1. The homologous recombination of Hygr gene on the VDBG_07494 sequence of
Verticillium alfalfa genome and its relation to the DRM pathway.
Thinh Nguyen, Sanah Bibi, Anna Klimes
Department of Physical and Biological Science, Western New England University
Abstract
Verticillium wilt is a destructive disease that can minimize the exposure of plant
leaves. Moreover, Verticillium alfalfae and Verticillium dahliae are the primary pathogen
that responsible for the wilt of plant’s leaves. Under the environmental stress, V. alfalfa
protected itself with the process of DRM (Dark Resting Mycelia). In this research, the
relationship between hypothetical gene VDBG_07494 and DRM of V.alfalfae were
studied. A series of bioinformatics tools such as Basic Local Alignment Search Tool
(BLAST), Clustal Omega were used to design the primers for amplifying the region of
VDBG_07494. Moreover, genome manipulation techniques such as homologous
recombination, DNA preparation, polymerase chain reaction were used to create knock
out version of VDBG_07494. Gel electrophoresis and Nano drop measurement were
used to analyze the success of Hygr gene (1 Kb) insertion into the genome of V. alfalfa.
However, the ectopic insertion was the suggested result of the homologous
recombination because there was not appearance of a band at 1.5 Kb mark on the gel
electrophoresis analysis.

2. Introduction
In nature, Verticillium alfalfae is an easily spread fungal pathogen that cause most of the
plant to experience vascular wilt (9). This disease is also known as verticulum wilt and
the progression cycle can be complicated with different stages such as parasitic,
saprophytic, and dormant (6) (figure 1).
Figure 1: Verticillium wilt Disease Cycle
Verticillium wilt can minimize the sun exposure of plant’s leaves, thus reduce the amount
of photosynthesis that plants can perform to produce energy to sustain life (figure 2) (7).
There is a wide range of hosts that were susceptible to Verticillium wilt. These host can
in including more than 300 different plant species of vegetables, fruit trees, flowers, field
crops, and shade or forest trees. Large number of crop plants were reported to be
destroyed because of this disease. Moreover, vascular wilt happens when V. alfalfae
starts to perform its dark resting mycelia (DRM) pathway, which produce dark

3. spot/regions on infected plants. These spots are small, hyaline asexual spores. They also
can enhance the wilting symptoms in the stem and leaves by inducing the blockage in the
xylem vascular tissues. As the result, there will be reduction water and nutrient flow, and
the plants will experience stress.
Figure 2: Alfalfa stems with a range of severity. Mild infection on the left to severe on the right.
Moreover, Verticillium dahliae, which is a fungal sister species of V. alfalfae, also
perform microsclerotia under certain stressors. This characteristic, which is equivalent to
DRM (10), helps V. dahlia to avoid being destroyed in harsh environments. Confirmation
of VDBG_04407 DRM relationship will aid the finding of relationship between
VDAG_08973 and microsclerotia. Overcoming both DRM and microsclerotia will promise
a bright future for famer around the work to improve their crop production. Fast production
of crop plants can be a potential key factor to end the world hunger.

4. This research was done to find a relationship between the hypothetical
VDBG_07494 genes in DRM pathway. The research findings will aid the strategizing
process of overcome DRM, thus treating vascular wilt in plant. A series of bioinformatics
tool such as primerBLAST, and Clustal Omega were used to perform to designed primers
for the hypothetical gene VDBG_04407. Genome, and protein sequence of V. alfalfae
were obtained from National Center for Biotechnology Information data base. In theory,
the main principle of this research is genetic manipulation. By utilizing the similarity of two
DNA strands, the hypothetical gene VDBG_07494 was experimentally replaced with a
knock out version. The replacement sequence (Hygr gene) was designed to have at least
1000 bases that have smiliar regions to the VDBG_07494. Thus the success of
homologous recombination will result with the insertion of the Hygr gene between
VDBG_07494 (figure 3). Moreover, because the knock out version of VDBG_07494 can
contain the Hygr gene, it can be validate by the appearance of a band that will show at
approximately 1.5kb mark on the gel electrophoresis after the amplification of PCR.
Figure 3: Homologous recombination. The homology region was indicate as blue X.
Primer binding regions were indicated with red arrows.
HYGrVDBG 0749
4
Genome DNA
VDBG_07494 Genome DNA
HYGr

