SlideShare a Scribd company logo
1 of 53
Good Morning…

1
Optimized Platelet-Rich Fibrin With the Low-
Speed Concept: Growth Factor Release,
Biocompatibility and Cellular Response
JOP 2016 – MASAKO FUJIOKA-KOBAYASHI, RICHARD J. MIRON, MARIA HERNANDEZ, UMADEVI
KANDALAM, YUFENG ZHANG, AND JOSEPH CHOUKROUN
- PRESENTED BY DR.MD ABDUL HALEEM
2
CONTENTS
• INTRODUCTION
• AIM OF THE STUDY
• MATERIALS AND METHODS
Platelet Concentrations
1. Protein Quantification With ELISA
Cell Culture
2. Cell Viability
3. Cell Migration Assay
4. Proliferation Assay
5. Real-Time PCR Analysis
3
CONTENTS
• STATISTICAL ANALYSIS
• RESULTS
• DISCUSSION
• CONCLUSION
• REFERENCES
4
INTRODUCTION
 Over 15 years ago…PRF introduced… as an autogenous
source of blood growth factors… tissue regeneration in
modern medicine.*
 This concepts… from the fact that… PRP despite bearing the
negative aspect of containing anti-coagulants… thereby
preventing the full coagulation cascade important for tissue
wound healing… was being heavy utilized in various fields of
medicine.*
 PRF (known as L-PRF)… does not contain any anti-
coagulants… provides a three-dimensional fibrin matrix…
scaffold… barrier membrane in GBR, GTR procedures.*
1. Choukroun J, Adda F, Schoeffler C, Vervelle A. Opportunities in Implant Dentistry: PRF (french). Implantodontie 2001;42:e62.
2. Marx RE. Platelet-rich plasma: evidence to support its use. Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and Maxillofacial
Surgeons 2004;62:489-496.
3. Toffler M. Guided bone regeneration (GBR) using cortical bone pins in combination with leukocyteand platelet-rich fibrin (L-PRF). Compendium of continuing education
in dentistry (Jamesburg, NJ : 1995) 2014;35:192-198.
5
INTRODUCTION 6
Aroca S, Keglevich T, Barbieri B, Gera I, Etienne D. Clinical evaluation of a modified coronally advanced flap alone or in combination with a platelet-rich fibrin membrane for the
treatment of adjacent multiple gingival recessions: a 6-month study. Journal of periodontology 2009;80:244-252.
 Since its introduction in 2001, PRF has been extensively utilized in dentistry
 Extraction socket management
 Gingival recessions
 Intrabony defect regeneration
 Sinus elevation procedures
 To accelerate wound healing process
 Major advantages… completely immune-compatible growth factors… collected at
relatively no costs… without anti-coagulants.
INTRODUCTION
 While initial and early experiments revealed that PRP contained high concentrations
of autologous growth factors… up to 6-8 times higher than normal blood
concentrations… including*
 Platelet-derived growth factor (PDGF)
 Vascular endothelial growth factor (VEGF)
 Transforming growth factor-beta1 (TGF-β1)
7
1. Peerbooms JC, van Laar W, Faber F, Schuller HM, van der Hoeven H, Gosens T. Use of platelet rich plasma to treat plantar fasciitis: design of a multi centre randomized
controlled trial. BMC Musculoskeletal Disorders 2010;11:69-69.
2. Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, et al. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations 2016.Jan 25. [Epub
ahead of print]
 PRF… shown to release even higher total
growth factors over a more extended period of
time.*
INTRODUCTION
 PRF… slower release of growth factors over time… is
the ability for the fibrin matrix to hold proteins
within its fibrin network… as well contains cells
capable of further release growth factors into their
surrounding micro-environment.*
 Leukocytes… highly important immune cells…
capable of directing and recruiting various cell
types during the wound healing process.*
8
1. Kumar RV, Shubhashini N. Platelet rich fibrin: a new paradigm in periodontal regeneration. Cell and tissue
banking 2013;14:453-463.
2. Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A. The role of leukocytes from L-PRP/L-PRF in
wound healing and immune defense: new perspectives. Current pharmaceutical biotechnology
2012;13:1153-1162.
INTRODUCTION
 Since high centrifugation forces are known to shift cell populations to the bottom of
collection tubes… whereas PRF is collected from the top one-third layer… it was
recently hypothesized that by reducing centrifugation G-force, an increase in
leukocyte numbers may be achieved within the PRF matrix.
9
Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral
implantology 2014;40:679-689.
INTRODUCTION
 It was since shown that by decreasing centrifugation g-force… now termed advanced-
PRF or A-PRF… an increase in total leukocyte numbers within PRF matrix scaffolds was
observed.
 Furthermore it was shown that the release of several growth factors including
PDGF
TGF-β1
VEGF
EGF
IGF
 were significantly higher in A-PRF when compared to L-PRF and PRP.
10
Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, et al. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations 2016.Jan 25.
AIM OF THE STUDY
 Since centrifugation… direct impact on growth factor release
from within PRF scaffolds, the aim of the present study was
to… further investigate whether centrifugation time would
similarly further improve growth factor release from within PRF
scaffolds.
 In principle… less centrifugation time would reduce cell pull-
down by centrifugation forces… which would theoretically
increase the total number of cells left contained within the top
layer (PRF matrix).
11
AIM OF THE STUDY
 Furthermore… it remains completely unknown, what changes to centrifugation
protocols will have on tissue regeneration… the effects of each PRF matrix including L-
PRF, A-PRF and A-PRF+… Is investigated for the first time on… human gingival
fibroblast cell for the biocompatibility and cell activity.
 Cells were therefore cultured with growth factors from each PRF matrix (L-PRF, A-PRF
and A-PRF+) and investigated for
cell migration
Proliferation
growth factor release
collagen synthesis
“All IN VITRO”
12
MATERIALS AND METHODS
PLATELET CONCENTRATIONS
 Blood sample… 8 volunteers…. (so 8x3=24 total samples)
 Age 30-60
 10ml of whole blood without anticoagulant was collected
 L-PRF = 2700 RPM(708g) , 12min
 A-PRF = 1300 RPM (200g) ,14min
 A-PRF+ = 1300 RPM (200g) , 8min
 Top 4ml of PRF clot is collected
 Placed into 6 well dish (24x6 = 144 total well dishes)
 With 5ml of Dulbecco's Modified Eagle Medium (DMEM) culture
media
13
MATERIALS AND METHODS
1) PROTEIN QUANTIFICATION WITH ELISA
 To determine the amount of released growth factors from L-PRF, A-PRF, and A-PRF+
 at 15 min, 60 min, 8 hours, 1 day, 3 days and 10 days
 samples placed in shaking incubator (37°C)
 To allow for growth factor release into the culture media.
 Each time point, 5ml culture media taken, frozen
 Protein quantification by ELISA
14
MATERIALS AND METHODS
PROTEIN QUANTIFICATION WITH ELISA
 Checked for
 PDGF-AA
 PDGF-AB
 PDGF-BB
 VEGF
 TGF-β1
 EGF
 IGF-1
 All samples measured in duplicate to avoid errors, 8 duplication made (144x8 =
1152 samples)
15
MATERIALS AND METHODS
