SlideShare a Scribd company logo
1 of 53
Preimplantation Genetic
Diagnosis
SR Ghaffari MSc MD PhD
M Rafati, MD, PhD
Reproductive Biotechnology Research Center
Avicenna Research Institute
History
 In the late 1980s several pioneers and their groups began
preimplantation genetic diagnosis (PGD) with the detection
of single gene disorders
 1990 :The first successful PGD cycle was reported
PGD in Clinic
 By the mid-1990s there were still only 100 live born
children resulting from PGD
 For most of the next decade, relatively few clinical cases
were performed, and the field generally was considered
‘‘boutique’’ in nature
 By 2013 the mood has changed, PGD is no longer
boutique
What is PGD?
• The procedure which involves the removal of
one or more blastomeres to test for mutations
in a specific gene sequence or chromosomal
abnormalities before transferring
PGD Indications
• An alternative to conventional PND for couples with a
significant risk of transmitting a serious genetic disorder
to their offspring
• Avoiding abortion (enormous physical and psycological
burden)
• Presence of ethical concerns in aborting embryoes
affected with specific disorders ( for example: hearing
loss, skeletal disorders, …)
The Most Common Indications (ESHRE)
ESHRE
Report
Genetic Techniques
Genetic analysis:
PCR-based techniques
 Hybridization based techniques
FISH
 Array CGH
 Next Generation Sequencing
Amplification-based PGD
In the Past
Target specific optimization
• Time consuming
• Limited number of disorders
• Limited genetic tests carried out on blastomeres
• High failure rate
At Present
• Whole genome amplification of single cell
• Degenerate oligonucleotide primed PCR (DOP-PCR)
• GenomePlex Single Cell Whole Genome Amplification
• Multiple displacement amplification (MDA)
• A universal protocol for PGD of single gene disorders for a
wide range of genetic disorders
• Large amount of DNA from each blastomere (µg)
• No limitation in genetic investigations
Our Experience
Avicenna Infertility Clinic
(2012-2015)
Wide Range of Genetic Disorders
Investigated disorders till now:
 Beta-thalassemia
 Spinal Muscular Atrophy
 Duchenne Muscular Dystrophy
 Cystic Fibrosis
 Congenital Hearing Loss
 Achondroplasia
 Metachromatic Leukodystrophy
 Fibrodysplasia Ossificans Progressiva
Even rare
disorders
Workflow
 Genetic Counseling
 Mutation detection or confirmation
 Designing multiple primer sets
 STR profiling of the parents
 Whole genome amplification of biopsied single cells
 Subsequent investigations:
 PCR amplification
 Sequencing
 STR profiling
Designing Several Primer Pairs
 AAAGAGGGTAACTCATTAATAAAATAACAAATCATATCTATTCAAAGAATGGCACCAGTGTGAAAAAAAGCTTTTTAACCAATGACATTTGTGATATGATTATTCTAATTTAGTCTTTTTC
 AGGTACAAGATATTATGAAATTACATTTTGTGTTTATGTTATTTGCAATGTTTTCTATGGAAATATTTCACAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACAC
TTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAAATGATTTT
TGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAACAACAGGTACTATGAACTCATTAACTTTAGCTAAGCATTTAAGTAAAAAATTTTCAATGAATAAAATGCTGCATTCTATAGGTTA
