This document is a thesis submitted by Logan Belnap for a Masters of Science degree. It investigates the interaction between the alpha2c and beta2 adrenergic receptor heterodimer and its effect on receptor regulation. Specifically, it aims to demonstrate the interaction between the alpha2c and beta2 receptors and establish the role this interaction plays in receptor regulation. The introduction provides background on G-protein coupled receptors and discusses previous research demonstrating the alpha2c receptor is "rescued" and expressed on the cell surface only when co-expressed with the beta2 receptor, suggesting an interaction. The methods and materials section describes the cell culture, transfection, cAMP assay, immunofluorescence microscopy, and DNA extraction procedures used in the

1. Interactions between the Alpha2c and B2 Adrenergic Receptor Heterodimer and Its Effect on
Receptor Regulation
By:
Logan Belnap
Bachelor of Sciences
Brigham Young University-Idaho
2012
A thesis submitted in partial fulfillment
Of the requirements for the
Masters of Science in Medical Health Sciences Degree
Department of Basic Science
College of Osteopathic Medicine
Touro University Nevada
May 2015

3. BELNAP 2
ACKNOWLEDGEMENTS:
I would like to acknowledge Dr. Steven Prinster for allowing me to be a part of his research
team and for the opportunity to explore the intricacies of scientific research with such a
project.
I would like to acknowledge Dr. Xia Wang for the many hours of lab work and instruction she
provided throughout the project.

4. BELNAP 3
TABLE OF CONTENTS:
Title page…………………………………………………………………………………………………………….1
Signature page……………………………………………………………………………………….……………2
Acknowledgements…………………………………………………………………………………………….3
Table of contents………………………………………………………….…………………………………….4
Abstract………………………………………………………………………………………………………………5
Introduction………………………………………………………………………………………………………..6
Methods and Materials……………………………………………………………………………………..11
Results………………………………………………………………………………………………………………16
Discussion…………………………………………………….…………………………………………………..24
Literature Citation……………………………………………………………………………………………. 30

5. BELNAP 4
Interactions between the α2c and β2 adrenergic receptor heterodimer and its effect on
receptor regulation
A. ABSTRACT
G-protein coupled receptors (GPCR’s) are surface receptors responsible for the alteration of
many physiological changes within a cell. Specifically, the alpha2c (α2c) and beta2 (β2)
adrenergic receptors (AR) play an important role in cell signaling in response to catacholamines
yet, the physiological interaction between the two has yet to be identified nor, the regulation of
these receptors in response to their interactions. Previous studies have demonstrated poor
surface expression of the α2c receptors when expressed alone but, when expressed in tandem
with the β2 receptors there was a demonstrated “rescue” of the α2creceptor. This co-
expression has demonstrated that there is an interaction between the two receptors and this
interaction may have a cellular regulatory function. We will test the hypothesis that the
heterodimeric interaction between the α2c and β2 adrenergic receptors mediates a cellular and
regulatory response. Specifically, we aim to demonstrate the interaction between the α2c and
β2 adrenergic receptor heterodimers and establish the role that this interaction plays in
receptor regulation. The identification of this interaction and its regulation may demonstrate
important cellular response in regards to catacholamines thus, its impact is crucial as many
human cells both, neuronal and non-neuronal have receptors to both the α2c and β2
adrenergic receptors.

6. BELNAP 5
B.INTRODUCTION
B.1 G-protein- coupled receptors characteristics
G-protein- coupled receptors (GPCR’s) are members of a large family of cell-surface receptors
responsible for the alteration of many physiological changes within a cell [1]. GPCR’s are
transmembrane proteins and although some variations may exist, most GPCR’s contain an
amino-terminal extracellular domain and a carboxyl-terminal intracellular domain which are
connected via seven transmembrane domains [2]. These transmembrane domains contain both
hydrophilic and hydrophobic loops, which are involved in receptor function, desensitization,
and phosphorylation potential [3].
G-protein-coupled receptors are activated via ligand binding which induces a conformational
change, leading to the release of GDP and binding of GTP. This conformational change activates
the G-protein complex which activates an enzyme inducing series of second messengers that
alter cellular physiology by eliciting reactions such as smooth muscle contraction,
neurotransmitter release, and changes in heart rate and contractility, amongst others [4].
Important to the ligand binding characteristics of GPCR’S is the ligand specificity that each
receptor complex possesses leading to a wide variety of ligand and receptor types.
While there are many types of GPCR’s found in the human body, adrenergic receptors are of
great significance due to their physiological effects in response to the catacholamines
epinephrine and norepinephrine [4]. Adrenergic receptors are found throughout the human
body in a variety of tissues, including neuronal and non-neuronal [5]. Within the adrenergic
receptor family, there are two initial divisions into α and β receptors, with the α division

