PCR Detection of Leprosy Bacteria Gene in Patient Samples

Tiffany Eisenbach
St. Olaf College, 2/17/15
Biology in South India Program
By
PCR detection of rlep
gene target of
Mycobacterium leprae
from clinical isolates of
leprosy patients and
contacts in a leprosy
endemic area of India

1
TABLE OF CONTENTS
Abstract.........................................................................................................................................................................3
Introduction .................................................................................................................................................................3
Classifications of leprosy .........................................................................................................................................5
Social issues associated with leprosy .....................................................................................................................6
Other major difficulties with the leprosy disease..................................................................................................6
Forms of bacterial detection ...................................................................................................................................8
Purpose ......................................................................................................................................................................8
Materials and Methodology.........................................................................................................................................9
Sample collection ......................................................................................................................................................9
Blood Sample processing ........................................................................................................................................10
DNA Extraction.......................................................................................................................................................10
From blood sample ..............................................................................................................................................10
From slit skin smear sample ................................................................................................................................10
PCR (Polymerase Chain Reaction)..........................................................................................................................10
Gel Electrophoresis..................................................................................................................................................11
Results.........................................................................................................................................................................11
Discussion...................................................................................................................................................................14
Acknowledgements .....................................................................................................................................................16
Literature Cited..........................................................................................................................................................17
Appendix I: Consent form ...........................................................................................................................................20
Appendix II: Gel pictures ............................................................................................................................................23
Appendix III: Detailed laboratory protocol and materials list for rlep PCR amplification of M. Leprae DNA
extracted from blood and slit skin samples .............................................................................................................25
Materials .................................................................................................................................................................25
Sample collection ...............................................................................................................................................25
Blood Sample processing...................................................................................................................................25

2
DNA extraction...................................................................................................................................................25
PCR (Polymerase Chain Reaction)....................................................................................................................25
Gel electrophoresis ............................................................................................................................................26
Methods ...................................................................................................................................................................26
Sample collection ...............................................................................................................................................26
Blood Sample processing...................................................................................................................................26
DNA Extraction...................................................................................................................................................27
PCR (Polymerase Chain Reaction)....................................................................................................................28
Gel Electrophoresis............................................................................................................................................29
Personal Reaction to Project........................................................................................................................................30

3
ABSTRACT
Early detection of leprosy is critical for timely treatments before significant nerve damage
occurs. My goal was to discover whether blood or slit skin smear samples provided the
most reliable diagnostic measure using rlep PCR-based detection. I collected blood samples
from newly diagnosed and untreated leprosy patients, familial contacts, and controls, and
slit skin scrapings from patients and contacts. All 41 samples were collected from cases and
contacts who attended the Schieffelin Institute of Health Research and Leprosy Center at
Karigiri or the Field Clinic in Gudiyatham. Blood cells and serum were separated, and DNA
was extracted from both blood and slit skin smear samples. The rlep gene target was
amplified from the extracted DNA using PCR, and the amplicons were analyzed by gel
electrophoresis with Orange G dye. A UV trans-illuminator was used to visualize the rlep
gene and confirm its presence. More positive results were observed for rlep PCR of slit skin
samples than blood samples from leprosy patients, but sample type did not seem to have
an effect on percent of positive results from rlep PCR for leprosy patient contacts. Although
slit skin smears for PCR are a reliable diagnostic measure, blood samples appear to have a
similar efficacy, especially for patient contacts.
INTRODUCTION
Leprosy has plagued people for millennia, with the Bible recording the disease being
prevalent in the Middle East from the 16th-6th century BCE and the Vedas (composed
during 1500-1000 BCE) recording it in India (Lavania et al. 2012). In fact, leprosy is one of
the oldest diseases known to affect humans (Turankar et al. 2013). As of April 1, 2010,
India had a leprosy prevalence of 6.9/100,000 (Lavania et al. 2012). The World Health
Organization introduced a Multi-Drug Therapy regimen in 1996 that significantly reduced
the number of people with prolonged leprosy infections (Vedithi et al. 2014). Although the
current prevalence rate may seem small, considering that India’s population is over 1
billion, more than 69,000 people in India are still infected. In 2011, more than 100,000 of
the 228,474 leprosy cases reported globally were from India (Vedithi et al. 2014). As of
March 2010, only 510 districts out of 633 in India have achieved leprosy elimination (NLEP
2010), and 11 districts in Chhattisgarh, Gujarat, Maharashtra, West Bengal, Dadra & Nagar
Haveli, Orissa, and Delhi still have an incidence rate of greater than 50 per 100,000 people
(NLEP 2012).
The causative agent of leprosy is the bacterium Mycobacterium leprae. The habitat of choice
for these bacteria is the Schwann cells of peripheral nerves and macrophages of mucous
membranes, because they bind to them and have an elaborate entry mechanism. The
bacteria prefer cooler areas of the body like ears, fingers, and toes (Vedithi et al. 2014).

4
When M. leprae enters the body, it goes into the circulatory system and enters these nerve
cells by crossing the endothelium, basement membranes/neural sheath, and then being
endocytosed by Schwann cells. The first nerve usually attacked is the ulna nerve. A
thickening of the nerve may result, leading to a nerve abscess, although this is infrequent
for the first manifestation of leprosy (Rai et al. 2013). Most often, patches form on the
patient’s body on the forearm or in other cool areas where the bacteria reproduce most
successfully (Cherath and Frey 2006). In fact, the most indicative characteristics used to
diagnose leprosy are hypo-pigmented patches or skin lesions, loss of sensation in this
patch, and a thickening of the sensory nerve serving this area.
Although the mechanism of infection of Mycobacterium leprae is still under investigation, it
is believed that the bacteria secrete a protein that keeps Schwann cells in a dedifferentiated
state, which causes them to lose their normal function leading to neurodegeneration, so
that the patient no longer has adequate nerve sensitivity to determine when too much
stress is placed on a body part (Costandi 2013). This leads to the development of ulcers,
called trophic ulcers, particularly in the hands and feet. Nerve impairment also can produce
disfiguring effects, such as clawing of the hands as the bacteria destroy the motor nerve at
the junction of the wrist and tendons. Other such deformities may also result, and may
become permanent without treatment or tendon transplant surgery. In leprosy’s systemic
form, as M. leprae multiplies, other organs may be infected, including the liver, kidneys,
gonads, bone, and cartilage. Another reason for deformities in leprosy patients is the
disintegration of cartilage, due to undetected extra stress placed on body parts because of
malfunctioning sensory nerves (Singh et al. 2000).
One of the current treatments for leprosy is Multi-Drug Therapy (MDT). MDT involves
Dapsone, a bacteriostatic drug which prevents bacteria from propagating by inhibiting the
biosynthetic pathway for folic acid, a nutrient bacteria require to survive. Dapsone blocks
the activity of an enzyme necessary for this pathway. MDT also includes Rifampicin, which
kills bacteria by inhibiting transcription, and Clofazimine, an anti-inflammatory drug that
controls human inflammations in addition to killing bacteria by enhancing the intracellular
killing ability of phagocytes (Wadee et al. 1988). For paucibacillary forms of the disease
(skin smears at all tested sites are negative for bacteria), a six-month drug regimen is
prescribed, which includes the first two medicines mentioned above. For multibacillary
forms of the disease (skin smears are positive for bacilli at any tested location), a 12-month
drug regimen is required, using all three drugs (WHOb 2014).