1F-239 2F-379
3F-160 4F-174
1F TCAAAGAATGGCACCAGTGT 1F TCAAAGAATGGCACCAGTGT
3R CGCAGTGTTGACAGGTACAA 4R TTCTCATTTGGAACCAGCGC
CFTR-Ex20-13
304bp
CFTR-Ex20-14
321bp
2F AATGACATTTGTGATATGAT 2F AATGACATTTGTGATATGAT
3R CGCAGTGTTGACAGGTACAA 4R TTCTCATTTGGAACCAGCGC
CFTR-Ex20-23
265bp
CFTR-Ex20-24
282bp
3F ATTTCACAGGCAGGAGTCCA 3F ATTTCACAGGCAGGAGTCCA
4R TTCTCATTTGGAACCAGCGC 2R CTTAAATGCTTAGCTAAAGT
CFTR-Ex20-34
177bp
CFTR-Ex20-32
276bp
Whole Genome Amplification
Rule out of Contamination
STR Markers
Fetus and the Parents
• M
Examples
Cystic Fibrosis
 AAAGAGGGTAACTCATTAATAAAATAACAAATCATATCTATTCAAAGAATGGCACCAGTGTGAAAAAAAGCTTTTTAACCAATGACATTTGTGATATGATTATTCTAATTTAGTCTTTTTC
 AGGTACAAGATATTATGAAATTACATTTTGTGTTTATGTTATTTGCAATGTTTTCTATGGAAATATTTCACAGGCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGG
ACACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAA
ATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAACAACAGGTACTATGAACTCATTAACTTTAGCTAAGCATTTAAGTAAAAAATTTTCAATGAATAAAATGCTGCAT
TCTATAGGTTA
1F-239 2F-379
3F-160 4F-174
1F TCAAAGAATGGCACCAGTGT 1F TCAAAGAATGGCACCAGTGT
3R CGCAGTGTTGACAGGTACAA 4R TTCTCATTTGGAACCAGCGC
CFTR-Ex20-13
304bp
CFTR-Ex20-14
321bp
2F AATGACATTTGTGATATGAT 2F AATGACATTTGTGATATGAT
3R CGCAGTGTTGACAGGTACAA 4R TTCTCATTTGGAACCAGCGC
CFTR-Ex20-23
265bp
CFTR-Ex20-24
282bp
3F ATTTCACAGGCAGGAGTCCA 3F ATTTCACAGGCAGGAGTCCA
4R TTCTCATTTGGAACCAGCGC 2R CTTAAATGCTTAGCTAAAGT
CFTR-Ex20-34
177bp
CFTR-Ex20-32
276bp
Single-cell Whole Genome Amplification
Assessment of DNA quality
Amplification of Specific Targets
Embryo, Heterozygous (carrier)
Embryo, Homozygous Mutation
(affected)
Embryo, Wild Type (not affected)
Fibrodysplasia Ossificans
Progressiva
Pedigree
Clinical Features
WGA
Amplification of Specific Targets
Embryo, Homozygous Mutation
(affected)
Embryo, Wild Type (not affected)
Beta-thalassemia
Confirmation of the Detected Mutations
• The father
Confirmation of the Detected Mutations
• The father
Confirmation of the Detected Mutations
• The mother
Confirmation of the Detected Mutations
• The mother
STR Profiling
PGD ‫بتاتاالسمی‬
Linked STR Marker(s)
HBB-D11S4891 (75-100bp) Di nucleotide
Unlinked STR Markers
D18S535 (130-155bp) Tetra Nucleotide
FGFR3-D4S3038 (163-180bp) Di Nucleotide
93.2.3
7pair Primers
HBB-D11S1760
HBB-D11S1871
HBB-D11S4891
GJB2-D13S141
FGFER3-D4S3038
D18S535
D21S11
STR profiling
PGD ‫بتاتاالسمی‬
Linked STR Marker(s)
HBB-D11S1760 (75-100bp) Di nucleotide
Unlinked STR Markers
GJB2-D13S141 (115-…bp) Di Nucleotide
D21S11 (230-326bp) Tetra Nucleotide
93.2.3
7pair Primers
HBB-D11S1760
HBB-D11S1871
HBB-D11S4891
GJB2-D13S141
FGFER3-D4S3038
D18S535
D21S11
STR profiling
PGD ‫بتاتاالسمی‬
Linked STR Marker(s)
HBB-D11S1871 (160-200bp) Di nucleotide
93.2.3
7pair Primers
HBB-D11S1760
HBB-D11S1871
HBB-D11S4891
GJB2-D13S141
FGFER3-D4S3038
D18S535
D21S11
Embryo biopsy
Whole Genome
Amplification
PCR
Investigation of Embryos
Normal
Embryo investigation
Normal
Final report
• M
Rule out of contamination
Allele drop-out
Thanks for Your Attention
5/22/13Rafati M 64