7. BELNAP 6
containing two subtypes α1 and α2 adrenoreceptors and the β adrenergic receptors comprised
of three subtypes: β1, β2, and β3 Adrenergic receptors [5]. The divisions and subsequent
subtypes of these receptors were based largely on the affinity of the subtypes for specific
ligands i.e. epinephrine= norepinephrine > isoproterenol for the α division and isoproterenol >
epinephrine > norepinephrine for the β division [4]. However, our current knowledge is based
on receptor sequence homology. The α2 family of receptors are largely responsible for
inhibitory functions acting to inhibit adenylyl cyclase, decrease cAMP, and activate Ca²⁺-
dependent K⁺channels [5]. Specifically, the α2creceptors can be found in the CNS where they
play crucial regulatory roles in neurotransmitter release especially in regards to noradrenaline
and serotonin [5]. Of the divisions found within the α family, the α2cadrenergic receptor has
been shown to assist in the presynaptic inhibition of norepinephrine release [3] and lacks GRK
substrates which does not allow for desensitization [4] yet, a firm determination of this
receptor’s physiological function(s) has not been identified [5]. Of the adrenergic receptors, the
β2 is the most well characterized adrenergic receptor and is located mostly in vasculature,
airway smooth muscle, and uterine cells and exhibits a high affinity for noradrenaline [5]. In
addition, the β2 receptors mediate various physiological changes that are subject to
pharmacological intervention; these include increased heart rate, smooth muscle relaxation,
and bronchodilation [5].
B.2 GPCR Heterodimerization
GPCR’shave customarily been categorized as monomers or a protein unit that does not interact
with other receptor units to produce a physiological result [2]. Yet, recent and developing
research has presented the idea that GPCRs may also act as heterodimers or, two separate

8. BELNAP 7
receptor protein units which interact, often producing distinct results [2]. This dimerization is
thought to play a role in important physiological processes for proteins such as proper
expression in a membrane, ability to induce a higher affinity to a ligand, altered signal
transduction, and receptor phosphorylation and internalization [1].
In heterodimer studies done previously, evidence suggested an interaction between µ and δ
heterodimers only when expressed concurrently and not when expression was singular [6]. This
data suggests that there is a necessary dimerization interaction between the two proteins and
that without a proper interaction and ligand(s), cellular signaling may be interrupted which
could alter the cellular response to the environment. In addition, a recent study demonstrated
the functional interaction between two angiotensin receptors (AT1 and AT2) which bind the
same ligand yet, produce different physiological results. While both of these receptors can act
as monomers with different functions, they can also induce regulatory actions on each other
when forming a heterodimer [1]. This regulatory effect is demonstrated as AT2 is constitutively
active, but is unable to bind G-proteins and is not internalized and the AT1 is able to bind G-
protein Gq. As AT1 and AT2 form a heterodimer, AT1 signaling and proliferation are inhibited by
the AT2 receptor via negative cross-talk [1]. These interactions may be similar to those of the
α2c and β2 adrenergic receptors where the normally intracellular α2c receptor is “rescued” and
expressed on the cell surface only when expressed with the β2 receptor [2].

9. BELNAP 8
B.3. Immunofluorescence Microscopy
In order to identify heterodimeric interactions, immunofluorescence microscopy was
performed to further appreciate the structural complementation and location of interacting
proteins. Immunofluorescence microscopy utilizes fluorophores, which are dyes that absorb
and consequently, emit various wavelengths of light when exposed by fluorescent stimulation
[6, 7]. Using antibodies which bind an antigen on the cell surface, and integrating a fluorophore
on those antibodies, enables the identification of cell surface molecules as well as their location
on the cell.
Figure 1. Example illustration of immunofluorescence.
The assay relies on the association between the fluorophore, the antibody, and the target
antigen of study. As the primary antibody binds the antigen, a secondary antibody attaches to
the primary. A fluorophore then attaches to the secondary antibody forming an

10. BELNAP 9
antibody/fluorophore complex [6, 7]. The sample is then visualized on a fluorescent microscope
utilizing various wavelength filters to identify cellular surface markers. The intensity of the
fluorescence or lack thereof, is correlated with interactions of the fluorophore and antibody
and the antibody with the antigen The fluorescent protein complex allows for a visualization as
one unit in a fluorescence microscope, demonstrating a location and identification of a
potential heterodimeric relationship between two proteins of interest [6-8],[9]. This assay is
very useful in identifying and demonstrating interactions and non-interactions between
proteins which is crucial to efficiency of heterodimer detection [10].
Due to their ability to potently alter physiological conditions, GPCRs are often targets for
prescription medicines that may act as agonists or antagonists [2, 11] and while GPCRs have
been widely researched, [2], [1], [12] there remain many unknowns in the areas of
heterodimers. This lack of knowledge is particularly true of the relative lack of knowledge in
regards to the requirements for co-expression of the α2c and β2 adrenergic receptor and the
effects on surface expression and internalization of receptor complexes α2cβ2. Thus, the
functionality, co-expression, and regulation of α2c and β2 adrenergic receptors must be further
explored to better understand their physiological effects.

