Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Â
Self- Reference Effect Experiment
1. Self- Reference Effect Experiment
Studies have shown the processing of information and memory is best stored when information is made relevant and important to the self. This theory
is presented in Cunningham, Turk, MacDonald, and Macrae's "Yours or Mine? Ownership and Memory" (2008). Cunningham et al. presented the idea
of 'selfâreference effect' in their article, stating words or other stimuli presented to participants will be easier to recall according to level of relevance to
said participant. Another article founded on this theory is Symons and Blair's "The SelfâReference Effect in Memory: A MetaâAnalysis" (1997).
Symons et al. reviewed participants and their propensity to "relate material to the self." The following experiment performed is a replication of the
classic experiment by Roger, Kuiper, and Kirker (1977) in which experimenters had participants process and categorize words quickly, later recalling
as many words exhibited in the experiment as possible. This collection of articles each wanted to exhibit the phenomenon of selfâreflected thought
processes and further explains human memory. The initial hypothesis for this experiment is that the words that recalled personal experiences for the
participant will be remembered best.
Method
Participants Participants for this experiment included 194 students at UCF who are enrolled in PSY 3213 Research Methods in Psychology, roughly
ages 18â22.
Materials and Procedures This experiment included the use of Dell Computers. Students sat
Get more content on HelpWriting.net
2. Assignment 1 Unitary and pluralistic frames of reference Introduction: This is a research/investigative assignment into the development and changing
background of industrial relations. Students will identify the main 'actors' in the industrial relations setting thereby creating a backdrop for further
studies. Task 1 Discuss the key differences between unitary theory and pluralism in relation to the following: "How industrial relations are conducted
within a particular organisation is determined by the frame of reference through which its top managers perceive the formal relationship with
individuals and/or their representatives". Alan Fox (1966) suggested that managers may adopt one of two basic views: the unitary and the pluralist
perspectives. (CIPD, 2016) The unitary and pluralist perspectives of employee relations The unitary perspective Managers who practice this view,
regard themselves as the one legitimate foundation of control and authority, to which they value and protect. Management see their role as central
ensuring the activities of the workforce. They assume all employees share the mutual goals of the organisation. All employees are dedicated to the
`management team' and entirely committed to the aspiration of the organisation. Armstrong (1999) suggests "the philosophy of HRM with its emphasis
on commitment and mutuality is based on the unitary perspective". The pluralistic perspective For this approach, managers may well encourage
freedom of
Get more content on HelpWriting.net
3. Where Do We Stand?
People travel a lot and meet other people from different countries around the world. In every country there are people with different backgrounds. Every
culture has its own ways of communication. Language is not the only factor that stops people from communicating with each other. Some people had
experienced meeting people from different cultures with completely different backgrounds, but they speak the same language and they had
misunderstood them because they comprehend things differently depending on how and where they grew up. In my point of view, the main stumbling
blocks for intercultural communication are the use of nonverbal communication and the different attitude toward the concept of time.
One of the strongest values that can be a base for intercultural misunderstandings is the use of nonverbal communication. It means the way you greet
people or the way you stand when you are talking to someone, the volume of your voice and your body language. People have different ways of
communicating, and it differs from one culture to another. In the article "Where Do We Stand?" by Lisa Davis, she explains how the difference in the
backgrounds of people from different cultures can be one of the main causes of nonverbal conflicts. She shows to the reader how body language is
acquired from childhood by the affect of culture. People grew up learning things from their families and people around them in their culture. Other
people learn other things in their culture. When two
Get more content on HelpWriting.net
4. Reference Groups
Reference groups exist in every society. Even though you don't think about falling into one or more reference groups you do. Each person probably
falls into more then one of these groups. As you age and grow
into another. Reference groups are formed by people's positions in society. This can have both positive and negative effects on a person.
When I was 19, I became a single mother of twin boys. I found a job at a local convenience store and began working. After a while, a chance for
advancement came up. I applied for the position. During my
interview the district manager told me that because I was a young single mother I would not receive the promotion since single mothers are more
likely to take time off and to steal....show more content...
I felt embarrassed to tell people that I was a single mom. I was ashamed and thought I would never get anywhere
with people thinking that because I was a young mom I was not worthy of a chance.