CELL CULTURE
 L-PRF, A-PRF, APRF+
 Incubated for 3 days
 With 5ml of DMEM culture media
 The conditioned media is collected
 Utilized for further experiment as 20%
 Diluted with standard DMEM culture media + 15% FBS(Fetal
Bovine Serum) + 1% Antibiotics
 Human gingival fibroblasts…cultured in a humidified
atmosphere (37°C) along with growth medium consisting of
DMEM, 10% fetal bovine serum (FBS) and 1% antibiotics…
cultured cells detached using 0.25% EDTA-Trypsin… these cells
seeded into the 3 groups.
16
CELL CULTURE
 For Test Samples
 Cells seeded with 20% Conditioned Media into all
3 groups
 Along with growth medium
 Cellular density of the cultured human gingival
fibroblasts cells (24 samples)
 10,000…for checking viability
 50,000…for checking proliferation… in 24 wells
plates
 Cell quantification…. using microscope
17
MATERIALS AND METHODS
CELL CULTURE
 For Control Samples
 Cells seeded with 20% Conditioned Media into all
3 groups
 Without growth medium
 Both the test and control samples
 Left for 3 days
 On a plate shaker(37°C)
 For experiments >5days… medium replaced twice
weekly
18
MATERIALS AND METHODS
2) CELL VIABILITY
 After 24 hrs post cell seeding
 Live-dead staining assay
 Fluorescent images quantified
 Expressed as % of Living Vs Dead
19
MATERIALS AND METHODS
3) CELL MIGRATION ASSAY
 Migration assay of human gingival fibroblasts performed
 Using 24 well plates + polyethylene terephthalate, cell culture with pore size 8µm
 Conditioned media filled into lower compartment
 DMEM containing 0.5% FBS for 12hrs
20
MATERIALS AND METHODS
3) CELL MIGRATION ASSAY
 10,000 cells were filled in upper compartment
 After 24hrs
 Cells fixed with 4% formaldehyde for 2min
 cells permeabilize by acetone for 15min
 Stained with hematoxylin solution for 20min
 Upper side, rinsed, wiped gently with cotton swab
 To remove cell debris
 Number of cells on the lower compartment counted
under microscope
21
MATERIALS AND METHODS
4) CELL PROLIFERATION ASSAY
 Human gingival fibroblasts
 50,000 cells taken
 At 1,3 and 5 days
 At desired point, cells washed with
phosphate buffered solution
 Quantified for cell proliferation
 Using MTS colorimetric assay
and microplate reader
22
MATERIALS AND METHODS
REAL-TIME PCR ANALYSIS
 Human gingival fibroblasts
 At 3 and 7 day
 Total RNA harvested
 To investigate mRNA level of
 TGF-β
 PDGF
 Collagen 1a2
 RNA isolation… performed using
High Pure RNA isolation kit
23
MATERIALS AND METHODS
REAL-TIME PCR ANALYSIS
 Primer and probe sequence
Gene Primer Sequence
hTGF-β F actactacgccaaggaggtcac
hTGF-β R tgcttgaacttgtcatagatttcg
hPDGF F cacacctcctcgctgtagtattta
hPDGF R gttatcggtgtaaatgtcatccaa
hCOL1a2 F cccagccaagaactggtatagg
hCOL1a2 R ggctgccagcattgatagtttc
hGAPDH F agccacatcgctcagacac
hGAPDH R gcccaatacgaccaaatcc
24
STATISTICAL ANALYSIS
 All experiments were performed in triplicate
with three independent experiments for each
condition.
 Means and standard errors (SE) were
calculated and data were analyzed for
statistical significance using one-way analysis
for cell viability and migration assay, two-way
analysis of variance for ELISA, proliferation
assay and real time PCR analysis with Turkey
test
 p values < 0.05 was considered significant by
GraphPad Prism 6.0 software
25
RESULTS
 Growth Factor Release From PRF, A-PRF and A-PRF+
26
RESULTS
 Growth Factor Release From PRF, A-PRF and A-PRF+
27
RESULTS
 Growth Factor Release From PRF, A-PRF and A-PRF+
28
RESULTS
 Growth Factor Release From PRF, A-PRF and A-PRF+
29
RESULTS
Biocompatibility Of L-PRF, A-PRF and A-PRF+ On Human Gingival Fibroblasts
 Investigated on cell viability of human gingival fibroblasts.
 All platelet formulations… displayed excellent cell biocompatibility … high living cells
GREEN CELLS… very few observable apoptotic cells red cells.
30
RESULTS
 Influence of PRF, A-PRF and A-PRF+ on Human Gingival Fibroblast Activity
 For Cell Migration  For Cell Proliferation
31
RESULTS
 Influence of PRF, A-PRF and A-PRF+ on Human Gingival Fibroblast Activity
 For mRNA expression of growth factors and collagen
32
DISCUSSION
 The aim of the present study… was to investigate the
 Influence of centrifugation speed (g-force) and
 Time on PRF matrix scaffolds
 Their release of growth factors
 Their effect on cellular biocompatibility and activity.
 As the use of PRF has continuously and steadily increased in regenerative implant
dentistry and periodontology, there remains great clinical benefit to optimize
centrifugation protocols for clinical practice.
33
DISCUSSION
 Therefore, the aim of the present study was to investigate if… lower centrifugation
speeds and time could be additionally used to improve growth factor release and cell
bioactivity.
 One of the interesting findings from a previous study
by Ghanaati et al. found that cells quantified
histologically within the PRF matrix observed that the
majority of leukocytes were found near the bottom of
the fibrin clot in standard L-PRF.
34
Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering
by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689
DISCUSSION
 Based on this finding, it became clear that centrifugation
speeds (G-forces) were evidently too high pushing
leukocytes down to the bottom of centrifugation tubes
and away from the PRF matrix clot.
 In order to redistribute leukocyte cell numbers across the
entire PRF matrix, lower centrifugation speeds were
investigated.
 It was confirmed that higher cell number could be
obtained by reducing G-force during centrifugation.*
35
Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral
implantology 2014;40:679-689.
DISCUSSION
 Ghanaati et al. showed that while platelets were detected throughout the clot in
both groups (L-PRF and A-PRF), but more platelets were found in the distal part
of A-PRF.
 Furthermore, by decreasing the rpm while increasing the centrifugation time in
the A-PRF group, an enhanced presence of neutrophilic granulocytes in the distal
part of the clot was also observed.
 Red areas – red blood cells
 Blue areas – platelets and white blood cell
 Dark pink – dense fibrin network with
interspersed loose fibrin network
 Light pink – loose fibrin network
36
Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue
engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689
DISCUSSION
 Accordingly, it was reported that a higher
presence of these cells might be able to
influence the differentiation of host
macrophages and macrophages within the clot
after implantation.
 Thus, it was concluded that A-PRF might
influence bone and soft tissue regeneration,
especially through the presence of
monocytes/macrophages and their growth
factors.
37
Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral
implantology 2014;40:679-689
DISCUSSION
 It must also be noted that the role of
leukocytes in tissue wound healing and
bone biology has been extensively