11. BELNAP 10
C. Materials and Methods
a. Cell culture transfections.
For CHO (Chinese Ovarian Hamster) cell culture, transfected cells were maintained in complete
medium (DMEM with 10% FBS, 1% penicillin/streptomycin). Cells were incubated with 5% CO2 at
37°C. Cells were passaged when 70-80% confluent by trypsinizing the monolayer and transferring
to a new flask. For transient transfections, 80-90% confluent cells in 35mm dishes,6-well plates,
and 8-well Millicell EZslides (EMD Millipore) were incubated with 1-2 µg of DNA mixed with
Lipofectamine LTX (15 µl) (Life Technologies), Lipofectamine 3000 (15 µl) (Life Technologies), or
Jet Prime (5 µl) (Polyplus) according to manufacturer protocol in CHO complete medium. As
appropriate, cells were re-plated into appropriately-sized dishes for experiments and
observation.
For CHO-Hygromycin cell culture, transfected cells were maintained in CHO-Hygromycin medium
(400 ug Hygromycin B in 50 mL CHO complete medium). Cells were incubated with 5% CO2 at
37°C. Cells were passaged when 70-80% confluent by trypsinizing the monolayer and transferring
to a new flask. For transient transfections, 80-90% confluent cells in 35mm dishes, 6-well plates,
and 8-well Millicell EZslides (EMD Millipore) were incubated with 1-2 µg of DNA mixed with
Lipofectamine LTX (15 µl) (Life Technologies), Lipofectamine 3000 (15 µl) (Life Technologies), or
Jet Prime (5µl) (Polyplus) according to manufacturer protocol in CHO complete medium. As
appropriate, cells were re-plated into appropriately-sized dishes for experiments and
observation.

12. BELNAP 11
CHO cells were transfected with 10 µg of pGlosensor cDNA and 7.5 µL of Lipofectamine 3000 (Life
Technologies) according to the manufacturers protocol. After two days, the growth medium was
replaced with growth medium containing 0.4 mg/mL hygromycin B. A suitable clone was selected
based on low basal cAMP production (luminescence) and robust forskolin-stimulated cAMP
production, these cells are referred to as CHO-glo cells. CHO-Hygromycin cells (400 ug
Hygromycin B in 50 mL CHO complete medium) were plated on 35-mm dishes with low number
of cells per dish (high dilutions) to isolate for specific cell colonies. Colonies from 35-mm dishes
were isolated, washed, trypsinized and then re-plated onto 24-well plates and incubated 48
hours. Cells from 24-well plate were transferred to 96-well plate for cAMP assay. From the cAMP
assay only clone lines 8 and 12 demonstrated high enough cAMP values to be viable options for
further study.
b. cAMP assay
cAMP levels were measured using the cAMP-GLOTM Assay (Promega). Briefly, CHO-glo cells
transiently transfected with α2c adrenergic receptor in the absence or presence of β2
adrenergic receptor and were trypsinized, counted, and transferred to a 96-well white-wall,
clear-bottom plate. Cho-glo cells were assayed 2-3 days after plating, depending on when they
reached 90-95% confluence. 100 µL of Locke’s buffer 15.5 mL (NaCl, KCl, MgCl2, CaCl2, HEPES
and glucose) and luciferin (2.5mg) was added to the 96-well plate with incubation at room
temperature for 1 hr. The plate was then read by the plate reader every 2 minutes for 16
minutes to establish a baseline. Drugs were diluted in Locke’s buffer and added to appropriate
wells at 3-fold the desired final concentration. The plate was allowed to rest for two minutes
(to limit the observed increase in luminescence following handling of the plate), followed by 6

13. BELNAP 12
more readings with 3 minutes interval pauses. cAMP production was measured by the amount
of ATP available to stimulate the conversion of luciferin to oxyluciferin + light. The
luminescence was measured on a Varioskan Flash (Thermo).
c. Data analysis.
Statistical comparisons and analysis will be performed with Microsoft Excel (Microsoft).
d. Immunofluorescence Microscopy
Immunofluorescence microscopy was utilized to visualize fluorescence from transiently
transfected CHO cells using the Eclipse TE2000-U Inverted Microscope (Nikon). Fluorescence is
detectable using FITC, GFP, and UV-2E/C-DAPI filters which allow for detection of fluorescence
at various wavelengths Specimens were fixed with 4% paraformaldehyde (16% formaldehyde
diluted in PBS) on Millicell EZslides (Millipore) and subjected to immunohistochemistry with
rabbit Anti-α2c and mouse Anti-β2primary antibodies (Santa Cruz Biotechnology, INC) and
detected with goat anti-rabbit alexa 488 and donkey anti-mouse alexa 594 secondary
antibodies (Life Technologies) as appropriate. DAPI was also utilized for some experiments to
better identify a cell’s nucleus thus, allowing for increased surety of cell identification,
unfortunately the signal from the DAPI stain was found to interfere with observations using the
blue and green filters, limiting its usefulness. Samples were visualized first, using bright field
microscopy at 10x magnification then, using 60x magnification, samples were observed using
the various filters listed above at different exposure times (.01-10 seconds). Imaging analysis
software Metaporph (Universal Imaging) was used for identification of fluorescence intensity.