5. However, in some cases, ectopic insertion which is an illegitimate recombination
can occur (figure 4). In this form of genetic recombination, the Hygr gene can be
intergraded at random location (non-homologous location) on the genome of host cells.
In consideration of the Hygr gene length (1kb), the designed primer will prefer to amplify
the original region of VDBG_07494 when ectopic insertion happen.
Figure 4: Ectopic insertion. The primers are indicate as red arrows.
In this research, knock out version of VDBG_07494 was created to study its effects
on function of DRM pathway. The conformation of Hyg gene insertion into the genome
of VaMs was tested by many rounds of single sporing on the antibiotic treated agar plates.
Moreover, a series of genetic protocols were utilized to extract out the DNA fragments.
Moreover, primers were designed to amplify the VDBG_07494 region. Thus, the success
of homologous recombination, can be confirmed after gel electrophoresis analysis.
Material and Methods
Single Sporing.
The cultured Petri dishes were placed under a microscope. After adjusting the
power, the spores were located. Then, a sharp sterile scalpel was used to dissect out a
square of agar that contained the spore. The square was moved to a fresh sterile agare
plate. This protocol was repeated for different trials of VaMs. At the end, the plates were
store at temperature approximately between 27oC to 30oC
HYGr Genome DNAVDBG_0749
4

6. Plates preparation
A mixture of 1L complete medium was prepared. The added components are shown in
the table below.
Next, the pH of this mixture was adjusted to 6.5 by using NaOH. After adding 18
g of agar, the whole mixture was autoclaved. Before pouring the plates, antibiotic was
added. A total of 30 plates were prepared to be used for growing new cultures of VaMs,
and VdLs.
Amount Components Subcomponents
50ml 20x Nitrate salts (1L) 120g NaNO3, 10.4g KCl, 10.4g MgSO47H2O, 30.4g KH2PO4
1ml 1000x Trace Elements
(100 mL) at pH 6.5
80 ml ddH2O, 2.2 g ZnSO47H20, 1.1 g H3BO3, 0.5 g MnCl2
4H2O, 0.5 g FeSO4 7H2O, 0.17 g CoCl2 6H2O, 0.16 g
CuSO4 5H2O, 0.15 g Na2MoO4 2H2O, 5 g Na4 EDTA
1ml Vitamin solution
(100 mL)
0.01g Biotin , 0.01g Pyridoxin , 0.01g Thiamine 0.01g
Riboflavin , 0.01g PABA (p-aminobenzoic acid, 0.01g
Nicotinic Acid
10g D-glucose
2g Peptone
1g Yeast Extract
1g Casamino Acids

7. Streaking and new cultural preparation.
In order to streak a specimen from a culture tube, metal transfer loops were first
flamed so that the entire wire is red-hot. Once sterile, the loop was allowed to cool by
holding it still. The lid was held open and sample was collected using the sterile loop.
Bacteria on the loop was transferred to the agar. The bacteria was spread in three sectors
of the petri dish by moving the loop in a back and forth manner across the dish, a zig-zag
motion. Any remaining bacteria left on the loop was ran through flame again. Petri dish
were left inverted to incubate the plates.
DNA prep
The protocol was carried out for cultures of VdLs and VaMs. The cultures were
grown in complete medium flasks. The cultures were filtered using a Miacloth to isolate
colonies of the two species in separate tubes. These tubes were centrifuged for 10
minutes, 4 C, at speed of 1480x g. The pellets attained contained spores which were
washed with 1 mL of sterile distilled water. The spores were suspended in 200 uL of
breakage buffer and 100 uL of this solution was added to 1.5 mL sterile tubes containing
glass beads. These tubes were put through a 3 min cycle: 30 second vortex then 30 sec
on ice. To these tubes 200 uL of of phenol;chloroform;isoamyl alcohol (25:24:1) was
added to the sample and vortexed. The sample was further centrifuged for 5 mi, room
temperature, at 16,000x g. The supernatant was transferred into separate sterile tube,
while ensuring that phenol is not carried over. To fresh tubes, 100 uL of 7.5 M NH4OAC
and 500 uL of ethanol added and allowed to precipitate overnight. These tubes were
centrifuged for 30mins, 4 C, at 16,000 xg. Then washed with 70 % ethanol and