discussed and critically important to
wound healing.
 Interesting findings from basic science now
point to the absolute necessity of
macrophages during bone tissue
remodeling and have further shown that
macrophages are responsible for a 23-fold
increase in osteoblast differentiation.
38
Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A. The role of leukocytes from L-PRP/L-PRF in wound healing and immune defense: new perspectives. Current
pharmaceutical biotechnology 2012;13:1153-1162.
DISCUSSION
 Without these key immune cells, it has been shown that bone formation has very
limited potential to generate new bone.
 Furthermore, macrophages are key players in biomaterial integration and are the
responsible cell type dictating material integration.
39
Miron RJ, Bosshardt DD. OsteoMacs: Key players around bone biomaterials. Biomaterials 2016;82:1-19.
DISCUSSION
 Therefore it becomes evident that both an
increase in leukocyte number as well as their
even distribution across the PRF scaffold as
demonstrated with lower centrifugation speeds is
highly favorable during tissue wound healing
and during biomaterial integration of collagen
barrier membranes, various classes of bone
grafting materials and potentially dental
implants.
 Future research is therefore necessary.
40
DISCUSSION
 Another important aspect of leukocyte biology that has not been discussed in
this study but again shows much clinical relevance is the fact leukocytes are the
responsible cell-type acting to prevent infiltrating pathogens.
 In light of this fact, it becomes of interest to
note that PRF placed into extraction sockets
has been shown to greatly decrease the rate
of complications and infections.
41
1. Ramilo O, Allman W, Chung W, et al. Gene expression patterns in blood leukocytes discriminate patients
with acute infections. Blood 2007;109:2066-2077.
2. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature reviews
immunology 2008;8:958-969.
DISCUSSION
 Hoaling and Lines reported that filling 3rd molar extraction sockets with PRF led to a
10 fold decrease in osteomyelitis infections when compared to natural healing.
 This study performed in 200 patients utilized bilateral extractions (one side filled with
PRF, the other left to naturally heal) providing good scientific evidence for the
reduced rate of infection following healing with PRF.
42
Hoaglin DR, Lines GK. Prevention of localized osteitis in mandibular third-molar sites using platelet-rich fibrin. International journal of dentistry 2013;2013:875380.
DISCUSSION
 One aspect that remains to be investigated is to determine…. if not only higher
concentrations of growth factors are released from the various PRF formulations,
but also if additional growth factors or cytokines may also be subsequently
released.
 Future research utilizing cytokine prolife assays comparing the various PRF
formulations would be necessary to further investigate these possible differences.
43
DISCUSSION
 Another interesting area of research that is often left unstudied is the effect of
higher than optimal doses of growth factors on tissue remodeling.
 For instance, Oshima et al. found that certain growth factors including TGF-β
and VEGF are not only capable of supporting tissue regeneration but may
also participate in tissue degradation in periodontitis.
 While in general both of these growth factors are routinely associated with
tissue regrowth (TGF-β) and angiogenesis (VEGF), it must also not be
excluded that they may also show negative effects also.
 Future research investigating the optimal growth factor concentrations from
PRF formulations remains to be determined.
44
1. Ohshima M, Yamaguchi Y, Matsumoto N, et al. TGF-beta signaling in gingival fibroblast-epithelial interaction. Journal of dental research 2010;89:1315-1321.
2. Ohshima M, Yamaguchi Y, Ambe K, et al. Fibroblast VEGF-receptor 1 expression as molecular target in periodontitis. Journal of clinical periodontology 2016;43:128-137.
DISCUSSION
 Furthermore, analysis of mRNA levels of PDGF and TGF-β also demonstrate the ability
for PRF matrix scaffolds produced with the low speed concept to significantly increase
the production of growth factors from gingival fibroblasts.
 Therefore, not only are higher quantities of PDGF and TGF-β1 found in A-PRF+
scaffolds themselves… but the cells then in contact with their matrix are also further
stimulated to release more growth factors… thus having a synergistic effect on the
total growth factors produced locally.
45
DISCUSSION
 Lastly it was also shown that A-PRF and A-PRF+ samples were able to locally
increase in collagen1 mRNA levels.
 Not surprisingly, collagen remains one of the key factors during tissue
wound healing and remodelling.*
 Therefore the increase in collagen type 1 when cells were exposed to A-PRF
and A-PRF+ further demonstrates the regenerative potential of the newer
PRF formulations centrifuged at lower g-forces and lower centrifugation
times.
46
Chattopadhyay S, Raines RT. Review collagen‐based biomaterials for wound healing. Biopolymers 2014;101:821-833.
CONCLUSION
 In summary, the results from the present study demonstrate that all formulations of
PRF matrix scaffolds including PRF, A-PRF and A-PRF+ were able to secrete the local
release of various growth factors important for tissue regeneration and A-PRF+
demonstrated significantly higher release of growth factors when compared to all
other groups.
 Furthermore, A-PRF and A-PRF+ matrix scaffolds were shown to directly impact the
ability for human gingival fibroblasts to migrate, proliferate, release additional
growth factors and increase mRNA levels of type 1 collagen.
47
CONCLUSION
 The findings from the present study demonstrate that modifications to
centrifugation speed and time with the low-speed concept favors an increase in
growth factor concentrations directly impacting human gingival fibroblasts. Future
animal and clinical studies are now needed to further confirm the effects of these
results in vivo.
48
REFERENCES
 1. Choukroun J, Adda F, Schoeffler C, Vervelle A. Opportunities in Implant Dentistry: PRF (french). Implantodontie 2001;42:e62.
 2. Anfossi G, Trovati M, Mularoni E, Massucco P, Calcamuggi G, Emanuelli G. Influence of propranolol on platelet aggregation and thromboxane B2 production
from platelet-rich plasma and whole blood. Prostaglandins, leukotrienes, and essential fatty acids 1989;36:1-7.
 3. Fijnheer R, Pietersz RN, de Korte D, et al. Platelet activation during preparation of platelet concentrates: a comparison of the platelet-rich plasma and the
buffy coat methods. Transfusion 1990;30:634-638.
 4. Marx RE. Platelet-rich plasma: evidence to support its use. Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and
Maxillofacial Surgeons 2004;62:489-496.
 5. Toffler M. Guided bone regeneration (GBR) using cortical bone pins in combination with leukocyte-and platelet-rich fibrin (L-PRF). Compendium of continuing