More Related Content

What's hot

PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014Metwalley Metwalley
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)鋒博 蔡
 
2018 07-cooper surgical-santiago munne_02072018
2018 07-cooper surgical-santiago munne_020720182018 07-cooper surgical-santiago munne_02072018
2018 07-cooper surgical-santiago munne_02072018Santiago Munne
 
PGD X-Linked™ - PGD for X-linked diseases
PGD X-Linked™ - PGD for X-linked diseasesPGD X-Linked™ - PGD for X-linked diseases
PGD X-Linked™ - PGD for X-linked diseasesINVICTA GENETICS
 
Preimplantation genetic screening
Preimplantation genetic screeningPreimplantation genetic screening
Preimplantation genetic screeningTevfik Yoldemir
 
Preimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-ViafetPreimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-ViafetMetwalley Metwalley
 
Preimplantation genetic testinng
Preimplantation genetic testinngPreimplantation genetic testinng
Preimplantation genetic testinngOsama Abdalmageed
 
Pre-implantation Genetic Diagnosis ( PGD )
Pre-implantation  Genetic Diagnosis ( PGD )Pre-implantation  Genetic Diagnosis ( PGD )
Pre-implantation Genetic Diagnosis ( PGD )Marwan Alhalabi
 
Preimplantation Genetics: A 25-Year Perspective
Preimplantation Genetics: A 25-Year PerspectivePreimplantation Genetics: A 25-Year Perspective
Preimplantation Genetics: A 25-Year PerspectiveProfessor Alan H Handyside
 
Preimplantation genetic diagnosis
Preimplantation genetic diagnosisPreimplantation genetic diagnosis
Preimplantation genetic diagnosisSandesh Kamdi
 
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)Andreu Paytuví
 
Munne Array Cgh Update 2010 05
Munne Array Cgh Update 2010 05Munne Array Cgh Update 2010 05
Munne Array Cgh Update 2010 05smunne
 
Pre genetic screen (1)pgs
Pre genetic screen (1)pgsPre genetic screen (1)pgs
Pre genetic screen (1)pgs鋒博 蔡
 

What's hot (19)

PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014PGT Applications and Biopsy procedures - COOK Media workshop- Dubai  2014
PGT Applications and Biopsy procedures - COOK Media workshop- Dubai 2014
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)
 
2018 07-cooper surgical-santiago munne_02072018
2018 07-cooper surgical-santiago munne_020720182018 07-cooper surgical-santiago munne_02072018
2018 07-cooper surgical-santiago munne_02072018
 
PGD X-Linked™ - PGD for X-linked diseases
PGD X-Linked™ - PGD for X-linked diseasesPGD X-Linked™ - PGD for X-linked diseases
PGD X-Linked™ - PGD for X-linked diseases
 
Preimplantation genetic screening
Preimplantation genetic screeningPreimplantation genetic screening
Preimplantation genetic screening
 
Preimplantation genetic diagnosis (pgd) PGD
Preimplantation genetic diagnosis (pgd) PGDPreimplantation genetic diagnosis (pgd) PGD
Preimplantation genetic diagnosis (pgd) PGD
 
Preimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-ViafetPreimplantation Genetic Testing-Viafet
Preimplantation Genetic Testing-Viafet
 
35170
3517035170
35170
 
Preimplantation genetic testinng
Preimplantation genetic testinngPreimplantation genetic testinng
Preimplantation genetic testinng
 
Pre-implantation Genetic Diagnosis ( PGD )
Pre-implantation  Genetic Diagnosis ( PGD )Pre-implantation  Genetic Diagnosis ( PGD )
Pre-implantation Genetic Diagnosis ( PGD )
 
Preimplantation Genetics: A 25-Year Perspective
Preimplantation Genetics: A 25-Year PerspectivePreimplantation Genetics: A 25-Year Perspective
Preimplantation Genetics: A 25-Year Perspective
 
PGS-NGS 360°™
PGS-NGS 360°™PGS-NGS 360°™
PGS-NGS 360°™
 
Preimplantation genetic diagnosis
Preimplantation genetic diagnosisPreimplantation genetic diagnosis
Preimplantation genetic diagnosis
 
Recent advances in PGT
Recent advances in PGTRecent advances in PGT
Recent advances in PGT
 
Knl wells
Knl wellsKnl wells
Knl wells
 
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
Application of NGS technologies to Preimplantation Genetic Diagnosis (PGD)
 
PGD-ONE FM™
PGD-ONE FM™PGD-ONE FM™
PGD-ONE FM™
 
Munne Array Cgh Update 2010 05
Munne Array Cgh Update 2010 05Munne Array Cgh Update 2010 05
Munne Array Cgh Update 2010 05
 
Pre genetic screen (1)pgs
Pre genetic screen (1)pgsPre genetic screen (1)pgs
Pre genetic screen (1)pgs
 

Similar to Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders

Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)鋒博 蔡
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)鋒博 蔡
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)t7260678
 
Dr. irene souter pgd stickler foundation (5)
Dr. irene souter pgd stickler foundation (5)Dr. irene souter pgd stickler foundation (5)
Dr. irene souter pgd stickler foundation (5)t7260678
 
Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)鋒博 蔡
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)鋒博 蔡
 
Dr. irene souter pgd stickler foundation (3)
Dr. irene souter pgd stickler foundation (3)Dr. irene souter pgd stickler foundation (3)
Dr. irene souter pgd stickler foundation (3)t7260678
 
Dr. irene souter pgd stickler foundation
Dr. irene souter pgd stickler foundationDr. irene souter pgd stickler foundation
Dr. irene souter pgd stickler foundationt7260678
 
Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)t7260678
 
Dr. irene souter pgd stickler foundation (4)
Dr. irene souter pgd stickler foundation (4)Dr. irene souter pgd stickler foundation (4)
Dr. irene souter pgd stickler foundation (4)t7260678
 
Dr. irene souter pgd stickler foundation (6)
Dr. irene souter pgd stickler foundation (6)Dr. irene souter pgd stickler foundation (6)
Dr. irene souter pgd stickler foundation (6)t7260678
 
Dr. irene souter pgd stickler foundation (7)
Dr. irene souter pgd stickler foundation (7)Dr. irene souter pgd stickler foundation (7)
Dr. irene souter pgd stickler foundation (7)t7260678
 
Pgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastakiPgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastaki鋒博 蔡
 
Pgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastakiPgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastaki鋒博 蔡
 
Screening methods- Genetic Testing counselling.pptx
Screening methods- Genetic Testing counselling.pptxScreening methods- Genetic Testing counselling.pptx
Screening methods- Genetic Testing counselling.pptxebinroshan07
 
Clinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningClinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningSri Ambati
 
Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...
Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...
Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...National Osteoporosis Society
 
Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...
Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...
Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...Fundación Ramón Areces
 
Presentation on Preimplantation Genetic Diagnosis (PGD)
Presentation on Preimplantation Genetic Diagnosis (PGD)Presentation on Preimplantation Genetic Diagnosis (PGD)
Presentation on Preimplantation Genetic Diagnosis (PGD)Dr.Laxmi Agrawal Shrikhande
 

Similar to Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders (20)

Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)
 
Dr. irene souter pgd stickler foundation (5)
Dr. irene souter pgd stickler foundation (5)Dr. irene souter pgd stickler foundation (5)
Dr. irene souter pgd stickler foundation (5)
 
Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)
 
Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)Dr. irene souter pgd stickler foundation (2)
Dr. irene souter pgd stickler foundation (2)
 
Dr. irene souter pgd stickler foundation (3)
Dr. irene souter pgd stickler foundation (3)Dr. irene souter pgd stickler foundation (3)
Dr. irene souter pgd stickler foundation (3)
 
Dr. irene souter pgd stickler foundation
Dr. irene souter pgd stickler foundationDr. irene souter pgd stickler foundation
Dr. irene souter pgd stickler foundation
 
Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)Dr. irene souter pgd stickler foundation (1)
Dr. irene souter pgd stickler foundation (1)
 
Dr. irene souter pgd stickler foundation (4)
Dr. irene souter pgd stickler foundation (4)Dr. irene souter pgd stickler foundation (4)
Dr. irene souter pgd stickler foundation (4)
 
Dr. irene souter pgd stickler foundation (6)
Dr. irene souter pgd stickler foundation (6)Dr. irene souter pgd stickler foundation (6)
Dr. irene souter pgd stickler foundation (6)
 
Dr. irene souter pgd stickler foundation (7)
Dr. irene souter pgd stickler foundation (7)Dr. irene souter pgd stickler foundation (7)
Dr. irene souter pgd stickler foundation (7)
 
Pgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastakiPgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastaki
 
Pgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastakiPgd an overview_dr.laila_bastaki
Pgd an overview_dr.laila_bastaki
 
Screening methods- Genetic Testing counselling.pptx
Screening methods- Genetic Testing counselling.pptxScreening methods- Genetic Testing counselling.pptx
Screening methods- Genetic Testing counselling.pptx
 
Clinical Decision Making with Machine Learning
Clinical Decision Making with Machine LearningClinical Decision Making with Machine Learning
Clinical Decision Making with Machine Learning
 
Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...
Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...
Osteoporosis 2016 | From family history to epigenetics of osteoporosis: Dr Ni...
 
Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...
Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...
Faisal Ahmed - Una aproximación sistemática a las diferencias del desarrollo ...
 