5
CLASSIFICATIONS OF LEPROSY
It is possible for a person to be infected with M. leprae but never develop leprosy
symptoms, if they have an adequate immune response to the bacilli – in fact, an estimated
95% of people do have full immunity to the disease (Bennett et al. 2008). In those
individuals who do progress to active disease, the T lymphocytes don’t produce adequate
amounts of cytokines such as interferon-γ, interleukin-10, tumor necrosis factor-α, and
interleukin-1β that act as antibodies against M. leprae (Moubasher et al. 1998). In fact, the
various leprosy disease forms are dictated by the host’s immune response. The two main
forms are tuberculoid pole and lepromatous pole, the latter characterized by a very low
response of the body to the bacteria. The progression of the disease, from greatest immune
response to the bacteria to the smallest immune response, called the RJ classification, is as
follows: Tuberculoid tuberculoid (TT), borderline tuberculoid (BT), borderline borderline
(BB), borderline lepromatous (BL), and lepromatous lepromatous (LL). Indeterminate
leprosy is used to describe a situation in which an initial skin lesion is present, but may
heal on its own. The patient’s immune system response will determine how the disease
progresses if the preliminary lesion fails to heal (Willacy and Tidy 2014).
In order for leprosy to be classified as indeterminate, the dermis remains unchanged, but
subcutaneous tissue contains characteristic changes. With these early lesions, the deep
dermal nerve needs to be biopsied and examined under a microscope for the presence of
lymphocytes, indicating leprosy. In the TT leprosy stage, macrophages have destroyed
some bacilli and the bacilli themselves are not easily seen in microscopic examination of
smears, because the person’s immune response at this stage is effective enough to limit the
number of bacilli (their lymphocytes are producing an effective amount of antibodies). In
BT leprosy patients, fewer lymphocytes (the person’s immune response is not as large) but
more epithelial cells are present at the site of infection than in TT. The dermis is very thin,
and usually the nerve has been partially destroyed by inflammation. Bacilli are typically
more prevalent in this stage.
BB leprosy is characterized by even more prevalent bacilli and even more visible nerve
damage. In this stage, some macrophages harbor bacilli rather than destroying them. The
patient’s immunity is not functioning adequately, with their Cell Mediated Immune
Response (CMI) at only 50% efficiency (only 50% of lymphocytes are functioning
correctly). Thus, around 50% of macrophages remain idle with bacilli in them. This
category includes 10-15% of newly-diagnosed leprosy patients. BL leprosy patients have
more lymphocytes present at the site of infection than BB patients, and more macrophages
than LL patients. The lymphocytes outnumber the macrophages, as the macrophages are
not activated well enough to destroy bacilli (Modlin et al. 1988). The nerves of patients at

6
this stage typically undergo an onion-peel like thickening due to perincurial cell
proliferation (Job 1989). In LL leprosy, there is mild atrophy of a patient’s epidermis, and
many bacilli reside in each ineffective macrophage. When macrophages fill with too many
bacilli, they rupture, releasing more bacilli into the patient’s system. LL is the most serious
form of the disease, and is highly infective. LL patients harbor bacteria in their nasal
chambers and spread them by sneezing. They typically contain bacteria in all of their body
fluids except sweat. Even one bacterium may cause disease, and the disease is very slow to
develop (WHOa 2015).
SOCIAL ISSUES ASSOCIATED WITH LEPROSY
Leprosy, if left untreated for too long, can prove to be both a physically and socially
debilitating disease. Due to the social stigma attached to leprosy, it may be difficult for
family members of leprosy patients to find a spouse or even be hired for a job, for fear that
they are infected as well, which is not an unreasonable concern given the latency of the
disease. It is all the more challenging for leprosy patients themselves to find work, even
when cleared of active bacilli. Unfortunately, many people try to keep far away from those
who have lasting effects of leprosy infection such as deformities, rather than giving them
the love and care that they need, and many post-leprosy patients are forced into begging
and living on the streets. It thus becomes vital that leprosy patients receive an early
diagnosis of their disease to prevent progression into more serious stages that can cause
lifelong physical debilitations and stigma for them and their families. Similarly, family
members deserve the assurance of sensitive testing methods to either catch infections
early or prove that they are not infected.
However, research is still being conducted to determine the most effective diagnostic
method for the early onset of leprosy. Leprosy is a chronic infectious disease with a latent
phase of 3-20 years. It remains silent in the nerves at first, before later multiplying and
causing damage. There is currently no approved early diagnostic test for leprosy before
symptoms (patch formation) begin. Unfortunately, once a patch appears, the disease has
already progressed to an advanced state.
OTHER MAJOR DIFFICULTIES WITH THE LEPROSY DISEASE
Several other characteristics make leprosy a particularly difficult disease to diagnose and
treat. Firstly, the bacterial causative agent, Mycobacterium leprae, cannot be cultured in
vitro, so it is challenging to study. It is a Gram-negative bacterium that is only stained by
acid-fast stains, because its cell wall contains lots of lipids and is consequently too thick for

7
the dark distinctive Gram stains to penetrate. This makes microscopic examination of the
bacteria difficult.
Another perplexing characteristic of leprosy is the still uncertain mechanism of
transmission. Although leprosy is believed to be only mildly contagious, one hypothesis is
that M. leprae is inhaled, and subsequently enters the circulatory system and is carried
throughout the body (Rees and McDougall 1977). Leprosy patients may release bacteria
into the environment through dust particles or airborne droplets by coughing or sneezing
(Turankar et al. 2013). Another possible route includes direct contact with leprosy
patients, including living with them. This is corroborated because people living in
households with leprosy patients are much more likely to subsequently develop the
disease (Lavania et al. 2012). In fact, the risk of leprosy is estimated to be 9 times higher for
people living in households with a leprosy patient and 4 times higher for those living in an
adjacent household, compared to the risk for the general populace (Fine et al. 1997). This
may be because leprosy patients harbor M. leprae even on unbroken skin, according to a
study where 80% of leprosy patients had M. leprae DNA in skin washings (Job et al. 2008).
Mycobacterium leprae may also be contracted from the environment, with humid
conditions favoring the bacteria’s multiplication (Desikan and Sreevasta 1995). Armadillos
and monkeys, inanimate objects, soil, and water have been hypothesized as possible
sources of human infection by M. leprae (Truman et al. 2011), with the latter two having
been proven to harbor slowly-reproducing bacilli (Matsuoka et al. 1999).
Unfortunately, an effective vaccine for leprosy has not yet been developed. Mycobacterium
tuberculi and M. leprae are in the same genus and a vaccine called BCG has been developed
that prevents tuberculosis at a rate of 30%, but only protects from leprosy at a rate of less
than 15%. However, a vaccine development project undertaken by the Infectious Disease
Research Institute and the American Leprosy Missions is currently underway (Science
Development 2014).
Currently, several single nucleotide polymorphisms (SNP’s, which are point mutations in
DNA) encode for genes that provide drug resistance for those M. leprae that contain these
mutations. These include SNP’s in genes that encode for active drug targets like DNA gyrase
(for ofloxacin), RNA polymerase β subunit (for rifampin) and dihydropteroate synthases
(folp) (for Dapsone) (Vedithi et al. 2014). These point mutations change the amino acid
sequence for the proteins they encode for, thus altering structure. This structural variance
disrupts the drug interactions with M. leprae protein drug targets, leading to drug
resistance (Lopez-Roa et al. 2006).

