1. CONCLUSIONS
•ZoeJ is a Siphoviridae mycobacteriophage that has the ability to
lyse M. smegmatis.
•ZoeJ is part of the K2 cluster, along with mycobacteriophages
Mufasa and TM4.
•ZoeJ contains an integrase that is not present in
mycobacteriophage TM4.
•ZoeJ contains a sequence nearly identical to the identified core
site of CrimD.
•Results suggest that the integrase in ZoeJ is functional.
Figure 1: K2 Subcluster Mycobacteriophages ZoeJ and TM4
Have Different Life Cycles
INTRODUCTION
Diseases including tuberculosis and leprosy are major
medical challenges caused by mycobacteria. These pathogenic
bacteria are developing strains resistant to current drug treatment,
which has become a frequent issue in modern healthcare. New
treatment options such as phage therapy, which involves targeting
and lysing harmful bacteria with specific viruses, could provide a
more permanent solution to this problem. Mycobacteriophages are
currently being studied for potential use in phage therapy.
We are researching mycobacteriophages that infect
Mycobacterium smegmatis, a close relative of Mycobacterium
tuberculosis and Mycobacterium leprae. ZoeJ is a
mycobacteriophage that has been isolated and characterized as a K2
subcluster phage. K2 is a new subcluster consisting of phages
ZoeJ, Mufasa, and TM4. Genomic comparison has revealed a gene
sequence in ZoeJ containing an integrase which is absent from
TM4. The presence of this integrase potentially enables ZoeJ to
form lysogens. A number of possible evolutionary pathways could
be proposed to explain this significant genomic difference within
the K2 subcluster.
Isolation and Characterization of Mycobacteriophage ZoeJ, a K2 Cluster Phage
Shelby Scola2, Eric Lebel2, Alicia Jancevski2, Sean Goralski2, Melissa Brown1, William Cavedon1, Heloise Dubois1, Michelle Fernando1, Christina Perri1, Seth Pinches1,
Stephen Rogers1, Nicanor Austriaco, O.P.1, and Kathleen Cornely2
1Department of Biology, Providence College, Providence, RI 02918
2Department of Chemistry and Biochemistry, Providence College, Providence, RI 02918
Figure 2: ZoeJ is a Siphoviridae Mycobacteriophage
Figure 3: Dotplot Reveals a Missing DNAsegment in TM4
ZoeJ TM4
Figure 1: ZoeJ is likely lysogenic and forms turbid plaques, while TM4 is
lytic and forms clear plaques with distinct edges.
Figure 2: EM photos indicate that ZoeJ has a long, flexible non-
contractile tail of approximately 190 nm and a head diameter of
approximately 60 nm.
Figure 4: The Novel K2 Subcluster Consists of Mycobacteriophages Mufasa, ZoeJ, and TM4
Figure 4: The gene map created by SEA Phamerator shows
purple regions which indicate conserved homologous
sequences among the K2 subcluster phages. ZoeJ and Mufasa
differ from TM4 in that they both have an integrase gene,
which enables their genetic material to be incorporated into the
host DNA, a key feature of the lysogenic cycle.
ABSTRACT
Mycobacteriophages are pathogenic viruses that infect and
kill mycobacteria, many of which cause diseases including
tuberculosis and leprosy. Mycobacteriophage ZoeJ was isolated
from a soil sample at Providence College via an enrichment
procedure. Plaque morphology and electron microscopy photos
suggest that ZoeJ is a siphoviridae lysogenic phage. DNA
sequencing and annotation of the genome indicates ZoeJ contains
57,315 bp and 92 probable genes. Based on homology, ZoeJ has
been assigned to the K2 subcluster, a new subcluster consisting of
ZoeJ, Mufasa, and TM4. Genomic comparison of the K2 subcluster
has revealed a gene sequence containing an integrase which is
present in both ZoeJ and Mufasa, yet absent from TM4. Immunity
assay results suggest that the integrase of ZoeJ is functional,
allowing it to form lysogens. The putative attP/attB sites of phage
integration have been identified for both ZoeJ and Mufasa.
ACKNOWLEDGEMENTS
We would like to thank our teaching assistant, Jennifer Giulietti, for her constant guidance throughout our research. Thank you to Dr. Joseph DeGiorgis for
preparing the grids and taking the excellent electron microscopy photographs of our mycobacteriophages at The Marine Biological Laboratory at Woods Hole, MA. Thank you
to The University of Pittsburgh for sequencing ZoeJ DNA. We would also like to thank Dr. Charles Toth and Dr. Paul Czech for their constant support and assistance
throughout our research process.
Finally, this research was made possible by the NIH through the NIGMS R15 grant GM094712 (awarded to NA) and by the Davis Foundation through the Davis
Student Engagement Grant (awarded to KC). Thank you!
Figure 3: A dotplot of ZoeJ vs. TM4 and Mufasa was generated using
Gepard. ZoeJ exhibits a stronger alignment with Mufasa than TM4.
The missing sequence in TM4 corresponds to a segement in both ZoeJ
and Mufasa which contains an integrase.
Figure 5: Phylogenetic Tree of K cluster phages suggests
that TM4 and Mufasa Diverged from a Common Ancestor
Figure 5: A Phylogenetic Tree of some K Cluster
Phages was generated using ClustalW2 Multiple
Sequence Alignment. Interestingly, TM4 seems to
have diverged from Mufasa, suggesting the gene
segment containing an integrase may have been
deleted from TM4’s genome during its evolution.