14. BELNAP 13
Images were taken and processed on photo enhancing software Photoshop (Adobe Photoshop)
to add color to represent the various filter emission wavelengths.
e. DNA Extraction
DNA and RNA extraction was performed on CHO, CHOGLO12 New, andCHO-GLO12 Old cells
which were grown to a density of 6x106 cells/ml in a T-25 flask, split, transferred to a 5 ml
centrifuge tube and centrifuged for 5 minutes at 14,000 RPM. CHO-GLO12 NEW and OLD are of
the same cell line with the “OLD” being those cells that were passaged approximately 15 times
before the NEW CHO-GLO line began passage. After centrifugation, the supernatant was
removed and discarded and the cell pellets were stored in -80 Celsius freezer. DNA and RNA
extraction were performed following AllPrep DNA/RNA/Protein Mini Handbook protocol for
DNA and RNA
f. Polymerase Chain Reaction (PCR)
The GloSensor™-22F cAMP plasmid (Promega) α2c, β2, α2c-β2 coding sequence was amplified
using polymerase chain reaction utilizing the following primers pairs (Invitrogen):
Primer Name Direction Base Pairs Sequences ( 5'-3' )
Glo-F1 Forward 225 CGCCATTCTACCCACTCGAA
Glo-R1 Reverse 225 GCAAGCTATTCTCGCTGCAC
Glo-F2 Forward 473
ACATTAAGAAGGGCCCAGCG
Glo-R2 Reverse 473
GCTTTGGAAGCCCTGGTAGT
Table. 1. Above-Primers used to amplify and bind to the GloSensorTM-22F cAMP coding region of the
pGloSensorTM-22F cAMP Plasmid in order to identify if proper transfection via PCR of receptors for either α2c, β2,
or α2c-β2 were realized.

15. BELNAP 14
The High-Fidelity DNA polymerase enzyme (New England Biolabs, Inc.) was used with reaction
buffer. Temperatures used for proper annealing were 68 °C, 70 °C, and 71 °C. PCR was
accomplished on Bio-Rad machine with the specific sequence as follows:
Temperature Time
Initial
Denaturation
98°C 30 seconds
35 Cycles 98°C 7 seconds
68-71°C 30 seconds
72°C 45 seconds
Final
Extension
72°C 2 minutes
Hold 4°C --
Table. 2. Above- PCR sequence using primers from Table 1. (step H) and DNA from DNA extraction (step G).
Gel electrophoresis was conducted on the products of the polymerase chain reactions to
identify if the GloSensorTM-22F cAMP coding region could still be identified within the CHO-
GLO12 cells using a 50kBP DNA ladder (LiCor).

16. BELNAP 15
C. RESULTS
A. CAMP Production of CHO-GLO8 and CHO-GLO12
cAMP levels were measured in both CHO-GLO8 and CHO-GLO12 cell clones using the same pre-
forskolin read times, post-forskolin read times, software, and protocol. In addition, both cell
lines were subjected to the same amount of stimulation time by Forskolin at varying
concentrations. The cell line with the overall higher cAMP levels when subjected to Forskolin
stimulation at varying concentrations were selected to conduct further cAMP studies involving
either α2cUK14304, an α2c agonist or isoproterenol, a β2 agonist. Wells with either no cells or
no treatment in both cell lines produced levels of oxyluciferin, and very low relative light units
(RLUs) even after forskolin stimulation. CHO-GLO 12 cells were found to stimulate cAMP
production maximally from four minutes after the addition of forskolin until 6-8 minutes. The
maximal activation of the CHO-GLO 8 cell line occurred at T=4, with readings of 375 relative
light units (RLUs) at a concentration of 3x10-5.5 M forskolin ( Figure 1). Similarliry, maximal
activation of the CHO-GLO 12 cell line occurred at T=6, with readings of 750 relative light units
(RLUs) at concentration 3x10-5 M forskolin ( Figure 2). Following maximal activation in both cell
lines, RLUs declined minimally untill the final read at T=10.