education in dentistry (Jamesburg, NJ : 1995) 2014;35:192-198.
 6. Lekovic V, Milinkovic I, Aleksic Z, et al. Platelet‐rich fibrin and bovine porous bone mineral vs. platelet‐rich fibrin in the treatment of intrabony periodontal
defects. Journal of periodontal research 2012;47:409-417.
 7. Shivashankar VY, Johns DA, Vidyanath S, Sam G. Combination of platelet rich fibrin, hydroxyapatite and PRF membrane in the management of large
inflammatory periapical lesion. Journal of Conservative Dentistry 2013;16:261-4.
 8. Hoaglin DR, Lines GK. Prevention of localized osteitis in mandibular third-molar sites using platelet-rich fibrin. International journal of dentistry
2013;2013:875380.
 9. Aroca S, Keglevich T, Barbieri B, Gera I, Etienne D. Clinical evaluation of a modified coronally advanced flap alone or in combination with a platelet-rich fibrin
membrane for the treatment of adjacent multiple gingival recessions: a 6-month study. Journal of periodontology 2009;80:244-252.
 10. Padma R, Shilpa A, Kumar PA, Nagasri M, Kumar C, Sreedhar A. A split mouth randomized controlled study to evaluate the adjunctive effect of platelet-rich
fibrin to coronally advanced flap in Miller's class-I and II recession defects. Journal of Indian Society of Periodontology 2013;17:631-636.
49
REFERENCES
 11. Agarwal SK, Jhingran R, Bains VK, Srivastava R, Madan R, Rizvi I. Patient-centered evaluation of microsurgical management of gingival recession using
coronally advanced flap with platelet-rich fibrin or amnion membrane: A comparative analysis. European journal of dentistry 2016;10:121-133.
 12. Agarwal A, Gupta ND, Jain A. Platelet rich fibrin combined with decalcified freeze-dried bone allograft for the treatment of human intrabony periodontal
defects: a randomized split mouth clinical trail. Acta odontologica Scandinavica 2016;74:36-43.
 13. Elgendy EA, Abo Shady TE. Clinical and radiographic evaluation of nanocrystalline hydroxyapatite with or without platelet-rich fibrin membrane in the
treatment of periodontal intrabony defects. Journal of Indian Society of Periodontology 2015;19:61-65.
 14. Medina-Porqueres I, Alvarez-Juarez P. The Efficacy of Platelet-Rich Plasma Injection in the Management of Hip Osteoarthritis: A Systematic Review
Protocol. Musculoskeletal care 2016 Jun;14(2):121-5.
 15. Salamanna F, Veronesi F, Maglio M, Della Bella E. New and emerging strategies in platelet-rich plasma application in musculoskeletal regenerative
procedures: general overview on still open questions and outlook. BioMed Research International. 2015;2015:846045.
 16. Albanese A, Licata ME, Polizzi B, Campisi G. Platelet-rich plasma (PRP) in dental and oral surgery: from the wound healing to bone regeneration.
Immunity & ageing : I & A 2013;10:23.
 17. Panda S, Doraiswamy J, Malaiappan S, Varghese SS, Del Fabbro M. Additive effect of autologous platelet concentrates in treatment of intrabony defects: a
systematic review and meta-analysis. Journal of investigative and clinical dentistry 2014.
 18. Peerbooms JC, van Laar W, Faber F, Schuller HM, van der Hoeven H, Gosens T. Use of platelet rich plasma to treat plantar fasciitis: design of a multi centre
randomized controlled trial. BMC Musculoskeletal Disorders 2010;11:69-69.
 19. Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, et al. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations
2016.Jan 25. [Epub ahead of print]
 20. Lekovic V, Milinkovic I, Aleksic Z, et al. Platelet-rich fibrin and bovine porous bone mineral vs. platelet-rich fibrin in the treatment of intrabony periodontal
defects. Journal of periodontal research 2012;47:409-417.
50
REFERENCES
 21. Panda S, Jayakumar ND, Sankari M, Varghese SS, Kumar DS. Platelet rich fibrin and xenograft in treatment of intrabony defect. Contemporary clinical
dentistry 2014;5:550-554.
 22. Pradeep AR, Rao NS, Agarwal E, Bajaj P, Kumari M, Naik SB. Comparative evaluation of autologous platelet-rich fibrin and platelet-rich plasma in the
treatment of 3-wall intrabony defects in chronic periodontitis: a randomized controlled clinical trial. Journal of periodontology 2012;83:1499-1507.
 23. Sharma A, Pradeep AR. Treatment of 3-wall intrabony defects in patients with chronic periodontitis with autologous platelet-rich fibrin: a randomized
controlled clinical trial. Journal of periodontology 2011;82:1705-1712.
 24. Kumar RV, Shubhashini N. Platelet rich fibrin: a new paradigm in periodontal regeneration. Cell and tissue banking 2013;14:453-463.
 25. Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A. The role of leukocytes from L-PRP/L-PRF in wound healing and immune defense: new
perspectives. Current pharmaceutical biotechnology 2012;13:1153-1162.
 26. Martin P. Wound healing--aiming for perfect skin regeneration. Science 1997;276:75-81.
 27. Barrick B, Campbell EJ, Owen CA. Leukocyte proteinases in wound healing: roles in physiologic and pathologic processes. Wound Repair and
Regeneration 1999;7:410-422.
 28. Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells.
The Journal of oral implantology 2014;40:679-689.
 29. Fujioka-Kobayashi M, Sawada K, Kobayashi E, Schaller B, Zhang Y, Miron RJ. Osteogenic potential of rhBMP9 combined with a bovine-derived natural
bone mineral scaffold compared to rhBMP2. Clinical oral implants research 2016.
 30. Sinder BP, Pettit AR, McCauley LK. Macrophages: Their Emerging Roles in Bone. Journal of bone and mineral research : the official journal of the American
Society for Bone and Mineral Research 2015;30:2140-2149.
51
REFERENCES
 31. Chang MK, Raggatt LJ, Alexander KA, et al. Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues and
regulate osteoblast function in vitro and in vivo. Journal of immunology (Baltimore, Md : 1950) 2008;181:1232-1244.
 32. Miron RJ, Bosshardt DD. OsteoMacs: Key players around bone biomaterials. Biomaterials 2016;82:1-19.
 33. Ramilo O, Allman W, Chung W, et al. Gene expression patterns in blood leukocytes discriminate patients with acute infections. Blood 2007;109:2066-
2077.
 34. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature reviews immunology 2008;8:958-969.
 35. Dohan DM, Choukroun J, Diss A, et al. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part II: platelet-related biologic features.
Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics 2006;101:e45-50.
 36. Ohshima M, Yamaguchi Y, Matsumoto N, et al. TGF-beta signaling in gingival fibroblast-epithelial interaction. Journal of dental research 2010;89:1315-
1321.
 37. Ohshima M, Yamaguchi Y, Ambe K, et al. Fibroblast VEGF-receptor 1 expression as molecular target in periodontitis. Journal of clinical
periodontology 2016;43:128-137.
 38. Chattopadhyay S, Raines RT. Review collagen‐based biomaterials for wound healing. Biopolymers 2014;101:821-833.
52
Thank you…
53