8. centrifuged step was repeated. The pellets were re-suspended in TE buffer. The solution
acquired from each different sample, were put into a nano drop machine to attain the total
amount of DNA present in the tubes.
Polymerase chain reaction/ Bioinformatics
A master mix was prepared as shown below. this mixture was distributed into four
tubes that contained templates of VaMsgDNA, and VaMs hypothetical gene
(VDBG_07494). In the negative control tube, 2ul of template was replace by 2ul of distilled
water.
Volume 5X Volume Reagents
5 ul 25 ul Buffer
1 ul 5 ul dNTP mix
5 ul 25 ul VDBG_07494_F
5 ul 25 ul VDBG_07494_R
2 ul X Template
0.25 ul 1.25 ul Taq
31.75 uL 158.75 ul FSDW
Total: 341 ul
PrimerBLAST was used to design two primers, which was utilized to amplify the
VDBG_07494. The forward primer was CCCAGCCAACCTCGAAACAT. The reverse
primer was CCTCTGGCAAAGAAGGGCA. Both primers had a length of 20 bases. During
40 cycles of PCR procedure, denaturing was at 950C for 30 seconds; designed primers
annealing was at 600C for 30 seconds; and then new DNA strands complementary to the

9. DNA template was made by extension at 68˚C for 1 minute. At the end, a gel
electrophoresis of PCR products was used to validate the amplification of targeted
sequenc
Agarose gel preparation/electrophoresis.
The preparation of (0.8%) Agarose gel was started by adding 0.8 gram of Agarose
into a flask that contained 100 ml buffer of Tris-Acetae (pH 6). After the addition of 0.5 ul
SYBR Safe, the solution was heated by using a microwave. After the gel solution became
clear, it was left to cool at room temperature for one minute. Then, the assembled casting
tray was filled with melted gel. The tray also was rocked back, and forth for one time to
evenly distribute the Agarose. Next, the comb was inserted into the casting tray slots by
pushing down gently on the top of the comb until resistance is encountered. The teeth of
the comb came to rest in the melted Agarose about 0.2 mm above the surface of the
glass plate. After the gel has cooled for at least 20 minutes, the comb was carefully lifted
straight up and away from the casting tray. Before the samples were loaded into each wells,
1 ul of each samples were mixed with 8ul of water, 1ul of gel loading dye. The first well also was
added with 10 ul of DNA ladder.
Result
The various stages of dark resting mycelia development were observed. There
were presence of budding hyphae that gave rise to small spherical yellow/brown spots.
The plates also showed dark resting mycelia rings (figure 5).

10. Moreover, the VdLs and VaMs showed continuous growths after two round of
single sporing on the completed antibiotic treated agar plates (table 1). Eight samples of
VaMs and VdLs strains (Vdls AT1-1, Vdls AT1-3, Vdls AT1-8, Vdls AT1-12, Vdls AT1-14, VaMs
AT1-1, VaMs AT1-3, VaMs AT1-6, VaMs AT1-10, VaMs AT1-13) were chosen to for DNA
extraction
Gel electrophoresis after DNA extraction showed adequate amount of DNA fragments
(figure 8 and figure 10) (table 2). Moreover, under Nano drop measurement, most of the DNA
extraction sample showed A260/280 values that were higher than 1.8 (table 2) (figure 7). In
consideration of the primers binding site on the genome of VaMs hypothetical gene
VDBG_074749, the amplified region was expected to be about 327 bases longs (figure 6). The
gel electrophoresis analysis of PCR products showed distinct bands between 0.3 and 0.4 marks
for lanes 6,7,8,9 (figure 9 and 11). There was no visible band in lane 10 (figure 9 and 11).
Figure5: the display of isolated VaMs and VdLs samples in complete Hygr after
incubation.

