Recommended
Recommended
More Related Content
Similar to #include iostream The library of IO functions#include fstr.docx
Similar to #include iostream The library of IO functions#include fstr.docx (20)
More from katherncarlyle
More from katherncarlyle (20)
Recently uploaded
Recently uploaded (20)
#include iostream The library of IO functions#include fstr.docx
- 1. #include <iostream> //The library of IO functions #include <fstream> //The library of external stream functions #include <cstdlib> //The library for external errors #include <string> //The library for string functions #include <cmath> //The library of C math functions #include <stdlib.h> #include <stdio.h> #include <iomanip> #include <vector> using namespace std; int main(){ ifstream fin; string filename = "file.txt";
- 2. fin.open(filename); char letter; string line; vector<string> str; vector<string> ::iterator ptr; string sub1; string sub01; string sub2; string sub02; while (!fin.eof()){
- 3. getline(fin, line); //getline()(fin, line); //line.push_back(letter); if (line.length() >= 6){ str.push_back(line); for (int i = 0; i != str.size(); i++){ // cout << str.at(i) << endl; sub1 = str.at(i); sub01 = sub1.substr(0, 5);
- 4. for (int j = 1; j = str.size(); j++){ sub2 = str.at(j); sub02 = sub2.substr(0, 5); } if (sub01 == sub02 ){ cout << "true"; } } // end out if }
- 5. } fin.close(); system("pause"); } World Historical Marker Commission of TSU Public history is any type of history that is directed at the general public (that is, NOT something done mainly for students and teachers in the history classroom). Historical markers are a form of public history that just about everyone has seen
- 6. sometime, somewhere (there are several on the TSU campus). As a class project, we will be posting our own historical markers in the hallways of Crouch Hall. To facilitate this project, we will work as the World Historical Marker Commission of TSU. The director is Dr. Elizabeth Dachowski, and each student in HIST 1210 will earn course credit by working as researcher/author, fact- checker, and editor of the markers. RESEARCHERS/AUTHORS will look up information in appropriate peer- reviewed reference works as defined in the Historical Marker assignment and present the information in historical marker format with an emphasis on historical relevance and interest to the public. Researchers/authors will see revisions before the markers are posted and will have the option of having markers posted anonymously or with credit. FACT CHECKERS AND EDITORS will double-check the factual information on the marker for accuracy using appropriate sources and will make
- 7. corrections/suggestions on matters of grammar, style, organization, clarity, and overall impact of the marker (does it "grab" the reader?). Fact checkers and editors will not edit their own markers. The DIRECTOR will oversee all aspects of the production process and provide guidance to researchers/authors and fact checkers/editors. The director will read all markers, oversee fact-checking and editing, assign points to all participants as appropriate, make the final selection of markers to be posted, and print/post completed markers. Each student in HIST 1210 (as a member of the World Historical Marker Commission) is responsible for handing in three markers by the deadline and acting as fact-checker and editor to three additional markers (researched and written by other students). For more information on public history and historical markers:
- 8. National Council on Public History, "What is Public History?" http://ncph.org/cms/what-is-public-history/ Historical Marker Database. http://www.hmdb.org/ Assignment Write three historical markers (one for each major period covered by the course). Upload your marker into the D2L (elearn) dropbox for the assignment. Due dates and topics are indicated below. You have been given the job of writing a historical marker for a significant place in world history. Compose a text (entirely in your own words) that is historically accurate, full of interesting detail, grammatically correct, and no longer than 150 words. The focus of your marker should be on the time period covered in the course (before 1500 CE and as indicated in the assignment). Your historical marker assignment should include the following sections: (1) Text of the marker. Required elements are a brief description of the