I belong to the PTA (actually two of them). A group of parents who get together to find ways to help our kids and our schools. We sponsor book fairs,
carnivals, ice cream socials. At the beginning of the school
year we purchase all the school supplies for our elementary students. Teachers come to use if they need help in their class room, or funding for an item
or a trip. The feeling you get helping make your children's
schools better places is amazing. Kids come up to you when you are helping at an event and say thank you. The PTA becomes a group of friends by
the end of the school year who can not wait for September to
come so we can start doing things together again. Before I actually joined the PTA, I thought it was just a bunch of stay at home moms who baked
cookies for back sales and collected box tops, because they had so
5. much time on their hands. I was wrong, most of us work, go to school, have multiple children, run businesses. The one thing that ties us all together is
our
Get more content on HelpWriting.net
6. Philosophical Frame Of Reference Essay
Of the philosophical frames of reference that we have studied so far, I would say Utilitarianism is my favorite. While it seems that each system
drives and points towards a certain 'good,' none, I feel, are as dedicated to achieving an overall 'good' as utilitarianism. The general basis of
Utilitarianism is that all actions should be explicitly aimed at doing or achieving some greater good than is present at that very moment. Now, within
Utilitarianism are two different principle sects of the frame of reference. One believes wrong or right is determined by the consequences of the action,
while the other views pleasure as the sole good and pain at the only evilâthat one should attempt to maximize their pleasure anĐÂŹd minimize their pain
(EMP
Get more content on HelpWriting.net
7. Frame Of Reference Opinion Essay
To think critically, it is necessary to clear the mind from all positive and negative thoughts about certain subject that the argument involves, and to be
openâminded towards from the opposing side. The human mind is designed to form thinking and beliefs based on one's perspective and what they
have experienced in their own personal lives. Being so, the major obstacles that form the frame of reference in human's minds and limit individuals
from deeper thinking can be determined as lack of understanding, bias from previous life events, and cultural beliefs. One of the most obvious and
prominent examples that demonstrates bias due to a person's own frame of reference is the neverâending contrast of beliefs from Democrats and
Republicans. Liberals typically tend to take the "proâchoice" stance on the issue of abortion while on the other end, Conservatives view the topic of
abortion as in favor of the fetus, or "proâlife." When facing very opposing opinions towards a topic like this, these both sides will typically never
change their viewpoint on the issue and firmly stick to their...show more content...
Another recurring issue in regards to frame of reference bias is that of older generation perspective versus "modern" perspective from millennials, for
example. People who were born in the mid to late 1900's tend to have a very different opinion than those born in the 1990's or later when it comes to
controversial issues in society. Older generations tend to be more oldâfashioned and conservative when it comes to modern world ideas such as
technology, sameâsex marriage, and overall diversity of society. The same bias applies to this situation as it did to the political parties, as the two
opposing generation will generally not actually listen to one another's opinions and remain with their own closeâminded
Get more content on HelpWriting.net
8. Comparing The Fall Of Adam And Even In Genesis
"So God created mankind in his own image, in the image of God he created them; male and female he created them." (Genesis 1:27) This verse in
scripture discusses how not only did God create the heavens and the earths but he also created mankind perfectly in his image. When God had
created man and woman he did so for the full purpose of man and woman to go out and make disciples (Matthew 28:19) and to also serve him and
bring him all the glory (Romans 11:36). However because of the Fall of Adam and Even in Genesis 3 where Eve had disobeyed Gods ordersAdam and
Eve not to eat from the Tree of the Knowledge of Good and Evil (Genesis 2:17) sin had entered into the world. Sin becomes apparent in Genesis 4
once again when Cain attacks and kills his
Get more content on HelpWriting.net
9. Carl Rogers View On Human Nature
I think my view of human nature is pretty positive, I think with the right upbringing and environment that everyone can be a decent human being. I
think in terms of Counseling I fall in line heavily with the Carl Rogers idealist viewpoint, I think it's safe to say I'm a humanist. I strongly believe
that no one is born evil, I think it's something bred into people. I believe the changes in behavior arise mostly due to; not having a loving parental
figure, growing up in a low socioeconomic level in society, and if they suffer from some type of trauma. To me the evidence is when you go into the
past of the most depraved individuals in society, usually they have something in their past that changed their behavior. Counseling to me is in essence,
Get more content on HelpWriting.net
10. For Reference Essay
KimNgoc Huynh
Bimm101
Section: CO2
TA: Pagkapol Yhew Pongsawakul Bioinformatics Homework#1
Question#1:
The sequence is 8654 nucleotides long.
Question#2:
â10 sequence for the lux operon: 5'âTGTTATA
â3' There are 2 nucleotides different that are G and A.