8
FORMS OF BACTERIAL DETECTION
One way to detect the presence of M. leprae in the body is through performing a
Bacteriology Index, which involves scraping off a small amount of skin from an area on the
ear or an infected skin patch and putting the scrapings onto a glass slide to make a smear.
Following acid-fast staining by the Ziehl-Neelsen method, intact M. leprae cells are counted
(WHOc 2015). However, this is not a fool-proof method because the bacilli are not always
visible. For indeterminate (usually earlier) cases of leprosy, the biopsies can be quite
painful for the patient, because tissue samples need to be taken at least 1 cm deep. The
patient has already developed actively progressed leprosy by the time the procedure is
performed, so the Bacteriology Index does not allow for early diagnosis.
PCR detection of M. leprae involves targeting a unique bacterial gene, amplifying it using
PCR, and identifying it by agarose gel electrophoresis. The benefit of PCR testing is that M.
leprae genes can be detected in the patient before leprosy symptoms present themselves.
Bacterial DNA can be detected through PCR even if the bacterial cells are dead, exist in very
small numbers, or are not actively reproducing, and thus detecting M. leprae in a person’s
body does not necessarily mean that they have (or will develop) leprosy, as their body
could already be working towards destroying the bacteria (Shin et al. 2014). Determining if
they have developed the disease would require mRNA detection, which can be modified to
detect specifically living cells.
PURPOSE
I amplified the rlep gene (a gene very highly expressed for M. leprae) from DNA extracted
from both blood and slit skin samples of patients and contacts, and blood samples from
controls. I used gel electrophoresis to show the presence of the gene, with an expected
molecular weight of 129 bp for rlep. My goal was to see whether slit skin smear or blood
samples provide a better DNA source for the PCR detection of M. leprae DNA in patients and
contacts. Recent research suggests that because M. leprae is present in the circulatory
system before it travels to the peripheral areas of the body, DNA taken from blood samples
may allow earlier detection of leprosy (Wen et al. 2013). Therefore, I hypothesized that
PCR amplification of M. leprae DNA will therefore be positive for blood samples when they
may not for slit skin samples. This information is also valuable for reasons of patient
comfort, as slit skin smears are more invasive (thus greater risk) and can be an
uncomfortable process for the patient and are generally much less preferable than drawing
blood.

9
MATERIALS AND METHODOLOGY
SAMPLE COLLECTION
Blood and slit skin samples were taken from 10 leprosy patients and 4 of their familial
contacts, and blood samples were taken from 10 controls. Before samples were collected,
consent was attained using Karigiri Hospital’s standard procedure (Appendix I). Medical
professionals at Karigiri then collected the samples, putting slit skin smears into micro-
centrifuge tubes and blood into glass tubes.
Table 1. New leprosy cases reported at SIH-R& LC in 2014. Samples were obtained
from a broad spectrum of newly diagnosed untreated leprosy patients, with roughly half
male and female, an age range of 19-73, BI’s ranging from 0 to 5+, both MB and PB forms,
and RJ classification ranging from TT to LL. Some information was not able to be
obtained, and samples for only four patient contacts were obtained. All patient contacts
were immediate family members. – Indicates the data was not obtained.
ID No. Age Sex Contact
relation
RJ
Classification
Bacteriological
Index (BI)
PB/MB
1 60 Female Sister BT 0 MB
2 47 Female NA TT 0 PB
3 19 Male NA BT 0 -
4 38 Male Wife LL 5+ MB
5 35 Male Son BT/IND 0 MB
6 73 Male NA BL 0 MB
7 38 Female NA BT 4+ MB
8 33 Female Husband BT 0 MB
9 - - NA - 0+ -
10 37 Female NA LL 1.5 MB

10
BLOOD SAMPLE PROCESSING
Blood cells were allowed to settle to the bottom of the tubes. The serum was collected and
stored at -80° C, for other future experiments, and blood cells stored at 4°C. Parafilm was
placed around the caps of blood and serum samples.
DNA EXTRACTION
FROM BLOOD SAMPLE
The spin-column protocol titled Purification of Total DNA from Animal Blood or Cells in the
DNeasy Blood and Tissue Handbook was utilized to extract DNA from blood, using the
DNeasy® Blood and Tissue Kit (DNeasy® 2006). The extracted DNA was stored at -20° C.
See Appendix III.
FROM SLIT SKIN SMEAR SAMPLE
The slit skin smear samples were stored in 70% ethanol at 4° C, until DNA was extracted
from them using the spin-column protocol titled Purification of Total DNA from Animal
Tissues in the DNeasy Blood and Tissue Handbook, using the DNeasy Blood and Tissue Kit
(DNeasy® 2006). The extracted DNA was stored at -20° C. See Appendix III.
PCR (POLYMERASE CHAIN REACTION)
The UV light was switched on 10 minutes before starting the PCR process to destroy DNA
in the work area. The cooler with the PCR reagents and the ice block were both taken out,
and all reagents except Taq polymerase taken out of the cooler. PCR tubes and a conical
micro-centrifuge tube were placed into the ice block, and all PCR reagents thawed except
Taq polymerase (it never freezes). Each reagent was mixed before being added, and
replaced into the cooler after being added. Nuclease free water was pipetted into the
micro-centrifuge tube. Then the buffer was added, and then the dNTP’s, MgCl2, and forward
and reverse primers for rlep. The forward primer (PS 1) had the sequence 5’ –
TGCATGTCATGGCCTTGAGG – 3’. The reverse primer (PS 2) had the sequence 5’ –
CACCGATACCAGCGGCAGAA – 3’. rlep was chosen because thus far, rlep PCR is the most
sensitive available method for detecting M. leprae, able to detect as little as 10 bacilli (Jamil
1994). The Taq polymerase was added, and the reaction mixture was mixed using a pipet.
The micro-centrifuge tube was tapped to get all the liquid off the sides, and at least 18 µl of
the reaction mixture was dispensed into each PCR tube.
Each DNA sample (2µl), including the positive control, was added to and mixed in its PCR
tube. All tubes were placed into the thermocycler. The cycling conditions were as follows:

11
initial denaturation of 95° C for 10 minutes followed by one cycle of 94° C for 2 minutes,
58° C for 2 minutes (primer annealing), and 72° C for 2 minutes (extension). This was then
followed by 94° C for 30 seconds (initial denaturation), 60° C for 30 seconds (primer
annealing), and 72° C for 45 seconds (extension) with a total of 40 cycles. The reaction was
terminated by 72° C for 10 minutes, and the tubes were held at 4° C until they were
separated on the gel.
GEL ELECTROPHORESIS
Orange G dye (7 µl) was pipetted onto parafilm for each PCR amplicon and the DNA ladder,
and a 7 µl amount of each PCR amplicon and DNA ladder added onto the dye. A pipet set to
14 µl was used to mix the amplicon and dye, and each mixture then loaded into a well on
the gel plate, after the gel was poured and set (2% agarose). The gel was run at 100 V for
20-25 minutes. The bands were detected on a UV transilluminator and computer software
linked to the camera was used to take pictures of the gel. These images were analyzed for
presence of the rlep gene sequence in separate wells, and PCR percent positivity was
calculated for each sample and subject type.
RESULTS
The presence of rlep genes was found by amplification (PCR) yielding a band that ran at
129 bp (Fig. 1). No other bands were observed in the gels. It appears that DNA from slit
skin samples provided better PCR amplification for the rlep gene target than DNA from
blood samples for leprosy patients, but sample type did not make much of a difference in
PCR amplification for leprosy patient contacts (Table 3). As expected, PCR positivity for the
rlep gene target was more likely to occur in leprosy patients rather than their contacts.
Amplicons from blood samples had a greater incidence of faint positivity. All positive
amplicons from slit skin samples were strong bands, while 15% of positive amplicons from
blood samples had faint bands in the gel (Fig. 1). Both of the two faint positive amplicons
from blood samples were from patients. This supports that slit skin samples allow for
stronger positive amplification of the rlep gene target for patients, but not necessarily for
contacts.
Only blood samples were taken from controls because of the absence of skin lesions, and
the ethical issues associated with taking tissue samples from non-patients. The percent PCR
positivity of rlep for these control subjects’ blood samples (20%) was significantly less than
that of blood samples from leprosy patients and their contacts (Table 3). For sample

12
collection, both patients and contacts were observed to be less wary and experience less
pain during blood sample rather than slit skin sample collection.
All patients’ slit skin samples amplified rlep, and all blood samples but patient 008’s had
amplification for the rlep gene (Table 2). Samples were taken from patient 001, 004, 005,
and 008’s contacts. Contacts of 004 and 005 had rlep in both blood and slit skin samples,
while the contact of 001 had PCR positivity in only the blood sample and 008 in only the slit
skin sample (Table 2). Patients 004 and 005 were male and 001 and 008 were female
(Table 1). Patients 001, 004, 005, and 008 all had MB leprosy cases, and patients 001, 005,
and 008 all had RJ classification of BT with a BI of 0, while patient 004 deviated with an RJ
classification of LL and a BT of 5+ (Table 1). Although patient 004’s contact did show rlep in
both blood and DNA samples, patient 005’s contact did as well.
Figure 1. Blood DNA rlep PCR results 001C, 005C, 004C, 003, 005, 006, 001, 004, 007, 002.
Lane 1 – negative control; lane 2 – blank; lane 3 – positive control; lane 4 – patient 001
contact; lane 5 – patient 005 contact; lane 6 – patient 004 contact; lane 7 – patient 003; lane
8 – patient 005; lane 9 – patient 006; lane 10 – patient 001; lane 11 – patient 004; lane 12 –
patient 007; lane 13 – patient 002; lane 14 – blank. NC was not contaminated, and
amplification was achieved for PC, and all of the patient and contact samples. The positive
bands for patients 001 and 007 were quite faint. See Appendix III for other gel pictures.
Table 2. rlep PCR results. 8 of 9 leprosy patients’ blood samples were positive for the
rlep gene target from M. leprae, whereas all had positive slit skin samples. Of the contacts
who were sampled, only 2 had positive rlep detection from both sample procedures and
2 were positive in only one (slit skin or blood). Of the 10 control subjects who were only
tested with blood samples, 2 were positive.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 001C 005C 004C 003 005 006 001 004 007 002
129 bp

13
Sample Slit skin Blood
Patient 001 Positive Positive
Patient 001 contact Negative Positive
Patient 002 contact NA NA
Patient 004 contact Positive Positive
Patient 005 contact Positive Positive
Patient 008 Positive Negative
Patient 008 contact Positive Negative
Patient 010 Positive NA
Control 1 NA Positive
Control 2 NA Negative
Control 6 NA Positive
Table 3. Comparison of slit skin vs. blood for patients (n=10), contacts (n=4), and
controls (n=10). PCR positivity for the rlep gene target in leprosy patients was slightly
more likely in slit skin rather than blood samples. PCR positivity for the rlep gene target
in leprosy patient contacts was equally likely for both blood and slit skin samples.
Slit skin Blood

14
Patients 100% 90%
Contacts 75% 75%
Controls NA 20%
DISCUSSION
Most of the samples gave the same rlep result regardless of tissue, blood or slit skin. Slit
skin samples appeared to have greater PCR positivity for M. leprae DNA than blood samples
for leprosy patients (100% vs. 90%), but not for their contacts (75% vs. 75%) (Table 3).
This may be because for leprosy patients, the M. leprae bacteria has been present long
enough in the patient’s circulation to reach the cooler, peripheral areas of their body, so it
is sequestered in Schwann cells and is present more on their skin rather than in their
blood. For leprosy contacts, however, the bacteria have not been in their bodies long
enough to cause disease or migrate to their cooler areas (skin), so greater PCR positivity in
slit skin samples is not expected. However, the sample size for the study is too small render
statistical significance tests useful, so judgments cannot be made regarding if this
difference in sample type PCR positivity is at all significant.
As expected, greater PCR positivity was found for leprosy patients with both clinical
isolates in comparison to leprosy contacts (Table 3). Although leprosy patient contacts
have more exposure to M. leprae than the general populace, they will not inevitably harbor
it. Contacts with PCR positivity for M. leprae will not necessarily develop leprosy, as long as
they maintain a successful immune response before significant amounts of M. leprae
sequester in Schwann cells. However, those contacts who tested positive need to be
followed up and reassessed regularly for signs of leprosy. That way, the disease can be
caught and treated at an earlier stage before its effects have become debilitating.
Interestingly, blood sample PCR positivity of a contact has been found especially to
increase the likelihood of their developing leprosy, and thus patient 001, 004, and 005’s
contacts in particular should have medical follow up (Table 2) (Martinez et al. 2014).
Differences in band strength were also noted for amplicons from blood versus slit skin
samples. Two incidences of faint bands occurred in gels for blood sample amplicons from
two different patients, while the bands present for slit skin sample amplicons were never
faint. This, along with greater PCR positivity percentages for M. leprae DNA for slit skin
rather than blood samples taken from leprosy patients, serves to corroborate evidence
from past studies indicating blood samples are not as reliable for amplification of M. leprae
DNA in leprosy patients (Martinez et al. 2014).