- 9. historical site/object (remember that marker readers are generally able to see the site, so keep this to a sentence and/or focus on things not necessarily visible), historical context (what was going on in that place generally, such as religious movement, establishment of an empire, etc.), specific historical details relevant to the site, and historical significance. Put information entirely in your own words. Try to avoid quotations since the marker format doesn't facilitate giving citations, EXCEPT you are encouraged to quote briefly from primary sources if relevant (and you must, of course, clearly identify the sources). Remember to stick to the 150-word limit. (2) Full citation (Chicago Manual of Style) of all sources used. You must use at least one article (minimum 200 words) in the collection Oxford Reference Online Premium (available on the eBooks page of the TSU library; password required for off-campus access); you may also use your textbook (give full citation of book and cite specific chapter and page numbers). If you wish to use any other sources, you
- 10. must get written permission from the instructor (email [email protected]) at least 48 hours before the assignment is due and attach a copy of your correspondence to the assignment. Your fact-checker and the director will be looking to make sure that the information you include is supported by your sources, so include in the text of the marker ONLY information that you found in your sources and include in the citation section ALL sources used. If there is a disconnect between sources cited and the information in the marker text, you will be severely penalized. Your editor and the director will be looking to make sure that the form of the citation is correct. (3) Process paragraph: This should be a brief discussion of the choices that you made in deciding what to include in the marker text. Things to include might be your decision to leave out some information (not enough room on the marker), you decision to include other information, things that you wanted to add but couldn't find information about (for example, if you wanted to give the population
- 11. of a city but couldn't get that info), and any surprises along the way (either good or bad surprises; for example, there was a name that could be spelled several different ways, which made looking it up difficult, or if you found out something cool you didn't know before or if your sources gave seemingly contradictory information). You will be graded on content (providing insight into how you worked) and writing (paragraph structure, grammar and style). Grading will be as follows: Each marker will be worth 10% of your final grade and will be graded on a 10-point scale. The text of the marker will be worth 4 points, the citations 3 points, and the process paragraph 3 points. Late markers will be penalized a point a day up to a maximum deduction of 5 points out of 10. Your participation grade will be based on your being a good team player in this assignment. To gain full credit you must (1) hand in all markers to the correct Dropbox and post them on the correct Discussion Board by the
- 12. deadline (otherwise the editors and fact-checkers can't get to work), (2) complete your fact-checking and editing on time, and (3) comment on and/or accept suggested revisions to your own marker. Participating in fact-checking and editing will be worth 10% of your final grade. To receive full credit, you must post your own marker to the discussion board and do a fair and honest job with the markers of other students, and complete both of these tasks in a timely manner. You will receive a 1-point extra-credit bonus for each marker which is approved for posting (maximum of 3 extra credit points for the semester). First Marker (choose ONE and focus on the period before 500 BCE) Marker due: February 11. Fact-checking and editing due: February 18. Revisions due: February 22. Chauvet caves (focus on pre-historic info, NOT on modern rediscovery) Speos Artemidos (hint: Beni Hasan, Hatshepsut)
- 13. Etemenanki (ziggurat of Marduk at Babylon=Tower of Babel?) Knossos, Crete (focus on palace complex) Harappa Teopantecuanitlán (hint: Mesoamerica; early formative period) Second Marker (choose ONE and focus on the period 500 BCE to 500 CE) Marker due: March 23. Fact-checking and editing due: March 30. Revisions due: April 2. Meroë Hadrian’s Wall Tomb of Shihuangdi Silk Road (focus on period before 500 CE) Palenque (focus on classic period, before 800 CE) Khyber Pass (hint: Alexander the Great and Akbar the Great) Varanasi (or Benares; focus on the period before 500 CE) Third Marker (choose ONE and focus on the period 500-1600 CE) Marker due: March 23. Fact-checking and editing due: March 30. Revisions due: May 3.
