instructions,
requirements, or expectations. Again, for help with technology
57. see the How to
Get Tech Help document found under Content.
Academic honesty
All students are expected to know the academic honesty policy
of the College.
Plagiarism on one assignment will result in the grade F for that
writing assignment or
examination (or ‘not acceptable’ in the case of a discussion
posting), and may result in a
final course grade of F and a report to the Dean of Students.
The College may impose
further penalties. Proper citations must be given for all
material from any source used in
exam essays and the Moral Analysis writing assignment. This
includes both direct
quotation and paraphrase, that is, direct quotations as well as
putting ideas or
information from sources in your own words. Sources include
required course texts and
Instructor’s Notes in addition to any outside source (print,
internet, video, the work of
other students, tutors). Formatting and requirements for proper
citations are described in
the Examination Instructions document and in the Moral
Analysis Writing Assignment
Instructions document (both found under Content-
>Instructions).
Your submissions will be examined by Normandale’s
sophisticated suite of
plagiarism detection software platforms and compared with very
58. large databases (which
include previous submissions to this and other colleges and
universities, material
submitted by other students, material prepared by professional
cheaters, as well as
5
internet, electronic, and print sources). Use of materials
without proper citations is
plagiarism, and all instances of plagiarism detected will be
permanently documented as
part of your course record and will be subject to the penalties
described above. That
permanent documentation may also be forwarded to the Dean of
Students.
Grades
Each of the examinations and the writing assignment will be
worth 100 course
points. But as an incentive to improve, the lowest score will be
dropped from the final
course grade calculation. You should aim to do as well as
possible on the First
Examination and then use the comments you will receive to help
you write a stronger
Second Examination and a strong Writing Assignment.
I will check participation in Discussion for randomly selected
weeks during the
term. Following the Discussion Instructions document will
59. result in a grade of
“acceptable” for that week, and not following the discussion
instructions earns the grade
“not acceptable” for that week. Consistently making very
detailed and careful posts that
are relevant and clear during the semester earns ten bonus
points total added to the
second-lowest assignment score (ten bonus points total, not ten
per post).
The final course grade will be determined in the following way.
First, your lowest
assignment score is dropped (from the two examinations and the
Writing Assignment).
Then Discussion participation is checked and the ten-point
bonus, if awarded, is added to
the lowest of those two scores. Then I add those two scores to
determine a raw letter
grade calculated as a percentage of 200 course points, where A
is 100-90%, B is 89-75%,
C is 74-60%, D is 59-50%, and F is below 50%. Finally,
participation in discussion is
checked again; for each “not acceptable” beyond one, the raw
letter grade will be reduced
by one-half letter. This adjusted letter grade will be the final
course grade.
The grade of Incomplete will be assigned only under
extraordinary and
documented circumstances as determined by the instructor;
requests for Incomplete must
be made in writing before the second to last day of the
semester; generally speaking,
requests for the grade Incomple te will not be granted.
Automatic Grade of NW for Nonparticipation: College policy
requires that any
60. student that is inactive in a course for more than two weeks
must be assigned the
semester final course grade of NW. After that grade is assigned
there is no further D2L
access to the course as NW is the final course grade for the
semester. And those who
receive that grade will not be permitted to continue in the
course past that point even if a
request to do so is made (given that too much material has been
missed).
Important Notices
Information in this syllabus and other course documents is
subject to alteration and
amendment during the term; all alterations and amendments will
be announced on
the course D2L site. All students enrolled in this course will be
held responsible to
know the information in this syllabus, the information in all
other course instruction
and policy documents, and all alterations and amendments
announced under
Announcements or in updated course documents.
6
Normandale Community College is committed to providing
equal access for
students with disabilities through the services provided by the
Office for Students
with Disabilities (OSD). If you have an educational need
because of a disability,
61. please make an appointment for an intake/interview to discuss
these needs so that
appropriate accommodations can be implemented for your
Normandale courses.
Appointments can be made by calling the OSD staff at 952-358-
8625, emailing
[email protected], or stopping by the L2751 office. This
syllabus is available in
alternate formats upon request.
Instructor’s professional biography
Stephen Donaho holds the B.A. with honors in Philosophy from
the State University of
New York, and the M.A. and Ph.D. in Philosophy from the
University of Minnesota. His
doctoral research was on applications of logic in the study of
the semantics of natural
languages. He has taught in the philosophy departments at the
University of Minnesota,
the University of St. Thomas, Metropolitan State University,
Concordia College-New
York (where he also held an appointment as Associate Professor
of Liberal Studies), and
is presently a tenured member of the Department of Philosophy
at Normandale
Community College. He is also a Resident Fellow of the Center
for Philosophy of
Science at the University of Minnesota. He has delivered
lectures at the University of
Minnesota-Twin Cities, the University of Minnesota-Duluth,
Mankato State University,
Loyola-Marymount University, Canisius College, and Brooklyn
College-City University
of New York, as well as before the Minnesota Philosophical
Society and the American
62. Philosophical Association. His papers have appeared in Mind
and The Journal of
Philosophical Logic.
SECOND EXAMINATION
PHIL 1103, Summer
You must complete the examination in accordance with the
Examination
Instructions (available under Content->Instructions).
Examinations that do not
comply with those instructions and all course formatting and
submission
requirements will not be accepted.
Be sure to give proper citations for all of your sources.
Be sure to answer each part of each question; it is best to
include headings in your
answer like “Question 1, Part 1” so that I can clearly see where
you are addressing
each part of each question.
Be sure to use the Instructor’s Notes to help you write your
answers.
Question One
First describe four important differences between the Utilitarian
63. moral
perspective and Kant’s moral perspective. Second, describe a
situation in which the
Utilitarian and the Kantian moral perspectives result in
opposing moral requirements.
Question Two
First describe four important differences between the
Aristotelian virtue
perspective and the Ethics of Care on moral questions. Second,
describe a situation in
which the Aristotle’s perspective and the Ethics of Care result
in opposing moral
requirements.
Question Three
First explain how Utilitarianism might conflict with Aristotle’s
virtue
perspective. Second, explain how Kant’s moral perspective
might conflict with the
Ethics of Care.
Question Four
Ethical Hedonism is the view that one always ought to act so as
to maximize
their own personal pleasure. First explain why Utilitarianism,
the Kantian perspective,
Aristotle’s virtue perspective, and the Ethics of Care all
disagree with Ethical Hedonism.
Second, explain how each of those four perspectives can allow
for personal pleasure to