11. Table 1: Displays the strains of VdLs and VaMs after 1st single spring and 2nd single
spring. The record date also indicate the chosen sample for DNA prep and DNA PCR.
Strains 1st single
spore
2nd single
spore
DNA prep DNA PCR
Vdls AT1-1 Vdls AT1-1 Vdls AT1-1 03-25-2016 04-01-2016
Vdls AT1-3 03-25-2016 04-01-2016
Vdls AT1-4 Vdls AT1-4-1
Vdls AT1-4-2
Vdls AT1-8 Vdls AT1-8-1 Vdls AT1-8-1 04-08-2016 04-15-2016
Vdls AT1-12 Vdls AT1-12 Vdls AT1-12 03-25-2016 04-01-2016
Vdls AT1-13 Vdls AT1-13 Vdls AT1-13
Vdls AT1-14 Vdls AT1-14-1
Vdls AT1-14-2
04-08-2016
04-08-2016
04-15-2016
04-15-2016
VaMs AT1-1 VaMs AT1-1 VaMs AT1-2-2 04-08-2016 04-15-2016
VaMs AT1-3 VaMs AT1-3 VaMs AT1-3-1 04-08-2016 04-15-2016
VaMs AT1-4 VaMls AT1-4 VaMs AT1-4-1 04-15-2016
VaMs AT1-5 VaMs AT1-5 VaMs AT1-5-1
VaMs AT1-6 VaMs AT1-6 VaMs AT1-6 03-25-2016 04-01-2016
VaMs AT1-7 VaMs AT1-7
VaMs AT1-8 VaMs AT1-8 VaMs AT1-8-1
VaMs AT1-8-2
04-08-2016
VaMs AT1-10 VaMs AT1-10-1 VaMs AT1-10-1
VaMs AT1-10-2
03-25-2016 04-01-2016
VaMs AT1-11 VaMs AT1-11 VaMs AT1-11-1
VaMs AT1-11-2
VaMs AT1-13 03-25-2016 04-01-2016
VaMs AT1-16 VaMs AT1-16 VaMs AT1-16-1
VaMs AT1-16-2
VaMs AT1-17 VaMs AT1-17 VaMs AT1-17-1
VaMs AT1-19 VaMs AT1-19 VaMs AT1-19-1

12. VaMs.102mRNA GCTCCACAGAACTGCATTGATCCCTCTCTTTTGCCTACTATACTCCATCACCCTCCTCCA
VDgDNA ACTCTCCAGACTTACATTGATCGGTTTCTGTTACCTACTCTACTCCATCAACTTCCTCCA
.*** .****. *.******** * *** **.******.**********.* *******
VaMs.102mRNA GTATCTATTCACTATCCCAAGATGAGATTCACTATTGCGACGATTGCCCTGTTTGCTGGA
VDgDNA GTATCTATTTACTATCCCAAGATGAGATTCTCTATTGCGACGATTGCTCTGTTTGCTGGA
********* ********************:**************** ************
RED- forward primer
VaMs.102mRNA GCTGTCATGGCACACCCAGCCAACCTCGAAACATCCCTCGAAACGCGTGAGATGCGCACC
VDgDNA GCTGCCATGGCAACCCAGCCAACCTCGAAACATCCCTCGAAACGCGTGAGCTGCGTACC
**** **********************************************.**** ***
VaMs.102mRNA GCCTGCTCTGGCCTCCTTCACGGCACTCCTCTCTGCTGCTCTACCAGTATTCTTGGACTG
VDgDNA GCCTGCTCTGGCCTCCTTCATGGCACTCCTCTCTGCTGCTCCACCAGTATTCTTGGTCTG
******************** ******************** **************:***
VaMs.102mRNA GCCGTTCTAGACTGCTCTACGC--------------------------------------
VDgDNA GCCGTTCTAGACTGCTCTACCCGTACGTTGTTCGATCGTCTATCTGCAGCGCTTTAATTC
******************** *
VaMs.102mRNA ------------------------------------------------------------
VDgDNA CCTTCAAGCAATACCCCAGTTGAAAGTCGTGAGCGTGACTAATTCGTTCTCCCAACAATA
VaMs.102mRNA -CAAAGAGTGCCAGGAACGGCGAGGATATGAGGCGGAACTGCAACGGAAAGCAGCCCCAG
VDgDNA GCAAAGAGTGCCAGGAACGGCGAGGACATGAGGCGGAACTGCAACGGAAAGCAGCCCCAG
************************* *********************************
RED- reverse primer
VaMs.102mRNA TGCTGCACCCTGGGAATCAGCGAAATTGCCCTTCTTTGCCAGAGGCCCATCGGAGCTTAA
VDgDNA TGCTGCACCCTGGGAATCAGCGAAATCGCCCTTCTTTGCCAGAGGCCCATTGGAGCTTGA
************************** *********************** *******.*
VaMs.102mRNA TACAACGCCATGCGGCGCGGCAGTAATGGTGGAAGCTACGGCTCGCAGTGTACTCTGTCT
VDgDNA TAGAATAGCTCGTGGTGCGGCAGCAATGGTGGAAGCTACGGCTGGCAGTATACTCTTGTT
** ** . *: * ** ******* ******************* *****.****** *
VaMs.102mRNA TTTCTTCTCTCAACCGAGTCCCTCGACTCGGAATACACGAAAATCTTTAGCTCGCTCTAT
VDgDNA TT-ATTCTCTTGAT-------CAGAACTCCGAATACACGAAAACCTTGAGCTCGCTCTCT
** .****** .* *: .**** ************* *** **********.*
VaMs.102mRNA AGGAGAAATGTCGGGAATTTTGTCCTTGGTCTAGCACGACATGTTACAGATTGCACGCTT
VDgDNA AGGAGAAATGTCAGGAAT-TTATCCTTGGTCCAGCACGGCATGCCACAGCTTGCACGCTT
************.***** **.********* ******.**** ****.**********
VaMs.102mRNA TGCGGGCGTC-TTAAAAATAGAAAATCATCTTCTA
VDgDNA TGAAGGCAGTCTAAACTACAGAATATTGTCTA---
**..***. *:**.:* ****:** .***:
VDBG forward primer CCCAGCCAACCTCGAAACAT
VDBG reverse primer CCTCTGGCAAAGAAGGGCA
Figure 6: the protein sequence alignment between the hypothetical gene VDBG_07494
of Verticillium alfalfae and the homologous: Verticillium dahlia. The region of amplification
was highlighted as yellow, and the product will be about 327 base long. The primer
binding regions are shown as red above.