Presentation on Preimplantation Genetic Diagnosis (PGD)
Presentation on Preimplantation Genetic Diagnosis (PGD)Presentation on Preimplantation Genetic Diagnosis (PGD)
Presentation on Preimplantation Genetic Diagnosis (PGD)
 
Future of pnd - Eurocat 2011
Future of pnd - Eurocat 2011Future of pnd - Eurocat 2011
Future of pnd - Eurocat 2011
 

More from Maryam Rafati

Personalized Medicine in Diagnosis and Treatment of Cancer
Personalized Medicine in Diagnosis and Treatment of Cancer Personalized Medicine in Diagnosis and Treatment of Cancer
Personalized Medicine in Diagnosis and Treatment of Cancer Maryam Rafati
 
Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion Maryam Rafati
 
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...Maryam Rafati
 
Genetics in Congenital Disorders of the Gastrointestinal Tract
Genetics in Congenital Disorders of the Gastrointestinal TractGenetics in Congenital Disorders of the Gastrointestinal Tract
Genetics in Congenital Disorders of the Gastrointestinal TractMaryam Rafati
 
Genetics in Congenital Disorders of the Urinary Tract
Genetics in Congenital Disorders of the Urinary TractGenetics in Congenital Disorders of the Urinary Tract
Genetics in Congenital Disorders of the Urinary Tract Maryam Rafati
 
"Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop...
"Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop..."Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop...
"Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop...Maryam Rafati
 

More from Maryam Rafati (7)

Personalized Medicine in Diagnosis and Treatment of Cancer
Personalized Medicine in Diagnosis and Treatment of Cancer Personalized Medicine in Diagnosis and Treatment of Cancer
Personalized Medicine in Diagnosis and Treatment of Cancer
 
Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion Prenatal diagnosis, case discussion
Prenatal diagnosis, case discussion
 
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
Preimplantation Genetic Diagnosis using Next Generation Sequencing for Social...
 
Genetics in Congenital Disorders of the Gastrointestinal Tract
Genetics in Congenital Disorders of the Gastrointestinal TractGenetics in Congenital Disorders of the Gastrointestinal Tract
Genetics in Congenital Disorders of the Gastrointestinal Tract
 
Genetics in Congenital Disorders of the Urinary Tract
Genetics in Congenital Disorders of the Urinary TractGenetics in Congenital Disorders of the Urinary Tract
Genetics in Congenital Disorders of the Urinary Tract
 
"Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop...
"Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop..."Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop...
"Familial" versus "sporadic" Intellectual Disability: Contribution of DNA Cop...
 
Test for ss
Test for ssTest for ss
Test for ss
 

Recently uploaded

VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...narwatsonia7
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipurparulsinha
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...Garima Khatri
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatorenarwatsonia7
 
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls ServiceKesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Servicemakika9823
 
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...Miss joya
 
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service BangaloreCall Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalorenarwatsonia7
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...astropune
 
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Miss joya
 
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...narwatsonia7
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.MiadAlsulami
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoybabeytanya
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Miss joya
 
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...narwatsonia7
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiAlinaDevecerski
 
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoybabeytanya
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...narwatsonia7
 
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...Call girls in Ahmedabad High profile
 
Call Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night Enjoy
Call Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night EnjoyCall Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night Enjoy
Call Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night Enjoynarwatsonia7
 

Recently uploaded (20)

VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
 
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
VIP Mumbai Call Girls Hiranandani Gardens Just Call 9920874524 with A/C Room ...
 
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service CoimbatoreCall Girl Coimbatore Prisha☎️  8250192130 Independent Escort Service Coimbatore
Call Girl Coimbatore Prisha☎️ 8250192130 Independent Escort Service Coimbatore
 
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls ServiceKesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
 
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
College Call Girls Pune Mira 9907093804 Short 1500 Night 6000 Best call girls...
 
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service BangaloreCall Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
Call Girl Bangalore Nandini 7001305949 Independent Escort Service Bangalore
 
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
Best Rate (Hyderabad) Call Girls Jahanuma ⟟ 8250192130 ⟟ High Class Call Girl...
 
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
 
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...High Profile Call Girls Coimbatore Saanvi☎️  8250192130 Independent Escort Se...
High Profile Call Girls Coimbatore Saanvi☎️ 8250192130 Independent Escort Se...
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
 
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
Russian Call Girls in Pune Riya 9907093804 Short 1500 Night 6000 Best call gi...
 
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
Russian Call Girls in Bangalore Manisha 7001305949 Independent Escort Service...
 
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls DelhiRussian Escorts Girls  Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
Russian Escorts Girls Nehru Place ZINATHI 🔝9711199012 ☪ 24/7 Call Girls Delhi
 
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
 
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...Bangalore Call Girls Hebbal Kempapura Number 7001035870  Meetin With Bangalor...
Bangalore Call Girls Hebbal Kempapura Number 7001035870 Meetin With Bangalor...
 
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
Call Girls Service Navi Mumbai Samaira 8617697112 Independent Escort Service ...
 
Call Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night Enjoy
Call Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night EnjoyCall Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night Enjoy
Call Girls Yelahanka Bangalore 📲 9907093804 💞 Full Night Enjoy
 

Preimplantation Genetic Diagnosis (PGD) of a wide range of single gene disorders