Question#3:
The lux R, which has its own promoter and is transcribed in the opposite direction from the lux operon, could not be transcribed from the same strand
because the RNA polymerase recognizes a promoter sequence only in the direction of 5' to 3', and the lux R gets transcribed in the opposite direction
from the lux operon. Thus, the transcriptions of luxR and lux operon have to occur on two different strands including coding strand and template strand.
Question#4:...show more content...
In our experiment, we did not digest the lux operon with Hind III because there are 6 Hind III sites in the lux sequence, and it might cut within the gene
region of interest, which is luxAB gene in our experiment. Hind III has more sites than Sal I because Vibrio Fischeri is A/T rich (AT=66%,
GC=34%) and so is Hind III recognition sequence; thus, there are more chances for Hind III to recognize and cut the lux sequence along with a great
possibility of it cutting within the luxAB sequence.
Question#6:
a) * The position of the forward primers: 4053â4072
The alignment of the forward primer on the lux operon:
Lux operon 1 ACGAAGGCAGCCTTAGCATT 20
Primer 4053 ACGAAGGCAGCCTTAGCATT 4072 Score| Expect| Identities| Gaps| Strand| 40.1 bits(20)| 0.072| 20/20(100%)| 0/20(0%)| Plus/Plus| *
The position of the reverse primers: 6379â6398
The alignment of the reverse primer on the lux operon: Score| Expect| Identities| Gaps| Strand| 40.1 bits(20)| 0.072| 20/20(100%)| 0/20(0%)| Plus/Minus|
Lux operon 1 TGGACAGTCATACCCTCTCC 20
11. Primer 6398 TGGACAGTCATACCCTCTCC 6379
b) Yes, a PCR product produced using these primers will contain the entire luxAB gene sequence because the positions of the forward (4053â4072) and
reverse (6379â6398) primers indicate that the PCR will amplify the region from 4053 to 6398 that also
Get more content on HelpWriting.net
12. Frame Of Reference Essay
ĐÂŹĐÂŹ_
Option Aâ Frame of reference (Topic 2)
Introduction
The aim of this essay is to discuss how people's frame of reference may influence their communication with individuals from different cultural
backgrounds, with reference to personal and cultural differences in values, beliefs, attitudes and customs, and how these differences may complicate
sharing of meaning and cooperation in relationships.
Key concepts
Frame of Reference
According to (Atherton, 2013) frame of reference is very broad in understanding and has a lot of complex set of assumptions and attitudes which we
use to filter perceptions to create and share meaning. Our frame of reference is largely influenced by our values, beliefs, attitudes and our customs or
culture and this often influences our understanding, response and judgement. This makes the process of communication a very unique and dynamic part
of our everyday life (relationships). According to (Du PlooyâCilliers and Louw, 2014) we need to understand that people have no view into our frames
of reference and thus we must be open in allowing other people to understand our frames in order to...show more content...
Personal values can be seen as personal principles, beliefs, morals, and ideas used to make everyday decisions. These values are developed during our
upbringing and are strengthened from occurring circumstances around us, and may change over time (Du PlooyâCilliers and Louw, 2014).
Understanding and recognizing our personal values and interests is important as it assists us in making healthy and responsible decisions in our
relationships and for future reference. Our personal values differ as individuals thus personal values are indirectly related to choice because they allow
a person to compare their decisions with the associated values of each choice. (Atherton,
Get more content on HelpWriting.net
13. In Mary Shelley's Frankenstein, there are several references to God and the bible, specifically the book of Genesis. Shelley uses allusion to point
to the idea of the parallels between Victor and the Monster and the story of Adam and Eve. These allusions are not only comparisons of Victor to
God and the Monster to Adam but also Victor to Adam. Driven by his mother's own death, Victor looked to science for a way to combat death and
illness for his own personal benefit and glory. By giving his creation life, he manages to attain the knowledge and status similar to that of God. The
creation of this monster, like Prometheus' stealing of fire, leads to Victor's punishment. His life becomes one of loneliness and isolation, brought
upon him by the creation of his creature and his attempt to be God. His carelessness and inability to fully understand the complications with his
experiment contributed to his downfall and ultimately leads to a diversion in this comparison. Bodies Victor and the creation of his monster to God
and the creation of Adam, I feel as though another implication could be made. Victor Frankenstein could be seen as Adam. In Genesis God says to
Adam, "But of the tree of the knowledge of good and evil, thou shalt not eat of it: for in the day that thou eatest thereof thou shalt surely die" (Genesis
2). The creation of the monster sets off a series of events ultimately ending in the death of Victor's family, leaving him to die alone in isolation. The
Get more content on HelpWriting.net
14. Essay about Online vs In-Person Reference
I.The Question
The question that was posed to both the Ankeny Public Library and Ohio's Know It Know online reference service was "I am looking for information
about the weather in Daytona, Florida."