- 14. Aachen (Aix-la-Chapelle; city in Germany; hint: Charlemagne) Krak des Chevaliers Templo Mayor of Tenochtitlan Angkor Wat (in Cambodia) Timbuktu (in Mali) Directions for submission of markers 1. Be sure to complete all parts of the assignment (text of marker, citations, process paragraph) and put them in a single file. 2. Save your marker in an appropriate file format (acceptable formats are Word and Rich Text Format). Keep formatting simple (no text boxes, please) and be sure to put your name on the first page of the marker and give your file a meaningful name (for example, author’s last name and first initial followed by a hyphen and the name of the marker: BrownA- Babylon.doc). 3. Upload a complete file to the Dropbox for the marker in eLearn. Be sure to put the marker in the correct folder (misplaced markers will not be graded). 4. Post a copy of your marker to the Discussion board eLearn (ideally, cut/paste the text
- 15. of your marker, your citations, and the process paragraph into a discussion message; you may also attach a file, but remember that this might make it harder for your peers to evaluate your marker). Again, be sure to post to the correct Discussion topic. Directions for fact-checking and editing of markers 1. Go to the appropriate Discussion board in eLearn and choose one marker to fact- check/edit (not your own marker). (Note that ability to read posts on the discussion board will be restricted to those who have uploaded a marker to the Dropbox or made a post with your marker text to the appropriate Discussion board.) 2. Write a message assessing the marker. You MUST address the following in your comments (you may choose to divide these up into separate posts; just be sure that it is clear what you are doing and that you address all information before the deadline for comments): a. Is factual information relevant to marker subject and was essential information included? b. Were appropriate sources cited? (If not, can information not found in cited sources can be verified elsewhere? Note that this does not excuse poor citation practices.)
- 16. c. Can information in the marker be verified from cited sources? (If relevant, are quotations are accurate and correctly attributed?) d. Are spelling and grammar (including punctuation) correct? e. Is writing clear? f. Is organization logical? g. Is style appropriate, engaging, pleasing to read? 6 c g t a a t c
- 18. gtattcaac gtaccat accacata c c a gt tg gt ta cagtat cggtac ttgaca ccacac ttgac tgacg tacgt actga
- 31. actgtgactgactgac catgtgactgcatgactg actgactgactgatg actgtgactgac gat cgg gtt gat ctgact gcgtag tcagtt Description: Computers are used in many different fields, including biology. The study of DNA sequencing makes extensive use of computers to reconstruct DNA genomes for different plants and animals. A popular method for discovering the genome is called “shotgunning.” In shotgunning copies of the entire genome DNA are broken up into smaller pieces and then those smaller pieces are analyzed and reassembled. The base pairs making up the sequence can be matched at the end of two samples and pasted together when they match. Possible base pairs are A, C, G, and T. Suppose we have a DNA sequence of TAGGACTAGCATTAGACCAT and another consisting of
- 32. TAGCATTAGACCATAACCATAGAGA then we can see that the two sequences have an identical sequence consisting of TAGCATTAGACCAT Two subsequences are considered to be part of the same overall sequence if a certain number of base pairs are identical. Let that minimum number be six base pairs. If a match can be made on the minimum number of base pairs in two different fragments, then the fragments can be combined. For example, the two fragments used in the example can be combined into TAGGACTAGCATTAGACCATAACCATAGAGA since the end of the first fragment matches sufficient pairs in the second fragment. Note that the fragments do NOT have to be of the same length, but note that the fragments MUST be of the minimum length for matching to be of use. Smaller pairs are discarded without consideration because they cannot be positively matched. In this machine problem we will reconstruct as much of the DNA sequence as possible from a file of sequenced fragments of DNA. Your program will: 1. Read the filename of a file of sequenced fragments of DNA (use the filename MP2data.bin). 2. Open the data file, read in the minimum number of base pairs required for combining base pairs 3. Read an unspecified number of fragments of varying size 4. Eliminate all fragments that cannot be used for pairing (smaller than the minimum number of base pairs used for combining fragments) 5. Match fragments and reassemble the fragments into larger fragments, where possible 6. Report the results, to include a. The minimum number of pairs for matching b. All remaining pairs after combining c. The original number of fragments in the data file d. The final number of fragments e. The maximum and minimum fragment size, both read in and
- 33. after combining fragments There is a minimum number of base pairs, that when they match, are considered to be matching so that the fragments can be considered to be part of the same area of the full sample sequence The data file will have the format minimum number of base pairs to match fragment … fragment eof Size will be an integer, fragments will be of type string, and the eof will be the system appended eof.