Figure 6: Plate 2 Patch Test of ZoeJ Shows Signs of Phage Release
for Patches D and E, Indicating Possible Lysogen Candidate
Figure 6: 10-2 spots from ZoeJ plates were streaked out on 7H9 agar plates. A patch test was performed
on M. smegmatis colonies picked from the streak plate to test for putative lysogens. Plate 1 shows
patches on a 7H9 agar plate, while Plate 2 shows patches on a 7H9 agar plate with M. smegmatis and
top agar. Patches D and E show lysis where the patch was made, indicating a possible ZoeJ lysogen.
E D E D
Plate 1 Plate 2
Figure 7: 100-10-3 dilutions of TM4, Mufasa,
Adephagia, and ZoeJ phage lysates were spotted
on putative ZoeJ lysogen and incubated at 37 °C.
TM4, Mufasa, and Adephagia bacteriophages all
infected the ZoeJ lysogen as indicated by plaque
formation. However, ZoeJ phage did not show
visible plaques, indicating that ZoeJ phage was
unable to infect ZoeJ putative lysogen. If a
lysogen has formed, its corresponding virus should
be unable to infect the lysogen. Adephagia, a K1
phage known to form lysogens, served as a
positive control.
Figure 7: Immunity Assay Suggests ZoeJ is Able to Form Lysogen
MATERIALS AND METHODS
Mycobacterium smegmatis mc2 155 was obtained from the
American Tissue Type Collection. A sample was streaked out on an
L-agar plate (L-Agar base, 50 µg/mL CB, 10µg/mL CHX) and
incubated at 37°C. A small piece from a single colony was
transferred to a baffled flask containing 50 mL of 7H9 Complete
(7H9 liquid medium, 10% AD supplement, 50 µg/mL CB, 10µg/mL
CHX, 1mM CaCl2, 0.05% Tween 80) and incubated at 37°C for
72 hours for the P1FF culture. A volume of 1:1000 P1FF culture
was then placed in 7H9 Complete without Tween and incubated for
72 hours at 37°C for use in phage experiments. ZoeJ phage was
extracted from soil by adding enrichment buffer (7H9, 0.2%
glycerol, 0.5% albumin, 0.2% dextrose, 14.5 mM NaCl, 1mM
CaCl2) to the sample and incubating at 37°C for 24 hours. The
sample was centrifuged and filter-sterilized with a 0.2 µm filter. All
serial dilutions of phage lysate were made with phage buffer (10
mM Tris [pH 7.5], 10 mM MgSO4, 68 mM NaCl). Plaque
purification was completed with several rounds of titering and high
titer lysate was prepared. DNA was isolated using WizardPrep
(Promega). The ZoeJ genome was sequenced using ion torrent
sequencing.
Lysogens were identified by spotting 3.0 µL of ten fold serial
dilutions on a lawn of M. smegmatis. Mesas were identified and
streaked out on Luria agar plates. Patch tests were used to identify
putative lysogenic colonies by monitoring lysis on a lawn of M.
smegmatis. P2FF cultures of ZoeJ and Adephagia lysogens without
Tween were plated and spotted with 3.0 -4.0 µL of 10-fold serial
dilutions of high titer lysates of TM4, Adephagia, Mufasa, and ZoeJ
to test for immunity. DNA Master, Phamerator, and Lasergene
were used to identify the attP/attB sites in ZoeJ and Mufasa phages
and M. smegmatis, respectively.
ZoeJ
TM4
Mufasa
ZoeJ
TM4
Adephagia
Mufasa
ZoeJ
ZoeJ lysogen Adephagia lysogen M. smegmatis
GCGCCTCGACGAACGCCCCCGACCGGATCACCCGGCGGGGGCGTTTTCGT
GTCGGCAAACGGCCACCAGGGGCCTCGCCGAGCCCGCTTTCGGGACTCGG
GAGGATTACCCGGCACCCCTTGAGCTGCTACCGTTCAAGGCGTGTTGACG
ACCTGGGATTTTGCGGCGCGACCGGCGCCCGCGGCGGCCGATTTCGGGCC
GCCCAGCAAACACCTCTGCGCCTCGGCAAACTTGTGGATGCCATCCACAC
CGCCCAGGTTTTCCTGCGGATTCCGGCGTCGTTTCGCGTCGTTTCGCGTA
CCGATTTAAGGCGTTTGCGCAGGTCAGCGCCCGGATAGGACCGCGGTTCA
ATTCCCGGCAGCTCCACAAGCTAAGGCCCTGGTCAGAGCAGGTTTTCTGA
CCGGGGCCTTTTTTCGTATCCACACTCCCATCCACAAATGGGTACTATCG
GCCGCT
P1 is in blue and has 6/11 bases identical to CrimD
P2 is in purple and has 9/11 bases identical to CrimD
P3 is in green and has 8/11 bases identical to CrimD
P4 is in orange and has 8/11 bases identical to CrimD
The core is in red and has 23/24 bases identical to CrimD
The bases that are different are underlined
Figure 8: The P1, P2, P3, P4, and Core regions were
identified in ZoeJ
Figure 8: ZoeJ was sequenced, and the region between genes 42 & 43 is
shown. The sequence was compared with CrimD, a K1 cluster phage.
The P1, P2, P3, and P4 sites for integrase binding and the core region
containing the attP site were identified based on homology with CrimD.
Figure 9: BLAST of ZoeJ Core with M. smegmatis
complete sequence.
Figure 9: A Pairwise BLAST of the ZoeJ core
against M. smegmatis genome revealed a high
degree of identity with bp 216901-216923 in
M. smegmatis, suggesting that this sequence
is the attB site in the host bacteria.
M. smegmatis
ZoeJ Core