15
Amplification of M. leprae DNA was seen in only 20% of controls, which is a considerably
lower percentage than that achieved for the PCR positivity of both leprosy patients and
their contacts (Table 3). This result is expected, because the control subjects do not have a
leprosy patient in their household, and thus experience much less exposure to M. leprae
than those living with someone with an active leprosy infection. Nevertheless, since the
controls were staff workers at a leprosy hospital, who have spent time treating leprosy
patients and processing their clinical isolates, some control subjects indicate that they have
been exposed to M. leprae. The rate of postive results is thus not surprising and higher than
expected for the general population. These control subjects should be closely monitored for
signs of leprosy disease, just like the contacts with PCR positivity. Future studies could
involve using non-endemic controls.
It is interesting to note that disease classification status did not appear to have an effect on
PCR positivity for M. leprae for leprosy patient samples. This may be because leprosy
patients, regardless of the progression of their disease (TT to LL) or the number of bacteria
detected from their lesions under the microscope (BI) will harbor bacilli nonetheless, so RJ
classification and BI number should not actually make a difference with regard to PCR
positivity. PCR is only an indicator for the presence, not the number, of bacteria. Also, not
enough data was obtained to consider disease classification statuses of patients influential
PCR positivity factors.
However, intriguingly, gender of the leprosy patient did appear to affect the PCR positivity
of their contact (see Tables 1 and 2), with contacts of male leprosy patients being more
likely to harbor the bacteria than contacts of female leprosy patients. Nevertheless, the
samples from the two contacts of the female patients still did achieve amplification, just in
only one clinical isolate rather than both like the contacts of the male patients, and only
four contact samples were obtained total, so at best only a hint that gender of the patient
may affect likelihood of their contact to harbor M. leprae can be noted. No data was
achieved about the lifestyles of any of the contacts and their possible interaction with other
sources of leprosy infection, so it would be interesting to follow up with a future study
involving more patient contacts and information about the contacts’ other sources of
leprosy exposure.
Because the study only involved 10 patients, 4 contacts, and 10 controls, and not all
epidemiological and disease classification information was obtained for the patients,
comprehensive conclusions cannot be drawn from this study. Time (only five weeks for the
experiment), availability of newly diagnosed untreated patients, and access to and consent
issues with patient contacts all proved to be limits to the experiment. For this reason, only
percent PCR positivity for rlep was reported for data analysis rather than other more
complete statistical analyses such as a Chi-Square Test that are more fitting for larger

16
samples sizes. However, this study provides a basis for future experiments testing rlep PCR
sensitivity of various clinical isolates utilizing a larger sample size. Other types of patient
samples such as urine and nasal swabs should be tested for sensitivity and reliability
(Martinez et al. 2014). Also, larger blood samples could be taken in the future, to see if
increasing the amount of cells from which DNA is extracted has an effect on rlep PCR
positivity.
Regardless of these limitations, several interesting findings have been obtained that
prompt future research questions. It would be beneficial to repeat this study with a larger
sample size of leprosy contacts to see if a difference in PCR postivity of M. leprae between
slit skin and blood samples can be obtained, since this positivity was found to be the same
in this study. It also would be interesting to obtain a larger sample size of leprosy patients
and see whether PCR positivity in blood and slit skin samples varies according to RJ
classification. The idea behind this is that in earlier stages, the M. leprae has not reached the
cooler areas of the body yet, and so will be present more in the blood, while for later stages,
the M. leprae has achieved this migration, and will be present more on the skin. Similarly,
experiments could be performed to test to see if percent PCR positivity varies between
blood and slit skin samples according to BI as well, since it would be expected that patients
with a larger BI will have a larger PCR positivity for slit skin rather than blood samples due
to the larger amount of bacteria that has been detected on their skin.
ACKNOWLEDGEMENTS
I would like to thank Dr. Sundeep Chaitanya Vedithi and Ms. Madhusmita Das of Karigiri
Hospital for serving as my advisors throughout this project, and teaching me all of the
necessary skills. I also would like to thank Professors Anne Walter and Mike Swift of St. Olaf
College for their assistance in editing this paper. I thank the Director of Karigiri Hospital,
Dr. Mannam Ebenezer, for welcoming us and permitting the procurement of necessary
supplies. I also thank the doctors at Karigiri Hospital for taking samples for use in this
project, and I thank the participants who provided samples for this study.

17
LITERATURE CITED
Bennett, B. H., D. L. Parker and M. Robson. 2008. Leprosy: Steps Along the Journey of Eradication. Public Health
Reports 123(2):198-205.
Cherath, L. and R. Frey, eds. 2006. Gale Encyclopedia of Medicine, 3rd ed. Thomson Gale, 2006.
Costandi, Mo. "Leprosy spreads by reprogramming nerve cells into migratory stem cells." The Guardian, January
17, 2013.
Desikan, K. and Sreevasta. 1995. Extended studies on the viability of Mycobacterium leprae outside the human
body. Leprosy Review 66(4):287-295.
DNeasy® Blood and Tissue Handbook. 2006.
http://mvz.berkeley.edu/egl/inserts/DNeasy_Blood_&_Tissue_Handbook.pdf.
Fine, P.E., J.A. Sterne, J.M. Ponnighaus, L. Bliss, J. Saui, A. Chihana, M. Munthali and D.K. Warndorff. 1997.
Household and dwelling contact as risk factors for leprosy in northern Malawi. American Journal of
Epidemiology 146(1):91-102.
Jamil, S., S.M. Wilson, M. Hacket, R. Hussain and N.G. Stoker. 1994. A colorimetric PCR method for the detection
of M. leprae in skin biopsies from leprosy patients. International Journal of Leprosy and other
Mycobacterial Diseases 62(4):512-20.
Job, C.K. 1989. Nerve damage in leprosy. International Journal of Leprosy and Mycobacterial Diseases 57(2):532-9.
Job, C.K., J. Jayakumar, M. Kearney and T.P. Gillis. 2008. Transmission of leprosy: a study of skin and nasal
secretions of household contacts of leprosy patients using PCR. The American Journal of Tropical
Medicine and Hygiene 78(3):518-21.
Lavania, M., R.P. Turankar, S. Karri, V.S. Chaitanya, U. Sengupta and R.S. Jadhav. 2012. Cohort study of the
seasonal effect of nasal carriage and the prescence of Mycobacterium leprae in an endemic area in the
general population. Clinical Microbiology and Infection 19(10):970-4.
Lopez-Roa, R., M. Fafutis-Morris and M. Masanori. 2006. A drug resistant leprosy case detected by DNA sequence
analysis from a relapsed Mexican leprosy patient. Review of Latinoamerican Microbiology 48(3-4):256-
259.
Martinez, A. N., C. Talhari, M.O. Moraes and S. Talhari. 2014. PCR-Based Techniques for Leprosy Diagnosis:
From the Laboratory to the Clinic. PLoS Neglected Tropical Diseases 8(4):e2655.
Matsuoka, M., S. Izumi, T. Budiawan, N. Nakata and K. Saeki. 1999. Mycobacterium leprae DNA in daily using
water as a possible source of leprosy infection. Indian Journal of Leprosy 71(1):61-67.
Modlin, R. L., J. Melancon-Kaplan, S. M. Young, C. Pirmez, H. Kino, J. Convit, T.H. Rea and B.R. Bloom. 1988.
Learning from lesions: Patterns of tissue inflammation in leprosy. Medical Sciences 85(4):1213-1217.
Moubasher, A., N. Kamel, H. Zedan and D. Raheem. 1998. Cytokines in leprosy, I. Serum cytokine profile in
leprosy. International Journal of Dermatology 37(10):733-740.