17. BELNAP 16
Figure.1. Above-CHO-GLO 8 cAMP levels before and after addition of Forskolin at varying concentrations using
logarithmic dilutions with concentration 30 representing 3x10 -5
M, 10 representing 3x10-5.5
M, 3 representing 3x10-
6
M, and 1 representing 3x10-6.5
. Data is from a single experiment performed in triplicate.
Figure 2. Above-CHO-GLO 12 cAMP levels before and after addition of Forskolin at varying concentrations using
logarithmic dilutions; with concentration 30 representing 3x10 -5
M, 10 representing 3x10-5.5
M, 3 representing 3x10-
6
M, and 1 representing 3x10-6.5
M. Data are from a single experiment performed in triplicate.
-50
0
50
100
150
200
250
300
350
400
t=-2 t=0 t=2 t=4 t=6 t=8 t=10
RelativeLightUnit(RLU)
Time (min)
CHO-GLO 8 cAMP Levels
No Cells No Trxt 1 3 10 30
0
100
200
300
400
500
600
700
800
t=2 t=0 t=2 t=4 t=6 t=8 t=10
RelativeLightUnit(RLU)
Time (min)
CHO-GLO 12 cAMP Levels
No Cells No Trxt 1 3 10 30
Forskolin Added

18. BELNAP 17
B. CAMP Production of CHO-GLO and CHO-GLO12 transfected with α2c/β2 DNA
The cell line CHO-GLO12 was chosen as previously mentioned (Figure 2.) for its enhanced
response to Forskolin over similar CHO-GLO clones. CAMP was measured in cells co-transfected
with 2c and 2 and without transfection. Cells were exposed to either the α2c– agonist
UK14304 (10µl/1ml LucLockes+Forskolin) or the β2 –agonist isoproterenol (10µl/1ml
LucLockes+Forskolin). cAMP levels were measured 6 times with 2 minutes pause intervals to
establish a baseline then, Forskolin and drugs were added and cAMP levels were measured 6
more times with 3 minute intervals. Averages of all the measurements were calculated
according to cell type and treatment. The averages of baseline reads 1, 3 and, 4 were calculated
which, represent the total baseline. Also, the averages of the post treatment reads 9, 10, and
11 were calculated which, represent the ability of the agonist to activate their respective
receptors. Finally, the averages of the post reads were divided by the pre reads to normalize
the data and then divided by the forskolin amounts to convert the measurements to “%
forskolin stimulation” (Figure 3). Wells in which no cells were added or no forskolin was added
did not increase above basal, whereas both transfected and untransfected CHOGLO cells
responded to forskolin and drug treatment. In cells transfected with α2cand β2DNA, response
to forskolin was set to 100%. When treated with UK14304 a α2c adrenergic receptor agonist, in
the presence of forskolin, cAMP production was reduced slightly to 94.8% of the forskolin-alone
values. When treated with Isoproterenol a 2-adrenergic receptor agonist, cAMP production
increased nearly 200% compared to forskolin alone.

19. BELNAP 18
Figure. 3. Above- cAMP levels (averaged) of pre and post-reads divided by forskolin averages of both CHO-GLO and
CHO-GLO12 transfected with α2c/β2 in response to Isoproterenol (10µl/1ml LL+F) and UK (10µl/1ml LL+F)
adrenergic agonists, and Forskolin (3x10-5
M). Data represent 2 experiments performed in triplicate.
C. PCR of CHO, CHO-GLO12 NEW, and CHO-GLO12 OLD
PCR was performed on DNA samples of CHO, CHO-GLO12 NEW, and CHO-GLO12 OLD as
pictured below in Figure 3. CHO-GLO12 NEW and OLD are of the same cell line with the “OLD”
being those cells that were passaged approximately 15 times before the NEW CHO-GLO line
began passage. In several cAMP experiments using the CHO-GLO12 OLD cells, it appeared that
these cells no longer responded to forskolin. CHO cells are regular cells without the GloSensor
plasmid that was stably transfected into the CHO-GLO cell line. Lanes containing Pglo which are
the original plasmid DNA served as positive controls, whereas lanes containing water only,
served as negative controls. A DNA ladder was added to the final lane for comparability of PCR
-50
0
50
100
150
200
250
No Cells No Treatment Forskolin Forskolin UK Forskolin ISO
%Forskolin
Treament
Averages of Post and Pre- Reads / Forskolin
CHOGLO A2cB2