More Related Content

What's hot

Internal derangement of tmj
Internal derangement of tmjInternal derangement of tmj
Internal derangement of tmjDrKamini Dadsena
 
Arthrocentesis of the temporomandibular joint
Arthrocentesis of the temporomandibular jointArthrocentesis of the temporomandibular joint
Arthrocentesis of the temporomandibular jointAhmed Adawy
 
platelet concentrates
 platelet concentrates platelet concentrates
platelet concentratesFatima Gilani
 
Local anesthetic techniques
Local anesthetic techniquesLocal anesthetic techniques
Local anesthetic techniquesSuman Mukherjee
 
Anatomy of the pterygomandibular space and its clinical significance
Anatomy of the pterygomandibular space and its clinical significanceAnatomy of the pterygomandibular space and its clinical significance
Anatomy of the pterygomandibular space and its clinical significanceHope Inegbenosun
 
Extraction instruments | Dental surgery | by Dr.mohammad nameer
Extraction instruments | Dental surgery | by Dr.mohammad nameerExtraction instruments | Dental surgery | by Dr.mohammad nameer
Extraction instruments | Dental surgery | by Dr.mohammad nameerDenTeach
 
mandibular molar Impactions
mandibular molar Impactionsmandibular molar Impactions
mandibular molar ImpactionsNishant Tewari
 
CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THE TREATMENT OF KERATOCYSTIC O...
CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THETREATMENT OF KERATOCYSTIC O...CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THETREATMENT OF KERATOCYSTIC O...
CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THE TREATMENT OF KERATOCYSTIC O...DrKamini Dadsena
 
Recent advances in periodontal surgical technology
Recent advances in periodontal surgical technologyRecent advances in periodontal surgical technology
Recent advances in periodontal surgical technologyDr Aananyaa Khanna
 

What's hot (20)

Internal derangement of tmj
Internal derangement of tmjInternal derangement of tmj
Internal derangement of tmj
 
Arthrocentesis of the temporomandibular joint
Arthrocentesis of the temporomandibular jointArthrocentesis of the temporomandibular joint
Arthrocentesis of the temporomandibular joint
 
Le fort fractures
Le fort fracturesLe fort fractures
Le fort fractures
 
Bsso
BssoBsso
Bsso
 
platelet concentrates
 platelet concentrates platelet concentrates
platelet concentrates
 
Local anesthetic techniques
Local anesthetic techniquesLocal anesthetic techniques
Local anesthetic techniques
 
Maxillary sinus
Maxillary sinusMaxillary sinus
Maxillary sinus
 
Mandibular nerve blocks techniques
Mandibular nerve blocks techniques Mandibular nerve blocks techniques
Mandibular nerve blocks techniques
 
Frenectomy
FrenectomyFrenectomy
Frenectomy
 
Anatomy of the pterygomandibular space and its clinical significance
Anatomy of the pterygomandibular space and its clinical significanceAnatomy of the pterygomandibular space and its clinical significance
Anatomy of the pterygomandibular space and its clinical significance
 
Extraction instruments | Dental surgery | by Dr.mohammad nameer
Extraction instruments | Dental surgery | by Dr.mohammad nameerExtraction instruments | Dental surgery | by Dr.mohammad nameer
Extraction instruments | Dental surgery | by Dr.mohammad nameer
 
Bsso
BssoBsso
Bsso
 
Periodontal probes
Periodontal probesPeriodontal probes
Periodontal probes
 
Platelet rich plasma
Platelet rich plasmaPlatelet rich plasma
Platelet rich plasma
 
mandibular molar Impactions
mandibular molar Impactionsmandibular molar Impactions
mandibular molar Impactions
 
CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THE TREATMENT OF KERATOCYSTIC O...
CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THETREATMENT OF KERATOCYSTIC O...CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THETREATMENT OF KERATOCYSTIC O...
CARNOY’S SOLUTION AS A SURGICAL MEDICAMENT IN THE TREATMENT OF KERATOCYSTIC O...
 
Mandibular Anesthesia : Inferior alveolar nerve block
Mandibular Anesthesia : Inferior alveolar nerve blockMandibular Anesthesia : Inferior alveolar nerve block
Mandibular Anesthesia : Inferior alveolar nerve block
 
Surgical anatomy of TMJ
Surgical anatomy of TMJSurgical anatomy of TMJ
Surgical anatomy of TMJ
 
maxillary nerve blocks
maxillary nerve blocksmaxillary nerve blocks
maxillary nerve blocks
 
Recent advances in periodontal surgical technology
Recent advances in periodontal surgical technologyRecent advances in periodontal surgical technology
Recent advances in periodontal surgical technology
 

Similar to Optimized platelet rich fibrin with the low-speed concept

Growth factors for periodontal an d periimplant regeneration - Copy.pdf
 Growth factors for periodontal an d periimplant regeneration - Copy.pdf Growth factors for periodontal an d periimplant regeneration - Copy.pdf
Growth factors for periodontal an d periimplant regeneration - Copy.pdfahmedbadr179
 
4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...
4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...
4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...Minia university, Faculty of Medicine
 
Lung Fibrosis Model Representative Studies by Aragen Bioscience
Lung Fibrosis Model Representative Studies by Aragen BioscienceLung Fibrosis Model Representative Studies by Aragen Bioscience
Lung Fibrosis Model Representative Studies by Aragen BioscienceGVK Biosciences
 
Platelet function and constituents of platelet rich plasma.
Platelet function and constituents of platelet rich plasma.Platelet function and constituents of platelet rich plasma.
Platelet function and constituents of platelet rich plasma.Angad Malhotra
 
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)Melanie Lampa
 
Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...
Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...
Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...Tiffany Chen
 
platelet rich plasma infertility
platelet rich plasma  infertilityplatelet rich plasma  infertility
platelet rich plasma infertilitymuhammad al hennawy
 
platelet rich plasma urogynecology
platelet rich plasma urogynecologyplatelet rich plasma urogynecology
platelet rich plasma urogynecologymuhammad al hennawy
 
Anti- Tumor assay / Screening of Anticancer Drugs
Anti- Tumor assay / Screening of Anticancer DrugsAnti- Tumor assay / Screening of Anticancer Drugs
Anti- Tumor assay / Screening of Anticancer DrugsPratik Parikh
 
platelet rich plasma intimate female ttt
platelet rich plasma intimate female   tttplatelet rich plasma intimate female   ttt
platelet rich plasma intimate female tttmuhammad al hennawy
 
BioPharming (Molecular Farming)
BioPharming (Molecular Farming)BioPharming (Molecular Farming)
BioPharming (Molecular Farming)Kuldeep Sharma
 
PAH Drug Discovery and Development: State of the Art in 2022
PAH Drug Discovery and Development: State of the Art in 2022PAH Drug Discovery and Development: State of the Art in 2022
PAH Drug Discovery and Development: State of the Art in 2022Duke Heart
 
PRP Animal study
PRP Animal studyPRP Animal study
PRP Animal studySchuco
 

Similar to Optimized platelet rich fibrin with the low-speed concept (20)

Growth factors for periodontal an d periimplant regeneration - Copy.pdf
 Growth factors for periodontal an d periimplant regeneration - Copy.pdf Growth factors for periodontal an d periimplant regeneration - Copy.pdf
Growth factors for periodontal an d periimplant regeneration - Copy.pdf
 
4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...
4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...
4. effect of-hydroxyprogesterone-17ohpc-on-placenta-in-a-rat-model-ofpreeclam...
 
L1
L1L1
L1
 
L1 (1)
L1 (1)L1 (1)
L1 (1)
 
Medi 95-e4174
Medi 95-e4174Medi 95-e4174
Medi 95-e4174
 
Medi 95-e4174
Medi 95-e4174Medi 95-e4174
Medi 95-e4174
 
Lung Fibrosis Model Representative Studies by Aragen Bioscience
Lung Fibrosis Model Representative Studies by Aragen BioscienceLung Fibrosis Model Representative Studies by Aragen Bioscience
Lung Fibrosis Model Representative Studies by Aragen Bioscience
 
Platelet function and constituents of platelet rich plasma.
Platelet function and constituents of platelet rich plasma.Platelet function and constituents of platelet rich plasma.
Platelet function and constituents of platelet rich plasma.
 