13. Table 2: The Nano-drop measurement (number of nucleic acid, 260/280 wavelength) of
VdLs and VaMs DNA extraction samples.
Figure 7: the correlation of 10mm absorbance and wavelength (nm) of VaMs AT1-10
DNA extraction sample. The highest peak was approximately at 260 nm
Sample ID Nucleic Acid 260/280
VdLs AT1-12 14264.4 2.08
VdLs AT1-3 2681.1 2.05
VaMs AT 1-10 956.7 2.07
VaMs AT 1-13 606.9 1.96
VdLs AT1-1 10901.1 2.06
VaMs AT 1-6 592.8 2.10
VdLs 4-1-1 105.3 1.57
VaMs 3-1 140.2 1.65
VaMs 4-1 69.0 1.57
VaMs 2-2 229.6 1.65
VdLs 8-1 252.5 1.95
VdLs 4-2 623.6 2.09

14. F
Figure 8: Gel electrophoresis of DNA extraction/preparation samples from VaMs and
VdLs. There were three distinct bands across the lanes.
Figure 9: The first gel electrophoresis of PCR products (VaMs and
VdLs DNA extraction samples). The designed forward and reverse
primers were used to span the hypothetical gene VDBG_07494. There
were two prominent bands at 0.5kb position (lane 1 and lane 3). There
also four prominent bands between the 0.4 kb and 0.3kb position (lane
6, lane 7, lane 8, and lane 9)
1 2 3 4 5 6 7 8 9 10
Lane1:VdLsgDNA,
Lane2:VdLs AT1-1
Lane3:VdLs AT1-3
Lane4:VdLs AT1-12
Lane5: (-) control
Lane6:VaMsgDNA
Lane7:VaMsAT1-6
Lane8:VaMsAT1-10
Lane9:VaMsAT1-13
Lane10: (-) control
0.2
0.3
0.2
0.4
0.2
0.5
0.2
Lane 1: VdLs AT1-3
Lane 2: VaMs AT1-10
Lane 3: VaMs AT1-13
Lane 4: VdLs AT1-12
Lane 5: VdLs AT1-1
Lane 6: VaMsAT1-6
1 2 3 4 65
0.5
0.4
0.3

15. Figure 10: Gel electrophoresis of DNA extraction/preparation samples from VaMs and
VdLs. There were three prominent bands at lane 4 and lane 6. The faded bands were
seen at lane 1, 2, 3, and 5.
Figure 11: The second gel electrophoresis of PCR products (VaMs and VdLs
DNA extraction samples). The designed forward and reverse primers were
used to span the hypothetical gene VDBG_07494. There were four prominent
bands at 0.5kb position (lane 1, 2, 3, and 4). There also four prominent bands
between the 0.4 kb and 0.3kb position (lane 6, lane 7, lane 8, and lane 9)
Lane1:VdLsgDNA,
Lane2:VdLs AT8-1
Lane3:VdLs AT4-1
Lane4:VdLs AT4-2
Lane5: (-) control
Lane6:VaMsgDNA
Lane7:VaMsAT 2-2
Lane8:VaMsAT 3-1
Lane9:VaMsAT 4-1
Lane10: (-) control
0.5
0.4
0.3
0.2
1
0.5
2
0.5
3
0.5
4
0.5
5
0.5
6
0.5
Lane 1: VdLs AT8-1
Lane 2: VdLs AT4-1
Lane 3: VdLs AT-12
Lane 4: VaMsAT1-6
Lane 5: VaMsAT1-10
Lane 6: VaMsAT1-13