20. BELNAP 19
product sizes following PCR sequence. PCR was employed to determine if the CHO-GLO12 cells
which had previously been stably transfected, retained the foreign GloSensor TM 22-F plasmid
throughout passaging. 2 pairs of DNA primers specific for sequences that were identified to be
contained within the GloSensor plasmid were ordered and used to confirm the presence of the
GloSensor plasmid; with Primer pair F1-R1 being 225 base pairs long and the F2-R2 primer pair
being 473 base pairs long. CHOGLO OLD 1 and CHOGLO NEW 1 were both observed to contain
the F1-R1 primer pair after PCR annealing. Both CHOGLO OLD 2 and CHOGLO NEW 2 were
positive for the primer pair F2-R2 after PCR sequencing. The CHO 2, CHOGLO OLD, and NEW
lanes were observed to contain markers at various base pairs however, they were not located
in the range of the primers pairs.
Figure. 4. Above- PCR gel of CHO-GLO12 Old and New in response to DNA extraction and GloSensor
primer annealing. Positive controls are Pglo1 &2 (left side) and Negative controls are H20 1&2 (right
side). Primer pairs F1&R1 are 225 BP long and F2&R2 are 473 BP long. Data represent a single
experiment from a single container of cells.

21. BELNAP 20
D. IMMUNOFLOURESCENCE MICROSCOPY
Nikon Fluorescent microscope was used with B-2E, G2a, and UV filters at various
magnifications. The UV 2E filter has an excitation wavelength at 340-380 nm and an emission
wavelength at 435-485 nm which, filters out all wavelengths but blue. The B-2E filter has an
excitation wavelength at 465-495 nm and an emission wavelength at 515-555 nm which, filters
out all wavelengths but green. The G2a-filter has an excitation wavelength of 510-560 nm and
an emission wavelength of 590 nm which filters out all wavelengths but red. CHO cells were
transfected with either α2c, β2 or α2c/β2 combination and introduced to UK, Isoproterenol, or
both and then stained with either 1o or 2o, or both antibodies. 2o fluorescent antibodies for α2c-
goat anti-rabbit alexa 594 nm (red) and for β2-donkey anti-mouse alexa 488 nm (green) (Life
Technologies).
Fig. 5.Below-
- A: Transfected with α2c/ β2 20x magnification--bright field setting-.1 second exposure
- B: Untransfected CHO cells with no antibodies- 20x magnification-G2a filter 5-seconds
- C: Untransfected CHO cells with no antibodies- 20x magnification-B-2E filter 5-seconds
- D: Transfected with α2c, stained with 1o and 2o antibodies-10x magnification-G2a filter-1
second exposure
- E: Transfected with β2, stained with 1o and 2o antibodies with ISO-60x magnification-B-2E
filter-3 second
- F: Transfected with α2c/ β2, stained with 1o and 2o antibodies with UK-60x magnification-G2a
filter-6 second exposure
- G: Transfected with α2c/ β2, stained with 1o and 2o antibodies with UK-60x magnification-B-2E
filter-6 second exposure
- H: Transfected with α2c/ β2, stained with 1o and 2o antibodies with ISO-60x magnification- G2a
filter-6 second exposure
- I: Transfected with α2c/ β2, stained with 1o and 2o antibodies with ISO-60x magnification- B-2E
filter-3 second exposure

22. BELNAP 21

23. BELNAP 22

24. BELNAP 23
D. Discussion
a. CAMP Production of CHO-GLO8 and CHO-GLO12
CHO-GLO clones 8 and 12, as previously mentioned, were selected for their response to
stimulation by forskolin, which acts directly on adenylyl cyclase. However, initially more than
clones 8 and 12 were isolated and passaged yet, only clones 8 and 12 proved viable for further
study due to an equipment failure. Wells containing no cells and no treatment demonstrated
only low luminescence throughout the experiment except at T=0 when they increased slightly
then, retreated at T=2 to basal levels, likely as a result of the manual manipulation of the dish.
These observations suggest that cells do not alter RLU measurements on their own. After
allowing collection of basal rates both clones responded to forskolin stimulation at T=0 and
both increased in their response to forskolin as time progressed until approximately T=4-6
where levels began to slowly decline. This identifies the maximal activation of clone 8 at T=4
and clone 12 at T=6. Clones were subjected to the same concentration of forskolin yet, clone 12
demonstrated a higher response (750 RLUs) than did clone 8 (375 RLUs). It is interesting to note
that clone 12’s highest response to forskolin was at the highest concentration of forskolin
(3x10-5M) whereas, clones 8’s highest response was at a lower concentration (3x10-5.5M).
However, clone 8’s response to a higher concentration did not increase its response to
forskolin. For this reason, and because of the lower cAMP production, clone 12 was chosen to
pursue further experimentation with the higher concentration of forskolin. These observations
suggest that the CHO-GLO clones with the pGlo plasmid respond to stimulation by forskolin,
regardless of the concentration used, providing evidence that cAMP was produced. The
observation that cAMP was produced allowed for further progression which began by