18
NLEP. NLEP – Progress Report for the year 2009-10 ending on 31st March 2010. New Delhi, 2010. Central
Leprosy Division. Directorate General of Health Services.
http://nlep.nic.in/pdf/ProgressReport31March2009-10.pdf.
NLEP. NLEP – Progress Report for the year 2011-12. New Delhi, 2012. Central Leprosy Division. Directorate
General of Health services. http://nlep.nic.in/pdf/ProgressReport2011-12.pdf.
Rai, D., H.S. Malhotra, R.K. Garg, M.M. Goel, K.P. Malhotra, V. Kumar, A.K. Singh, A. Jain, N. Kohli and S.K.
Singh. 2013. Nerve abscess in primary neuritic leprosy. Leprosy Review 84(2):136-140.
Rees, R.J. and A.C. McDougall. 1977. Airborne infection with Mycobacterium leprae in mice. Journal of Medical
Microbiology 10(1):63-68.
Science Development, "Trial Set for World's First Leprosy Vaccine," 2014.
Shin, I., J. Ray, V. Gupta, M. Ilgu, J. Beasley, L. Benedickson, S. Mehanovic, G.A. Kraus and M. Nilsen-Hamilton.
2014. Live-cell imaging of Pol II promoter activity to monitor gene expression with RNA IMAGEtag
reporters. Nucleic Acids Research doi: 10.1093/nar/gku297.
Singh, M., S. Radhakrishnan, K.M. Patil, and M.R.S. Reddy. 2000. Medical diagnostic techniques and procedures.
Narosa Publishing House, New Delhi, India.
Truman, R.W., P. Singh, R. Sharma, P. Busso, J. Rougemont, A. Paniz-Mondolfi, A. Kapopoulou, S. Brisse, D.M.
Scollard, T.P. Gillis and S.T. Cole. 2011. Probable zoonotic leprosy in the southern United States. New
English Journal of Medicine 364:1626-1633.
Turankar, R. P., M. Lavania, V.S. Chaitanya, U. Sengupta, J. Darlong, F. Darlong, K.S. Siva Sai and R.S. Jadhav.
2013. Single nucleotide polymorphism-based molecular typing of M. leprae. Clinical Microbiology and
Infection 20(3):O142-9.
Vedithi, S. C., M. Lavania, M. Kumar, P. Kaur, R.P. Turankar, I. Singh, A. Nigam and U. Sengupta. 2014. A report
of rifampin-resistant leprosy from northern and eastern India: identification and in silico analysis of
molecular interactions. Medical Microbiology and Immunology DOI: 10.1007/s00430-014-0354-1
Wadee, A.A., R. Anderson and A.R. Rabson. 1988. Clofazimine reverses the inhibitory effect of Mycobacterium
tuberculosis derived factors on phagocyte intracellular killing mechanisms. The Journal of Antimicrobial
Chemotherapy 21(1):65-74.
Wen, Y., Y. Xing, L.C. Yuan, J. Liu, Y. Zhang and H.Y. Li. 2013. Whole-blood nested-PCR amplification of M.
leprae-specific DNA for early diagnosis of leprosy. The American Journal of Tropical Medicine and
Hygiene 88(5):918-922.
Willacy, H. and C. Tidy. Patient. "Leprosy." Last modified May 21, 2014. http://www.patient.co.uk/doctor/leprosy-
pro.
WHOa. World Health Organization. "Classification of Leprosy." Last modified 2015.
http://www.who.int/lep/classification/en/.
WHOb. World Health Organization. "Leprosy." Last modified January 2014.
http://www.who.int/mediacentre/factsheets/fs101/en/.

19
WHOc. World Health Organization. "Microbiology of M. leprae." Last modified 2015.
http://www.who.int/lep/microbiology/en/.

20
APPENDIX I: CONSENT FORM
MOLECULAR BIOLOGY AND IMMUNOLOGY DIVISION
The Schieffelin Institute of Health Research & Leprosy Centre (SIH R & LC)
Karigiri, Vellore, Tamil Nadu 632106, India
INFORMED CONSENT FORM
Title of Project: ______________________________________________________
Principal Investigator: ______________________________________________________
Other Investigators: ______________________________________________________
Participant’s Name:
We invite you to take part in a research study on:
_____________________________________________________________________________
_____________________________________________________________________________
Which seeks to identify a more effective means of diagnosis and treatment of Leprosy. Taking
part in this study is entirely voluntary. If you decide to participate you must sign this form to
show that you want to take part.
 The purpose of this research study is to
_______________________________________________________________________
 Place of Sample
Collection:______________________________________________________________
 You will be asked to provide a sample of______________________________________at
the time of recruitment and once/twice/ during the course of study if required. The blood
will be taken with a sterile syringe from your arm during your standard clinic visit. The
biopsy sample will be collected in an aseptic surgical theater by a clinician and slit skin
scrapings will be taken with a sterile blade from your ear lobe.

21
 You samples will be used in the current research study and might also be used for future
research projects:
________ I consent to my sample being saved for future research.
________ I do not consent my samples being saved for future research.
Important notes:
 The procedures for sample collection will be performed by experienced
clinicians/technicians however in case of any unexpected injury, the cost towards the
treatment of that injury will be charged to SIH-R&LC Karigiri.
 If you agree to take part in this study, your involvement will last approximately 15
minutes for the blood draw and 30 min for a Biopsy Sample.
 Your research records that are reviewed, stored, and analyzed at Molecular Biology Lab
will be kept in a secured area in the computers in the office section of the laboratory.
 You will not lose any legal rights by signing this form.
 Taking part in this research study is voluntary. If you choose to take part, you have the right
to stop at any time. If you decide not to participate or if you decide to stop taking part in
the research at a later date, there will be no penalty.
 Your clinical data will be accessed from the hospital patient database for a period of 2
years. Further information regarding this is given in the separate form for “Authorization
to use Health Information for Research Purposes”.
Signature and Consent/Permission to be in the Research
Before making the decision regarding enrollment in this research you should have:
 Discussed this study with an investigator,
 Reviewed the information in this form, and
 Had the opportunity to ask any questions you may have.
Authorization to Use Your Health Information for Research Purposes
Your signature below means that you have received this information, have asked the questions
you currently have about the research and those questions have been answered and you
authorize us to utilize your samples for research purposes and your health information which will
only be used as required or allowed by law.
Participant: By signing this consent form, you indicate that you are voluntarily choosing to take
part in this research.
_____________________________ __________ ______ ________
Signature of Participant Date Time Name

22
Person Explaining the Research: Your signature below means that you have explained and
answered any queries regarding the research to the participant/participant representative.
______________________________ _________ ________ ____________
Signature of person who Date Time Name
explained this research
_____________________________ _________ ________ ____________
Signature of a witness Date Time Name
For any Queries:
Molecular Biology Lab: Directorate:
Dr. Sundeep Chaitanya. V Dr. Mannam Ebenezer
Research Officer Director
(SIH R & LC), Karigiri, Vellore, (SIH R & LC), Karigiri, Vellore,
Tamil Nadu, 632106, India Tamil Nadu, 632106, India
Office: +91 416 2274227 Extn: 2249 Office: +91 416 2274221
Email: sundeepchaitanya@gmail.com Email:
directorate@karigiri.org