16. Discussion
The pathogenicity of Verticiullium can be studied by the use of recombinant DNA
technology (genetic recombination). Homologous recombination is a mechanism by
which there is integration of an introduced DNA into the host genomic sequence. In our
case, the chosen insertion was the Hygr gene, which has approximately about 1000 kb.
Upon the success of a common homologous recombination, the Hyg gene was expected
to appear between the hypothetical sequences VDBG_07494. Moreover, a insertion of
the Hygr gene into the genome was observed by the grow of the VaMs on the antibiotic
treated agar plate (figure5). This also was supported by the continuous growth of the
strand after two round of single sporing on the completed antibiotic treated agar plates
(table1).
The extraction of the hypothetical gene was successful because reliable
measurement of DNA concentration was seen after using the nano drop instrument
(table2). Furthermore, the Nano drop instrument was used to determine the quality of the
extracted DNA fragments. From the obtained results, creditable DNA quality was
determined because A260/280 values were greater than 1.8 (table 2) (graph***) thus
suitable for further analysis. However, Lower A260/280 values of some samples
indicated there was proteins contamination (table 2). We further accessed the
concentration of the DNA extraction samples by running agarose gel electrophoresis. The
figure 8 showed prominent bands across the lanes. This indicate there were suficcient
amount of extracted DNA from the sample of the following strains (VdLs AT1-3, VaMs
AT1-10, VaMs AT1-13, VdLs AT1-12, VdLs AT1-1, VaMsAT1-6). However, the second

17. set of trials of DNA extraction showed less sufficient amount of DNA. Because the gel
electrophoresis (figure 10) displayed very light bands across the lanes that contained the
following strain trials (VdLs AT8-1, VdLs AT4-1, VdLs AT-12, VaMsAT1-6, VaMsAT1-10,
VaMsAT1-13).
In order to amplify the targeted DNA sequence to look at the location of the Hygr
gene on the genome, primerBLAST was used to design the appropriate primers which
annealed at the targeted location on VDBG_07494 gene. These primers were chosen
because they produce the most homology of the sequence. Moreover, primers of 20 base
pairs (forward primer CCCAGCCAACCTCGAAACAT, reverse primer
CCTCTGGCAAAGAAGGGCA) were designed at this length because it has the optimal
length for adequate specificity and short enough for the primers to bind easily to the
template at annealing temperatures. Upon the complete of polymerase chain reaction, it
was expected that the gel electrophoresis showed a band at 1.5Kb mark. This
hypothetical result also should had confirmed the success for the insertion of the Hygr
into to the VDBG_07494 by homologous recombination. Because the Hygr gene was
designed to have approximately 1000 bases in length and the VDBG_0494 of VaMs was
about 328 bases. However, the absence of the band at 1.5 kb mark (figure 9 and 110)
suggested that the ectopic insertion was the result of our homologous recombination).
This form of DNA recombination integrates the introduced DNA (HGY gene) at a random location
or a non-homologous location. In theory, the primer will prefer to amplify the
VDBG_07494 sequence which was about 328 bases long instead of the ectopic
insertion of Hygr gene. This was supported because there were prominent bands