25. BELNAP 24
transfecting the CHO-GLO clone 12 with α2c and β2 DNA to and observe if their receptors had
any effect of cAMP once activated. Only experimenting with 2 clones may be a limitation to
this study in that it only represents a small number of the clones originally selected for. Future
studies should expand the number of clones and observe their response to forskolin stimulation
to better identify what is a normal response in a large population.
b. CAMP Production of CHO-GLO and CHO-GLO12 transfected with α2c/β2 DNA
CHO- GLO clone 12 was selected for its high response to forskolin stimulation at concentration
3x10-5M, as described above. To further understand cAMP production in this CHO-GLO clone,
clones were treated with adrenergic agonists UK and ISO to determine what effects if any, they
had of cAMP production. CHO-GLO 12 clones were transfected with or α2c/β2 DNA in order to
enhance those particular cell-surface receptors, so as to study adrenergic receptor effects on
said receptors. Regular CHO-GLO cells without transfection were used as controls in addition to
wells containing no cells or cells not treated with the drugs. Wells containing no cells or cells
and no drug treatment were observed to have negligible amounts of % forskolin stimulation
after averages of post and pre-reads were taken and then divided by forskolin. This suggests
that drug treatment is required to observe higher cAMP production via % forskolin stimulation
which, does not occur on its own (see figure 3, above). Wells containing both cell lines and
treated with only forskolin were observed to increase forskolin response to a similar extent
(figure 3), which is consistent with previous findings (figures 1 and 2) [13]. Wells containing
both cells lines were treated with forskolin and UK 14304, an inhibitory adrenergic agonist for
α2c. It is unclear why untransfected CHO cells treated with UK 14304 had slightly higher levels
of cAMP production than CHO cells treated with forskolin alone, however, in cells transfected

26. BELNAP 25
with α2c and β2, cAMP production was decreased slightly but, still higher than basal rates. This
is consistent with the idea that UK 14304 inhibits cAMP production but forskolin acts directly on
adenylyl cyclase increasing cAMP production, resulting in higher % forskolin stimulation even
while the inhibitory signal is activated [2],[1],[13]. Treatment of cells with forskolin and
Isoproterenol, a β2 stimulatory adrenergic agonist, led to an increase in cAMP production from
basal but the cells transfected with the α2c and β2 DNA demonstrated a nearly 200 % forskolin
stimulation increase compared to basal rates. This is consistent with previous research
demonstrating Isoproterenol stimulates cAMP production and forskolin acting directly on
adenylyl cyclase, resulting in higher % forskolin stimulation [1, 2, 13]. These findings suggest
that the CHO-GLO 12 cells were successfully transfected with α2c and β2 DNA which, produced
cellular surface receptors that then, responded to drug stimulation. In addition, transfected
cells responded to treatments to drugs that targeted two different receptors suggesting a
relationship between the two receptors. The poor inhibition of cAMP production with UK 14304
treatment was Further studies should observe the effects of simultaneous treatment of both
adrenergic agonists on cAMP response.
c. PCR of CHO, CHO-GLO12 NEW, and CHO-GLO12 OLD
PCR results for the CHO, CHO-GLO12 NEW and OLD were satisfactory in regards to the
demonstrating of the added primers F1-R1 and F2-R2. Both primer pairs are observed at 225
base pairs long and 473 base pairs long, respectively on PCR gel (figure4). In comparison with
the DNA ladder, (figure 4) this suggests the primers annealed with the GloSensor plasmid in
both CHO-GLO12 OLD and NEW. Specific DNA markers also were observed in lanes CHO2 and
CHOGLOW OLD 2 and NEW 2 however, the markers do not appear to be associated with any of

27. BELNAP 26
the primers. It is more likely that the observed DNA markers are inherent to CHO cells in that,
both the CHO and CHO-GLOW contain this marker which, is separate from the primers. The
observation of primers in the PCR gel suggest that the stably transfected GloSensor plasmid
remained in the cells throughout passaging and experimentation. Due to technical difficulties,
Western blotting and Co-Immunoprecipitation experiments were not performed but should be
explored in future experiments to help solidify previous findings.
d. Immunofluorescence Microscopy
CHO cells that were transfected with either α2c, β2 or α2c/β2 combination using the protocol
aforementioned in materials and methods- part D, were utilized as our controls with cells being
subjected to fluorescent antibody staining without being transfected and cells that were
transfected but, without any fluorescent antibody. Previous research in immunofluorescence
has shown that fluorescent signaling is possible when a dimer is formed from separate proteins
and the lack of a signal is indicative of a non-dimer forming complex[6] [8],[9]. Utilizing an
inverted fluorescent microscope (Nikon) with various optic lenses (10x-60 x) and varying
exposure times (1-10 seconds) as well as three different filters (UV, G2a, and B2-E) indicates
transmission of strong signals; refer to results section- part D, figure 4. The strong and
successful fluorescent signal observed, confirms that the transfection protocols are accurate as
well as the observation of an interaction between two separate protein complexes.
CHO cells which were transfected with the α2c/β2 combination and stained with primary
antibodies and fluorescent secondary antibodies were observed to fluoresce in both the G2a
and B2-E filters suggesting heterodimerization of the two receptors (figure 4- images C and D).