23
APPENDIX II: GEL PICTURES
Figure 2. rlep PCR results: slit skin smears 001, 002, 004, 005, 001C, 004C
Lane 1 – blank; lane 2 – negative control; lane 3 – blank; lane 4 – positive control; lane 5 –
blank; lane 6 – patient 001; lane 7 – patient 002; lane 8 – patient 004; lane 9 – patient 005;
lane 10 – patient 001 contact; lane 11 – patient 004 contact, lanes 12 and 13 – other
samples not part of the project; lane 14 – blank. NC was not contaminated, and
amplification was achieved for PC, all patients, and contact of 004.
Figure 3. Slit skin smear PCR: 003, 005C, 007, 008, 008C
Lane 1 – negative control; lane 2 – blank; lane 3 – positive control; lane 4 – blank; lane 5 –
patient 003; lane 6 – patient 005 contact; lane 7 – patient 006; lane 8 – patient 007; lane 9 –
patient 008; lane 10 – patient 008 contact; lanes 11-14 – blank. NC was not contaminated,
and all patient and contact samples achieved amplification.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 001 002 004 005 001C 004C S1 S2
129 bp
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 003 005C 006 007 008 008C
129 bp

24
Figure 4. Blood sample PCR (008, 008C, and controls).
Lane 1 – negative control; lane 2 – positive control; lane 3 – patient 008; lane 4 – patient
008 contact; lane 5 – control 7; lane 6 – control 1; lane 7 – control 2; lane 8 – control 3; lane
9 – control 4; lane 10 – control 5; lane 11 – control 6; lane 12 – control 8; lane 13 – control
9; lane 14 – control 10. NC was not contaminated, and amplification was achieved for 2
(lane 6 & 11) of the controls but neither the patient nor contact.
Figure 5. Blood and slit skin smear samples 009 and 010.
Lane 1 – negative control; lane 2 – blank; lane 3 – patient 009’s blood sample; lane 4 –
patient 009’s slit skin sample; lanes 5 – patient 010’s slit skin sample, 6-7 – patient samples
unrelated to the project; lane 8 – blank; lane 9 – positive control; lane 10 – ladder; lanes 11-
14 - blank. NC was not contaminated, and amplification was achieved for the patients,
contact, and DNA from other samples.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC PC 008 008C 7 1 2 3 4 5 6 8 9 10
129 bp
1 2 3 4 5 6 7 8 9 10 11 12 13 14
NC 009B 009S 010 PC MW Ladder
129 bp
200 bp
100 bp

25
APPENDIX III: DETAILED LABORATORY PROTOCOL AND MATERIALS LIST FOR RLEP PCR
AMPLIFICATION OF M. LEPRAE DNA EXTRACTED FROM BLOOD AND SLIT SKIN SAMPLES
MATERIALS
SAMPLE COLLECTION
 Consent forms
 Pen or stamp pad
 Micro centrifuge tubes
 Glass tubes
 Labels
 70% ethanol
 70% ethanol
 Pipet
 Micro centrifuge tubes
 Sodium hypochlorite
 Parafilm
DNA EXTRACTION
 96-100% ethanol
 Proteinase K
 Buffers (ATL, AL, AW1, AW2, AE)
 Vortex Mixer
 Incubator
 DNeasy Mini spin column
 2 ml collection tube
 Centrifuge
 Pipets
 Conical micro-centrifuge tubes
 Marker
 DNA primers for rlep; forward and reverse

26
 Thermal cycler
 MgCl2
 Taq polymerase
 dNTP’s
 Nuclease-free water
 PCR tubes
 10X PCR buffer
 Pipets
 Conical micro-centrifuge tube
 Marker
 DNA templates (from samples and positive control)
GEL ELECTROPHORESIS
 2% Agarose gel
 Tris-Borate-EDTA buffer
 Orange G stain
 Ethidium bromide
 UV transilluminator
 PCR products
 Pipet
 Electrophoresis unit
 Parafilm
METHODS
SAMPLE COLLECTION
1. Consent was achieved (waiver form signed with either signature via pen or fingerprint via stamp pad)
before collection of each sample
2. Medical professionals collected the sample (slit skin smears into micro-centrifuge tubes, blood into glass
tubes)
3. Tubes were labeled
1. Withdraw serum from blood samples using 1000 µl pipet tip
2. Put into labeled micro-centrifuge tubes
3. Discard tips into sodium hypochloride

27
4. Put parafilm around the caps of blood and serum samples
5. Store serum at -80 degrees C and blood at 4 degrees C
DNA EXTRACTION
From blood sample
1. Vortex samples to unclog blood
2. Pipet 100 µls of blood (using 1000 µl pipet) into micro-centrifuge tube (may have to cut off the pipet tip
if blood is too thick)
3. Add 20 µls of Proteinase K (jetting into the blood – need to change the tip after each sample); ensure
mixing of each reagent before use
4. Add 100 µls of PBS
5. Vortex (3-4 shots) to mix thoroughly
6. Add 200 µls AL buffer (changing tips with each sample)
7. Incubate at 60 degrees C until evening; vortex every hour (at least 3-5 times)
8. Add 200 µls 96-100% ethanol and vortex thoroughly
9. Label DNeasy Mini spin columns
10. Pipet mixture into DNeasy Mini spin column in 2 ml collection tube.
11. Centrifuge at 8000 rpm for 1 min. Check to see that the filter is clean; repeat this step otherwise
12. Discard flow-through (make sure that spin column doesn’t come into contact with flow-through)
13. Add 500 µls Buffer AW 1 (don’t touch the pipet tip to the tube)
14. Centrifuge for 1 min. at 8000 rpm (centrifuge for longer if material resides above the filter)
15. Discard flow-through (repeat steps 15 and 16 if material resides above the filter)
16. Add 500 µls of Buffer AW 2
17. Centrifuge for 3 min at 14,000 rpm
18. Discard flow through and collection tube
19. Transfer spin column to new collection tube
20. Add 200 µl Buffer AE for elution
21. Incubate for 1 min. at room temperature
22. Centrifuge for 1 min. at 8000 rpm
23. Discard spin column
24. Pipet flow-through into labeled conical micro-centrifuge tubes
25. Store extracted DNA at -20 degrees C
From slit skin smear sample
1. Store slit skin smear in 70% ethanol at 4 degrees C
1. Centrifuge for 20 min at 10,000 rpm to make pellet
2. Discard supernatant
3. Dry samples in incubator for 6-12 hours at 37 degrees C
4. Add 180 µls of Buffer ATL, trying to get material off the sides of the tube
5. Add 20 µls of proteinase K
6. Mix by vortexing for 10 min. until all material is off the sides of the tube
7. Incubate at 60 degrees C for 6 hours
8. Vortex samples for 15 sec
9. Add 200 µls Buffer AL (put pipet all the way down to prevent bubbles)
10. Vortex thoroughly