18. between the 0.3 kb and 0.4 kb marks in lane 6, 7, 8 and 9 (figure 9 and 11). It was also
suggestive that the homologous recombination frequency was less than 1/8 because
there were eight screened VaMs samples.
Conclusion:
The over-all procedures were successfully carried out. Lab objectives were meet.
Hygr gene was successfully transformed into host cells of VaMs and VdLs. DNAs were
successfully extracted from host cells. Result of DNA prep-gel-electrophoresis and Nano
drop measurement showed high quality and quantity of DNA fragements for some
sample. It is suggestive that the DNA prep protocol need to be repeated for some other
trials. After the polymerase chain reaction of extracted DNA fragments, the gel
electrophoresis analysis suggested that Hygr gene resulted in ectopic insertion on the
VaMs genome. VaMs and VdLs PCR product samples both showed bands lower than
1.5 Kb. However, it is conclusive that the homologous recombination frequency was less
than 0.125 because knock out fragment of VDBG_07494 did not appear after screening
of 8 VaMs samples. For future research, we will continue to do more replicate of VaMs
and VdLS strains after knocking out the hypothetical VDBG_07494. We hope to screen
at least of 13 or more trials because there was evidence that suggested the successful
homologous recombination frequency was 0.0833 (1/12) (6). The repurification is
suggested for some sample because of the low value of A260/280 from Nano drop
measurement.

19. Acknowledgement:
First and foremost, I have to thank my research supervisors, Doctor Anna Klimes.
.Because of her assistance and dedicated involvement in every step throughout the
process, I was able to accomplish this paper. Moreover, I would like to thank you very
much for your support and understanding over these past four years. Doctor Klimes did
not only teach me the foundation of biology, but also provided me with advanced concepts
of genetic which aid me through this research. Doctor Klimes’s teaching style and
enthusiasm for any biological topic gave me a strong impression and I have always had
positive memories of her classes.
Second, I would also like to show gratitude to research partner, Miss Sanah Bibi.
. I cannot begin to express my gratitude and appreciation for their friendship. For many
memorable evenings out and in, we spent a quite amount of time together through this
research. She was a kindred soul who helped me get through the difficulties of this
research. Sanah’s laboratory skills were a great support on the complicated procedure.
Lastly, and most important, I would like to dedicate this research to my parents,
who sacrificed everything to provide me the best opportunities to achieve the education
that they always dream of. To my parents and my brother– it would be an understatement
to say that, as a family, we have experienced some ups and downs in the past six years
since we arrive to the US. Every time I feel down, it is your unconditional love that lifted
up my soul and carried me through the four years of college. Again, thanks for everything.

20. Reference
1. Aleksandr Morgulis, George Coulouris, Yan Raytselis, Thomas L. Madden, Richa
Agarwala, Alejandro A. Schäffer (2008), "Database Indexing for Production
MegaBLAST Searches", Bioinformatics 24:1757-1764.
2. Fast, scalable generation of high-quality protein multiple sequence alignments
using Clustal Omega Sievers F, Wilm A, Dineen DG, Gibson TJ, Karplus K, Li W,
Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins D Molecular
Systems Biology 7 Article number: 539 doi:10.1038/msb.2011.75
3. Klosterman, S. J., Subbarao, K. V., Kang, S., Veronese, P., Gold, S. E., Thomma,
B. P. H. J. & Ma, L. J. (2011). Comparative genomics yields insights into niche
adaptation of plant vascular wilt pathogens. PLoS Pathog,7(7), e1002137.
4. Nordberg H, Cantor M, Dusheyko S, Hua S, Poliakov A, Shabalov I, Smirnova T,
Grigoriev IV, Dubchak I. Nucleic Acids Res. 2014,42(1):D26-31.
5. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T (2012).Primer-
BLAST: A tool to design target-specific primers for polymerase chain reaction.BMC
Bioinformatics. 13:134.
6. Klimes, A., & Dobinson, K. F. (2006). A hydrophobin gene, VDH1, is involved in
microsclerotial development and spore viability in the plant pathogen Verticillium
dahliae. Fungal Genetics and Biology, 43(4), 283-294.
7. Fradin, E. F., & Thomma, B. P. (2006). Physiology and molecular aspects of
Verticillium wilt diseases caused by V. dahliae and V. albo‐atrum. Molecular Plant
Pathology, 7(2), 71-86.
8. Schaible, L., Cannon, O. S., & Waddoups, V. (1951). Inheritance of resistance to
Verticillium wilt in a tomato cross. Phytopathology, 41(11), 986-990.
9. Durrands, P. K., & Cooper, R. M. (1988). The role of pectinases in vascular wilt
disease as determined by defined mutants of Verticillium albo-atrum.Physiological
and molecular plant pathology, 32(3), 363-371.
10.Smith, H. C. (1965). The morphology of Verticillium albo-atrum, V. dahliae, and V.
tricorpus. New Zealand Journal of Agricultural Research, 8(3), 450-478.