28. BELNAP 27
Whereas, in cells transfected with only α2cor β2, fluorescence can only be observed under one
filter setting (figure 4- images G and H). Untransfected CHO cells subjected to the same staining
protocols demonstrated no fluorescent signal in either wavelength setting (figure 4- image
I).These findings suggest that heterodimerization does occur between the α2cAR and β2 AR in
vivo. In addition, cells treated with Isoproterenol (figure 4- images C,D and H) were observed at
60X magnification with punctate spot on their membranes possibly indicating cellular response
to the agonist. Cells treated with UK (figure 4- images E and F) were also observed at 60X on
magnification with punctate spots on their membranes, albeit less than those treated with
Isoproterenol. It is hypothesized that receptor internalization occurs in response to adrenergic
agonists [1] yet, in regards to our observations, it is unclear if and when internalization do
occur. Future studies may include observation of specimens at 100x oil immersion to better
resolve the cellular membrane and the receptors on its surface. Also, confocal microscopy could
be utilized to view the cellular membrane from a 3-D perspective and in separate planes as it
uses a laser to capture various images in thick sections, similar to a histological analysis of a
biopsy but without the actual tissue removal [14]. This technique could provide insight as to
receptor internalization after drug treatment.
In conclusion, findings within in this study suggest a heterodimerization between the α2c and
β2 adrenergic receptors in CHO and CHO-GLO cells. cAMP levels were increased in response to
transfected receptor activation and immunofluorescence microscopy images suggest a
proximity relationship between the two receptors. These results will add to the current
knowledge of the α2c and β2 adrenergic receptors and further the understanding of their roles
in cellular signaling.

29. BELNAP 28
Literature Citations
[1] Strosberg AD, Nahmias C. G-protein-coupled receptor signalling through protein networks.
Biochemical Society transactions. 2007;35:23-7.
[2] Prinster SC, Hague C, Hall RA. Heterodimerization of g protein-coupled receptors: specificity and
functional significance. Pharmacological reviews. 2005;57:289-98.
[3] Flordellis C, Manolis A, Scheinin M, Paris H. Clinical and pharmacological significance of alpha2-
adrenoceptor polymorphisms in cardiovascular diseases. International journal of cardiology.
2004;97:367-72.
[4] Saunders C, Limbird LE. Localization and trafficking of alpha2-adrenergic receptor subtypes in cells
and tissues. Pharmacology & therapeutics. 1999;84:193-205.
[5] Emma Robinson AH. Adrenoreceptor Pharmocology Tocris Review. 2000:6.
[6] Aoki V, Sousa Jr JX, Fukumori LMI, Périgo AM, Freitas EL, Oliveira ZNP. Imunofluorescência direta e
indireta. Anais Brasileiros de Dermatologia. 2010;85:490-500.
[7] Wählby C, Erlandsson F, Bengtsson E, Zetterberg A. Sequential immunofluorescence staining and
image analysis for detection of large numbers of antigens in individual cell nuclei. Cytometry.
2002;47:32-41.
[8] Kodama Y, Hu CD. Bimolecular fluorescence complementation (BiFC): a 5-year update and future
perspectives. Biotechniques. 2012;53:285-98.
[9] Mo S-T, Chiang S-J, Lai T-Y, Cheng Y-L, Chung C-E, Kuo SCH, et al. Visualization of Subunit Interactions
and Ternary Complexes of Protein Phosphatase 2A in Mammalian Cells. PLoS ONE. 2014;9:e116074.

30. BELNAP 29
[10] Förg T, Hafner M, Lux A. Investigation of Endoglin Wild-Type and Missense Mutant Protein
Heterodimerisation Using Fluorescence Microscopy Based IF, BiFC and FRET Analyses. PLoS ONE.
2014;9:e102998.
[11] Drews J. Genomic sciences and the medicine of tomorrow. Nature biotechnology. 1996;14:1516-8.
[12] Milligan G. A day in the life of a G protein-coupled receptor: the contribution to function of G
protein-coupled receptor dimerization. British journal of pharmacology. 2008;153 Suppl 1:S216-29.
[13] Goueli SaH, Kevin PROMEGA Corporation. MONITORING THE ACTIVITY OF G PROTEIN-COUPLED
RECEPTORS (GPCRS) MODULATED BY LIPID OR FREE FATTY ACID AGONISTS. CELL NOTES: Promega;
2009. p. 16.
[14] Hallani SE, Poh CF, Macaulay CE, Follen M, Guillaud M, Lane P. Ex vivo Confocal Imaging with
Contrast Agents for the Detection of Oral Potentially Malignant Lesions. Oral oncology. 2013;49:582-90.