28
11. Add 200 µls 96-100% ethanol
12. Vortex thoroughly
13. Label DNeasy Mini spin columns
14. Pipet samples into DNeasy Mini spin columns in a 2 ml collection tube (don’t touch the filter with the
pipet tip)
15. Centrifuge at 8000 rpm for 1 min.
16. Discard flow-through (don’t touch the bottom of the spin column to collection tube)
18. Centrifuge for 1 min. at 8000 rpm
19. Discard flow-through
21. Centrifuge for 3 min at 14,000 rpm
22. Discard flow through and collection tube
23. Transfer spin columns to new 2 ml collection tubes
24. Add 200 µls Buffer AE for elution
25. Incubate samples for 1 min at room temperature
26. Centrifuge for 1 min at 8000 rpm
27. Discard spin columns
28. Pipet flow-through into new labeled conical micro-centrifuge tubes
29. Store extracted DNA at -20 degrees C
1. Switch on the UV light 10 minutes before mixing PCR reagents
1. Calculate PCR reagent quantities
2. Turn off UV light and wait another 10 minutes
3. Take DNA out of fridge to thaw
4. Put on lab coat and gloves in PCR room only
5. Take out cooler with PCR reagents and ice block
6. Take all reagents out of cooler except Taq polymerase
7. Take out PCR tubes and conical micro-centrifuge tube; place into ice block
8. Thaw all PCR reagents except Taq polymerase
9. Pipet nuclease free water into micro-centrifuge tube first, adding extra to allow for pipet errors; put
back into cooler
10. Add buffer to micro-centrifuge tube; replace into cooler (mix each reagent before adding it)
11. Add dNTP’s, MgCl2, and forward and reverse primers; put reagents back into cooler
12. Add Taq polymerase (don’t need to mix beforehand)
13. Set pipet to amount larger than reaction mixture; mix all reagents (should see a froth)
14. Tap micro-centrifuge tube to get all liquid off the sides
15. Set pipet to 18 µls and dispense reaction mixture into each PCR tube (if extra remains in micro-
centrifuge tube, divide this up among the PCR tubes)
16. Close the negative control tube
17. Carry all PCR tubes over to PCR lab
18. Make sure sample DNA is thawed; add DNA to each PCR tube whilst labeling the tubes
19. Use pipet to mix reagents in each tube; tap to get all of the liquid off the sides
20. Take out Positive control DNA and thaw
21. Add PC DNA to labeled PC PCR tube; mix reagents and tap to get liquid down

29
22. Label NC PCR tube
23. Put PCR tubes into thermocycler; select the rlep PCR program
24. Return DNA and cooler to refrigerators
25. Switch on the UV light in the PCR workbench
GEL ELECTROPHORESIS
1. Place a 7 µl dot of dye on parafilm for each PCR amplicon and DNA ladder
1. Place a 7 µl amount of each PCR amplicon and DNA ladder onto each dot of dye, using the same pipet tip
and a pipet set to 14 µls to mix after the amplicon is added. Change the pipet tip with each amplicon
2. Load the liquid from each dot into well on gel plate (don’t load the first well) after amplicon and dye is
sufficiently mixed. Leave 1 well of space between amplicons and NC; make sure that the order of PC, NC,
amplicons and ladder is noted
3. Attach the wires and set the voltage to 100 V; push start
4. When gel is done running (20-25 min.), place gel in UV transilluminator
5. Use computer software linked to camera to take and view gel pictures; save them

30
PERSONAL REACTION TO PROJECT
Overall, I had a great time at Karigiri. It was exciting to be working on a molecular biology
project, which is something that I have always wanted to do, and especially to be working
on something with such clinical importance for the people there. Although leprosy is not a
very visible disease to us in developed nations, it is still a huge issue in several developing
countries, India included.
Our advisors at Karigiri, Dr. Sundeep and Ms. Madhusmita, were not only really kind, but
also very knowledgeable and helpful. Angela and I had known very little about leprosy
before coming to Karigiri, but because of them, we now have learned so much. They were
really patient when teaching us new skills, and did a great job of informing us what they
expected and giving us a projected schedule for the research. While they did quite a lot of
work in terms of planning the project for us, they also made sure that we were the ones
actually performing each step of the project. They also made sure that we understood
exactly what we were doing with our work, and the theories behind DNA extraction, PCR,
gel electrophoresis, etc. so that we weren’t just performing processes without grasping
why they were necessary. While they did a great job of maintaining a serious work
environment in the lab, outside of the lab we had a lot of fun together, and even more so
than our supervisors, they were our friends. The equipment in the lab was quite new and
high-quality, since Karigiri was in the process of revamping their molecular biology lab.
The A/C in the lab was also much appreciated.
Aside from our supervisors, most all the other staff we met at Karigiri were really sweet
and helpful. Dr. Esther Rita even took the time to help me identify the parasites from my
previous project. Angela and I made friends with several of the doctors there, like Dr. Katie
and Dr. Andrew, and the director, Dr. Mannam Ebenezer, was also a friendly man. It was
great to become friends with Valsa Augustine as well and to be welcomed so graciously into
her home, and to get to know all of the pleasantly sociable interns at the hospital. The
doctors who assisted in taking samples for our projects were more than happy to help us
out, and the guesthouse staff for the most part were really attentive to our needs. It was
wonderful to in such a spiritual environment and be surrounded by such strong Christians.
Angela and I really enjoyed the many Christmas functions that took place and the
decorations that were put up. It was hard to be away from home during the holiday season,
but the festive spirit at Karigiri helped put us into the Christmas mood a little more. It
seemed like there was always something fun happening every weekend, whether it was a
children’s show, a Christmas play, or a staff Christmas party. The shopping trip bus on the
weekends also made it easier to get off the hospital campus. The trails all around the

31
hospital really facilitated running, and the location of the hospital, with all of the
surrounding mountains, was very beautiful.
One of the only issues was that the molecular lab was relatively new and growing, so there
was a lot of equipment that we had to wait quite a long time for, and sometimes there
would be mechanical issues with the equipment once it arrived. There were a lot of snakes
around the hospital campus, partially because the grass was allowed to grow for so long, so
it was always a little scary to have to watch out for them. One member of the dining hall
staff at the guesthouse was a little too controlling in trying to make sure that we came to
meals right on time, when that wasn’t always possible due to work or social activities.
I believe that the hospital should direct more funding to the molecular biology lab at
Karigiri since the projects they are undertaking are so important for the development of
new ways to detect M. leprae in patients’ systems without painful biopsies. I think that they
are really doing quite a bit of very important work and should be getting the recognition
they deserve. I also suggest that the dining staff at the guesthouse could be a bit more
flexible with regard to their guests’ schedules. Sometimes the doctors are seeing patients
and can’t come to meals on time, and sometimes because of work, the lab personnel can’t
make it on time either. All guests do pay for the meals, however, so it would be nice if they
could keep the food out for a bit longer than the scheduled time and also not get angry at
guests for being late because it most often is due to extenuating circumstances outside of
their control. Another option would be to leave parcels for those who did not come to a
meal on time that the guests can pick up when they arrive, so that the staff workers also
don’t have to have their day set back due to waiting for guests to come to meals. The dining
hall staff could also just leave out some basic food options for latecomers, like fruit,
chappatis and hard-boiled eggs.

PCR Detection of Leprosy Bacteria Gene in Patient Samples

Recommended

Recommended

More Related Content

What's hot

What's hot (20)

Similar to PCR Detection of Leprosy Bacteria Gene in Patient Samples

Similar to PCR Detection of Leprosy Bacteria Gene in Patient Samples (20)

PCR Detection of Leprosy Bacteria Gene in Patient Samples