II.The Services
This question was first posed both Ohio's Know It Now online reference service on Monday, January 27th around 6:30 pm cst. The question was then
asked in person at the reference desk at the Ankeny Public Library on Thursday, January 30th around 6:00 pm cst.
III.The Expectations
When I initially posed the question to both the Know It Now service and to the Ankeny Public library I was interested in information about the monthly
temperature averages, precipitation averages, hurricane season, etc. During my reference...show more content...
She then provided me with another link, www.therealtyprosonline.com, which had information about hurricanes, temperatures and various other items
such as culture, demographics, education and transportation. This website was an allâaround good source as it provided additional information about
Daytona that I might not have been able to find on my own. During the reference interview Patricia asked a variety of open and closed ended
questions. The first open ended question that she asked was "Was there anything in particular you needed to know about the weather in Daytona?" This
question allowed me to elaborate into what specific information I was looking for. Once she found the resources that meet the requirements I indicated
then she proceeded to ask a closed ended question. The closed ended question that was asked of me was "Are those helpful?" Indicating are the two
resources that I was provided with what I was looking for. I replied that yes in fact that were. The entire reference interaction took approximately 12
minutes. At the beginning of the reference interview, Patricia indicated that it would take a few minutes to research the reference question. She was
conscious of the time as it only took her two minutes to locate the first reference. When researching information about hurricanes within Daytona,
obtaining this information took an additional 4 minutes to locate. While it might not have been a very lengthy reference transaction, Patricia was
Get more content on HelpWriting.net
15. Informal Reference Groups
A reference group is people who we want to resemble. When I was a freshman in college I dressed very plain such as a pair of jeans with a basic
tâshirt. As the months, went by I started dressing differently such as wearing lipstick, color jeans, nice shirts, etc. Also, I act differently more of a
preppy attitude. I was surrounded by a group of people who dress nicely and act preppy. This reference group molded me because I admire their
appearances and attitudes. There are different reference groups that can be identify such as informal, formal membership and disclaimant. Informal
reference groups have interests and goals in common. For example, relatives, mothers in the community and peers. A formal reference would be have
one main goal in
Get more content on HelpWriting.net
16. Carl Rogers Situational Analysis
Carl Rogers "5" Characteristics of al successful relations consist of honest, sensitivity, open communication, respect for autonomy, and rhythm ( Bethel
University, n.d.). To some extent individual that have a positive relationship display these five characteristics that were developed by Carl Rogers more
than twenty years ago ( Bethelu University,n.d.). Honesty is hard to achieve. However individuals want to share and or express their feelings and
thoughts while in a relationship without worrying about what impression that they are displaying ( Bethel University, n.d.) . Therefor they are willing
to be themselves ( Bethel University, n.d.). Sensitivity consist of individuals who are willing to understand the individuals that are included
Get more content on HelpWriting.net
17. Carl Rogers Frame Of Reference Essay
.The founder of Person Centred Approach was Carl Rogers. He believed that clients have their own view of the world which he termed 'Frame of
Reference', he believed that by helping clients accept themselves they would be able to live a happier life. I think it's important to look at the key
terminology of Carl Rogers approach, . I will start with the first one â Frame of reference, which in my opinion means every person have their own
unique view of the world. Second term is â Introjected values, which I think means to be held back from doing something important to you, because of
other people`s values or believes. Third term is â Conditions of worth, which is another barrier on the way of becoming a happier person. Basically to
me it means
Get more content on HelpWriting.net
18. In order to understand what reference group influences are, it is necessary to firstly understand what a reference group is. The depth of
information surrounding reference groups and the influences they poses on individuals, particularly on consumer purchasing behaviour is vast
and one could get lost in the mist of it all. Therefore, it is vital to ensure that only research relevant to this study is included in this section, thus an
overview of what a reference group is will be provided, then the different types of reference groups will be explored based on previous research,
then the data will start to look at the influences reference groups have on individuals, and their purchasing behaviour, in order to fully understand
the power that reference groups have. 3.2REFERENCE GROUPS (LONGER) In order to find a definition that is able to capture what a reference
group is in a comprehensive sentence, has been difficult and thus the following terms are the most relevant. The term reference group is defined as
'A group of people that influences the decisions and opinions of a person or group' (Cambridge, 2016). This term however, is very simplistic and
more detail is required to fully understand what reference groups are. Hyman (1942) originally characterised the term in a social status study and this
characterisation has been developed and refined numerous amounts of times since, (comb, 1943, Campbell, et al, 1960 and Shibutani, 1955). Park &
Lessig (1977) provided their version
Get more content on HelpWriting.net
19. Student No.: 12012403
Portfolio Task: Module 6
(526)
"Write a properly referenced essay on the treatment and management of a patient with corns."