1.prp
1.prp1.prp
1.prp
 
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)
Cancer Immunol Res-2015-Manuel-2326-6066.CIR-14-0214 (3)
 
Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...
Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...
Daily Intake of Probiotics with High IFN-γ IL-10 Ratio Increases the Cytotoxi...
 
platelet rich plasma infertility
platelet rich plasma  infertilityplatelet rich plasma  infertility
platelet rich plasma infertility
 
Human growth factorS
Human growth factorSHuman growth factorS
Human growth factorS
 
platelet rich plasma urogynecology
platelet rich plasma urogynecologyplatelet rich plasma urogynecology
platelet rich plasma urogynecology
 
Anti- Tumor assay / Screening of Anticancer Drugs
Anti- Tumor assay / Screening of Anticancer DrugsAnti- Tumor assay / Screening of Anticancer Drugs
Anti- Tumor assay / Screening of Anticancer Drugs
 
platelet rich plasma intimate female ttt
platelet rich plasma intimate female   tttplatelet rich plasma intimate female   ttt
platelet rich plasma intimate female ttt
 
BioPharming (Molecular Farming)
BioPharming (Molecular Farming)BioPharming (Molecular Farming)
BioPharming (Molecular Farming)
 
PAH Drug Discovery and Development: State of the Art in 2022
PAH Drug Discovery and Development: State of the Art in 2022PAH Drug Discovery and Development: State of the Art in 2022
PAH Drug Discovery and Development: State of the Art in 2022
 
PRP Animal study
PRP Animal studyPRP Animal study
PRP Animal study
 
Autophagy Promotes the Expression of Vascular Endothelial Growth Factor in Hu...
Autophagy Promotes the Expression of Vascular Endothelial Growth Factor in Hu...Autophagy Promotes the Expression of Vascular Endothelial Growth Factor in Hu...
Autophagy Promotes the Expression of Vascular Endothelial Growth Factor in Hu...
 

More from MD Abdul Haleem

L-PRF for increasing the width of keratinized mucosa around implants: A split...
L-PRF for increasing the width of keratinized mucosa around implants: A split...L-PRF for increasing the width of keratinized mucosa around implants: A split...
L-PRF for increasing the width of keratinized mucosa around implants: A split...MD Abdul Haleem
 
Interproximal tunneling with a customized connective tissue graft a microsurg...
Interproximal tunneling with a customized connective tissue graft a microsurg...Interproximal tunneling with a customized connective tissue graft a microsurg...
Interproximal tunneling with a customized connective tissue graft a microsurg...MD Abdul Haleem
 
Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...
Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...
Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...MD Abdul Haleem
 
Cortical bone repositioning technique for horizontal alveolar bone augmentati...
Cortical bone repositioning technique for horizontal alveolar bone augmentati...Cortical bone repositioning technique for horizontal alveolar bone augmentati...
Cortical bone repositioning technique for horizontal alveolar bone augmentati...MD Abdul Haleem
 
Analysis of buccolingual dimensional changes of the extraction socket using t...
Analysis of buccolingual dimensional changes of the extraction socket using t...Analysis of buccolingual dimensional changes of the extraction socket using t...
Analysis of buccolingual dimensional changes of the extraction socket using t...MD Abdul Haleem
 
2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...
2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...
2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...MD Abdul Haleem
 
Host Modulation: Controlling the Inflammation to Control the Infection.
Host Modulation: Controlling the Inflammation to Control the Infection.Host Modulation: Controlling the Inflammation to Control the Infection.
Host Modulation: Controlling the Inflammation to Control the Infection.MD Abdul Haleem
 
Entire papilla preservation technique in the regenerative treatment of deep i...
Entire papilla preservation technique in the regenerative treatment of deep i...Entire papilla preservation technique in the regenerative treatment of deep i...
Entire papilla preservation technique in the regenerative treatment of deep i...MD Abdul Haleem
 
Orthodontic treatment simultaneous to or after periodontal cause related trea...
Orthodontic treatment simultaneous to or after periodontal cause related trea...Orthodontic treatment simultaneous to or after periodontal cause related trea...
Orthodontic treatment simultaneous to or after periodontal cause related trea...MD Abdul Haleem
 
Coronal advanced flap in combination with a connective tissue graft. Is the t...
Coronal advanced flap in combination with a connective tissue graft. Is the t...Coronal advanced flap in combination with a connective tissue graft. Is the t...
Coronal advanced flap in combination with a connective tissue graft. Is the t...MD Abdul Haleem
 
General principles of periodontal surgery
General principles of periodontal surgeryGeneral principles of periodontal surgery
General principles of periodontal surgeryMD Abdul Haleem
 
Attached gingiva and its significance
Attached gingiva and its significanceAttached gingiva and its significance
Attached gingiva and its significanceMD Abdul Haleem
 
Sample collection, Preservation and its Estimation
Sample collection, Preservation and its EstimationSample collection, Preservation and its Estimation
Sample collection, Preservation and its EstimationMD Abdul Haleem
 
Classification of periodontal instruments
Classification of periodontal instrumentsClassification of periodontal instruments
Classification of periodontal instrumentsMD Abdul Haleem
 

More from MD Abdul Haleem (20)

L-PRF for increasing the width of keratinized mucosa around implants: A split...
L-PRF for increasing the width of keratinized mucosa around implants: A split...L-PRF for increasing the width of keratinized mucosa around implants: A split...
L-PRF for increasing the width of keratinized mucosa around implants: A split...
 
Interproximal tunneling with a customized connective tissue graft a microsurg...
Interproximal tunneling with a customized connective tissue graft a microsurg...Interproximal tunneling with a customized connective tissue graft a microsurg...
Interproximal tunneling with a customized connective tissue graft a microsurg...
 
Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...
Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...
Releasing Incisions Using Upward-Motion Scissors Technique for Flap Mobilizat...
 
Cortical bone repositioning technique for horizontal alveolar bone augmentati...
Cortical bone repositioning technique for horizontal alveolar bone augmentati...Cortical bone repositioning technique for horizontal alveolar bone augmentati...
Cortical bone repositioning technique for horizontal alveolar bone augmentati...
 
Analysis of buccolingual dimensional changes of the extraction socket using t...
Analysis of buccolingual dimensional changes of the extraction socket using t...Analysis of buccolingual dimensional changes of the extraction socket using t...
Analysis of buccolingual dimensional changes of the extraction socket using t...
 
2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...
2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...
2017 WORLD WORKSHOP - A new classification scheme for periodontal and peri‐im...
 
Host Modulation: Controlling the Inflammation to Control the Infection.
Host Modulation: Controlling the Inflammation to Control the Infection.Host Modulation: Controlling the Inflammation to Control the Infection.
Host Modulation: Controlling the Inflammation to Control the Infection.
 
Entire papilla preservation technique in the regenerative treatment of deep i...
Entire papilla preservation technique in the regenerative treatment of deep i...Entire papilla preservation technique in the regenerative treatment of deep i...
Entire papilla preservation technique in the regenerative treatment of deep i...
 