A corn is a thickened area of skin that can occur anywhere on the foot due to pressure. This thickening appears as a cone shaped mass pointing down
into the skin. Hard corns (heloma durum) tend to be found on the outer surface of the little toe or on the upper surface of the other toes. Soft corns
(heloma molle) occur between toes and are kept soft by moisture in this area.
Contrary to popular belief corns are a normal and natural way for the body to protect itself from areas of high pressure and friction. Corns that are not
treated will become painful if the pressure that causes them...show more content...
"The presence of peripheral neuropathy, vascular insufficiency, impaired immune response or the effects of longâterm steroid therapy on the healing
will make the application of caustics or any medicaments with the ability to cause breakdown of tissue undesirable. However a mild exfoliant such as
10% salicylic acid in collodion can be used to facilitate enucleation, but the patient should be monitored closely." (Neale's, 2010, p401)
Management of corns should include a proper health assessment to determine the cause of the corn. This should include regular maintenance by a FHP
to keep corns reduced. Surgical correction of bony prominences such as bunions as well as correction of abnormal gait could help in the management
of the corns.
Because many foot problems are biomechanical in origin, or due to poorly fitting footwear, therapeutic use of padding and strapping in the shortâterm
gives immediate relief from pain. "The longâterm use of clinical padding is inefficient in terms of durability and hygiene and thus it must always be a
shortâterm solution." (Neale's, 2010, p399). Orthotics is the best way to control and manage biomechanical disorders longâterm, and an orthotic fitted
insert or foot bed to a shoe or specially fitted orthotic footwear is good for distributing pressure so as to reduce recurrence of the corns.
Page 3
Student No.: 12012403
20. References:
Frowen, P., O'Donnell, M., Lorimer, D. and Burrow, G. (2010), Neal's Disorders of the Foot,
Get more content on HelpWriting.net
21. Frankenstein As A Biblical Reference Essay
Jada Williams Williams 1
Benjamin Compton
English 105
10/3/17
Frankenstein as a Biblical Reference In Mary Wollstonecraft Shelley's novel, Frankenstein, had an interâtextual connection to the bible. Shelley
connects the creature to Satan, his relation to Adam, the story of Adam and Eve, the book of Genesis and his reading of Paradise Lost. As the bible was
an esteemed text in the early 1800s, Shelley's use of it in her novel served to establish Frankenstein as a sort of parable of didactic text. She begins
with the idea of creation in the book of Genesis to start her allusions. In Genesis 1, God creates humans in his own...show more content...
The creature begins to find knowledge in the poem of Paradise Lost, a story about the legendary fall of Adam and Eve introducing the knowledge
of good and evil into a previously perfect world. In one split second sin was birthed, and the perfection of the earth was swept away, leaving
anguish and iniquity in its ramification. When the creature gets this novel he begins to more understand that Gods creations are natural things on
this earth, and he, who is made by man, is not. "He had come forth from the hands of God a perfect creature, happy and prosperous, guarded by the
special care of his Creator; he was allowed to converse with and acquire knowledge from beings of a superior nature, but I was wretched, helpless,
and alone" (Shelly 116). Frankenstein can be compared to both God and Satan in this case because like God, he created the monster and gave him
direction and attempted to love him. However, like Satan he was warned of the precautions and possible issues of creating an unknown and frightening
creature. The characters in Frankenstein are a resemblance of the characters in Paradise Lost. Frankenstein could possibly mirror Eve in the Garden of
Eden in that they would do whatever it takes to be able to know about everything in existence. While, the creature matches with Satan because they
both wanted to break free from their creators and receive a chance at their own decisions.
Get more content on HelpWriting.net