Orthodontic treatment simultaneous to or after periodontal cause related trea...
Orthodontic treatment simultaneous to or after periodontal cause related trea...Orthodontic treatment simultaneous to or after periodontal cause related trea...
Orthodontic treatment simultaneous to or after periodontal cause related trea...
 
Coronal advanced flap in combination with a connective tissue graft. Is the t...
Coronal advanced flap in combination with a connective tissue graft. Is the t...Coronal advanced flap in combination with a connective tissue graft. Is the t...
Coronal advanced flap in combination with a connective tissue graft. Is the t...
 
Saliva
SalivaSaliva
Saliva
 
General principles of periodontal surgery
General principles of periodontal surgeryGeneral principles of periodontal surgery
General principles of periodontal surgery
 
Attached gingiva and its significance
Attached gingiva and its significanceAttached gingiva and its significance
Attached gingiva and its significance
 
Trigeminal Nerve
Trigeminal NerveTrigeminal Nerve
Trigeminal Nerve
 
Diabetes Mellitus
Diabetes MellitusDiabetes Mellitus
Diabetes Mellitus
 
Hypothalamus
HypothalamusHypothalamus
Hypothalamus
 
Sample collection, Preservation and its Estimation
Sample collection, Preservation and its EstimationSample collection, Preservation and its Estimation
Sample collection, Preservation and its Estimation
 
Facial nerve
Facial nerveFacial nerve
Facial nerve
 
Digital Imaging
Digital ImagingDigital Imaging
Digital Imaging
 
Classification of periodontal instruments
Classification of periodontal instrumentsClassification of periodontal instruments
Classification of periodontal instruments
 

Recently uploaded

Call Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Miss joya
 
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore EscortsVIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escortsaditipandeya
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Miss joya
 
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...Miss joya
 
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls ServiceKesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Servicemakika9823
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowRiya Pathan
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...narwatsonia7
 
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment BookingHousewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Bookingnarwatsonia7
 
Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...
Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...
Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...narwatsonia7
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escortsvidya singh
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.MiadAlsulami
 
Call Girls Chennai Megha 9907093804 Independent Call Girls Service Chennai
Call Girls Chennai Megha 9907093804 Independent Call Girls Service ChennaiCall Girls Chennai Megha 9907093804 Independent Call Girls Service Chennai
Call Girls Chennai Megha 9907093804 Independent Call Girls Service ChennaiNehru place Escorts
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...narwatsonia7
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Availablenarwatsonia7
 
Call Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service ChennaiCall Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service ChennaiNehru place Escorts
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipurparulsinha
 
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...narwatsonia7
 

Recently uploaded (20)

Call Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Yelahanka Just Call 7001305949 Top Class Call Girl Service Available
 
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
Russian Call Girls in Pune Tanvi 9907093804 Short 1500 Night 6000 Best call g...
 
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore EscortsVIP Call Girls Indore Kirti 💚😋  9256729539 🚀 Indore Escorts
VIP Call Girls Indore Kirti 💚😋 9256729539 🚀 Indore Escorts
 
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
Low Rate Call Girls Pune Esha 9907093804 Short 1500 Night 6000 Best call girl...
 
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
VIP Call Girls Pune Vrinda 9907093804 Short 1500 Night 6000 Best call girls S...
 
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls ServiceKesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
Kesar Bagh Call Girl Price 9548273370 , Lucknow Call Girls Service
 
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call NowSonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
Sonagachi Call Girls Services 9907093804 @24x7 High Class Babes Here Call Now
 
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
Russian Call Girls in Delhi Tanvi ➡️ 9711199012 💋📞 Independent Escort Service...
 
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
VIP Call Girls Tirunelveli Aaradhya 8250192130 Independent Escort Service Tir...
 
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment BookingHousewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
Housewife Call Girls Hoskote | 7001305949 At Low Cost Cash Payment Booking
 
Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...
Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...
Call Girls Doddaballapur Road Just Call 7001305949 Top Class Call Girl Servic...
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
 
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
Artifacts in Nuclear Medicine with Identifying and resolving artifacts.
 
Call Girls Chennai Megha 9907093804 Independent Call Girls Service Chennai
Call Girls Chennai Megha 9907093804 Independent Call Girls Service ChennaiCall Girls Chennai Megha 9907093804 Independent Call Girls Service Chennai
Call Girls Chennai Megha 9907093804 Independent Call Girls Service Chennai
 
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Servicesauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
sauth delhi call girls in Bhajanpura 🔝 9953056974 🔝 escort Service
 
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
Russian Call Girls Chickpet - 7001305949 Booking and charges genuine rate for...
 
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service AvailableCall Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
Call Girls Whitefield Just Call 7001305949 Top Class Call Girl Service Available
 
Call Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service ChennaiCall Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
Call Girl Chennai Indira 9907093804 Independent Call Girls Service Chennai
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
 
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
Russian Call Girl Brookfield - 7001305949 Escorts Service 50% Off with Cash O...
 

Optimized platelet rich fibrin with the low-speed concept

  • 2. Optimized Platelet-Rich Fibrin With the Low- Speed Concept: Growth Factor Release, Biocompatibility and Cellular Response JOP 2016 – MASAKO FUJIOKA-KOBAYASHI, RICHARD J. MIRON, MARIA HERNANDEZ, UMADEVI KANDALAM, YUFENG ZHANG, AND JOSEPH CHOUKROUN - PRESENTED BY DR.MD ABDUL HALEEM 2
  • 3. CONTENTS • INTRODUCTION • AIM OF THE STUDY • MATERIALS AND METHODS Platelet Concentrations 1. Protein Quantification With ELISA Cell Culture 2. Cell Viability 3. Cell Migration Assay 4. Proliferation Assay 5. Real-Time PCR Analysis 3
  • 4. CONTENTS • STATISTICAL ANALYSIS • RESULTS • DISCUSSION • CONCLUSION • REFERENCES 4
  • 5. INTRODUCTION  Over 15 years ago…PRF introduced… as an autogenous source of blood growth factors… tissue regeneration in modern medicine.*  This concepts… from the fact that… PRP despite bearing the negative aspect of containing anti-coagulants… thereby preventing the full coagulation cascade important for tissue wound healing… was being heavy utilized in various fields of medicine.*  PRF (known as L-PRF)… does not contain any anti- coagulants… provides a three-dimensional fibrin matrix… scaffold… barrier membrane in GBR, GTR procedures.* 1. Choukroun J, Adda F, Schoeffler C, Vervelle A. Opportunities in Implant Dentistry: PRF (french). Implantodontie 2001;42:e62. 2. Marx RE. Platelet-rich plasma: evidence to support its use. Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and Maxillofacial Surgeons 2004;62:489-496. 3. Toffler M. Guided bone regeneration (GBR) using cortical bone pins in combination with leukocyteand platelet-rich fibrin (L-PRF). Compendium of continuing education in dentistry (Jamesburg, NJ : 1995) 2014;35:192-198. 5
  • 6. INTRODUCTION 6 Aroca S, Keglevich T, Barbieri B, Gera I, Etienne D. Clinical evaluation of a modified coronally advanced flap alone or in combination with a platelet-rich fibrin membrane for the treatment of adjacent multiple gingival recessions: a 6-month study. Journal of periodontology 2009;80:244-252.  Since its introduction in 2001, PRF has been extensively utilized in dentistry  Extraction socket management  Gingival recessions  Intrabony defect regeneration  Sinus elevation procedures  To accelerate wound healing process  Major advantages… completely immune-compatible growth factors… collected at relatively no costs… without anti-coagulants.
  • 7. INTRODUCTION  While initial and early experiments revealed that PRP contained high concentrations of autologous growth factors… up to 6-8 times higher than normal blood concentrations… including*  Platelet-derived growth factor (PDGF)  Vascular endothelial growth factor (VEGF)  Transforming growth factor-beta1 (TGF-β1) 7 1. Peerbooms JC, van Laar W, Faber F, Schuller HM, van der Hoeven H, Gosens T. Use of platelet rich plasma to treat plantar fasciitis: design of a multi centre randomized controlled trial. BMC Musculoskeletal Disorders 2010;11:69-69. 2. Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, et al. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations 2016.Jan 25. [Epub ahead of print]  PRF… shown to release even higher total growth factors over a more extended period of time.*
  • 8. INTRODUCTION  PRF… slower release of growth factors over time… is the ability for the fibrin matrix to hold proteins within its fibrin network… as well contains cells capable of further release growth factors into their surrounding micro-environment.*  Leukocytes… highly important immune cells… capable of directing and recruiting various cell types during the wound healing process.* 8 1. Kumar RV, Shubhashini N. Platelet rich fibrin: a new paradigm in periodontal regeneration. Cell and tissue banking 2013;14:453-463. 2. Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A. The role of leukocytes from L-PRP/L-PRF in wound healing and immune defense: new perspectives. Current pharmaceutical biotechnology 2012;13:1153-1162.
  • 9. INTRODUCTION  Since high centrifugation forces are known to shift cell populations to the bottom of collection tubes… whereas PRF is collected from the top one-third layer… it was recently hypothesized that by reducing centrifugation G-force, an increase in leukocyte numbers may be achieved within the PRF matrix. 9 Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689.
  • 10. INTRODUCTION  It was since shown that by decreasing centrifugation g-force… now termed advanced- PRF or A-PRF… an increase in total leukocyte numbers within PRF matrix scaffolds was observed.  Furthermore it was shown that the release of several growth factors including PDGF TGF-β1 VEGF EGF IGF  were significantly higher in A-PRF when compared to L-PRF and PRP. 10 Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, et al. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations 2016.Jan 25.
  • 11. AIM OF THE STUDY  Since centrifugation… direct impact on growth factor release from within PRF scaffolds, the aim of the present study was to… further investigate whether centrifugation time would similarly further improve growth factor release from within PRF scaffolds.  In principle… less centrifugation time would reduce cell pull- down by centrifugation forces… which would theoretically increase the total number of cells left contained within the top layer (PRF matrix). 11
  • 12. AIM OF THE STUDY  Furthermore… it remains completely unknown, what changes to centrifugation protocols will have on tissue regeneration… the effects of each PRF matrix including L- PRF, A-PRF and A-PRF+… Is investigated for the first time on… human gingival fibroblast cell for the biocompatibility and cell activity.  Cells were therefore cultured with growth factors from each PRF matrix (L-PRF, A-PRF and A-PRF+) and investigated for cell migration Proliferation growth factor release collagen synthesis “All IN VITRO” 12
  • 13. MATERIALS AND METHODS PLATELET CONCENTRATIONS  Blood sample… 8 volunteers…. (so 8x3=24 total samples)  Age 30-60  10ml of whole blood without anticoagulant was collected  L-PRF = 2700 RPM(708g) , 12min  A-PRF = 1300 RPM (200g) ,14min  A-PRF+ = 1300 RPM (200g) , 8min  Top 4ml of PRF clot is collected  Placed into 6 well dish (24x6 = 144 total well dishes)  With 5ml of Dulbecco's Modified Eagle Medium (DMEM) culture media 13
  • 14. MATERIALS AND METHODS 1) PROTEIN QUANTIFICATION WITH ELISA  To determine the amount of released growth factors from L-PRF, A-PRF, and A-PRF+  at 15 min, 60 min, 8 hours, 1 day, 3 days and 10 days  samples placed in shaking incubator (37°C)  To allow for growth factor release into the culture media.  Each time point, 5ml culture media taken, frozen  Protein quantification by ELISA 14
  • 15. MATERIALS AND METHODS PROTEIN QUANTIFICATION WITH ELISA  Checked for  PDGF-AA  PDGF-AB  PDGF-BB  VEGF  TGF-β1  EGF  IGF-1  All samples measured in duplicate to avoid errors, 8 duplication made (144x8 = 1152 samples) 15
  • 16. MATERIALS AND METHODS CELL CULTURE  L-PRF, A-PRF, APRF+  Incubated for 3 days  With 5ml of DMEM culture media  The conditioned media is collected  Utilized for further experiment as 20%  Diluted with standard DMEM culture media + 15% FBS(Fetal Bovine Serum) + 1% Antibiotics  Human gingival fibroblasts…cultured in a humidified atmosphere (37°C) along with growth medium consisting of DMEM, 10% fetal bovine serum (FBS) and 1% antibiotics… cultured cells detached using 0.25% EDTA-Trypsin… these cells seeded into the 3 groups. 16
  • 17. CELL CULTURE  For Test Samples  Cells seeded with 20% Conditioned Media into all 3 groups  Along with growth medium  Cellular density of the cultured human gingival fibroblasts cells (24 samples)  10,000…for checking viability  50,000…for checking proliferation… in 24 wells plates  Cell quantification…. using microscope 17
  • 18. MATERIALS AND METHODS CELL CULTURE  For Control Samples  Cells seeded with 20% Conditioned Media into all 3 groups  Without growth medium  Both the test and control samples  Left for 3 days  On a plate shaker(37°C)  For experiments >5days… medium replaced twice weekly 18
  • 19. MATERIALS AND METHODS 2) CELL VIABILITY  After 24 hrs post cell seeding  Live-dead staining assay  Fluorescent images quantified  Expressed as % of Living Vs Dead 19
  • 20. MATERIALS AND METHODS 3) CELL MIGRATION ASSAY  Migration assay of human gingival fibroblasts performed  Using 24 well plates + polyethylene terephthalate, cell culture with pore size 8µm  Conditioned media filled into lower compartment  DMEM containing 0.5% FBS for 12hrs 20
  • 21. MATERIALS AND METHODS 3) CELL MIGRATION ASSAY  10,000 cells were filled in upper compartment  After 24hrs  Cells fixed with 4% formaldehyde for 2min  cells permeabilize by acetone for 15min  Stained with hematoxylin solution for 20min  Upper side, rinsed, wiped gently with cotton swab  To remove cell debris  Number of cells on the lower compartment counted under microscope 21
  • 22. MATERIALS AND METHODS 4) CELL PROLIFERATION ASSAY  Human gingival fibroblasts  50,000 cells taken  At 1,3 and 5 days  At desired point, cells washed with phosphate buffered solution  Quantified for cell proliferation  Using MTS colorimetric assay and microplate reader 22
  • 23. MATERIALS AND METHODS REAL-TIME PCR ANALYSIS  Human gingival fibroblasts  At 3 and 7 day  Total RNA harvested  To investigate mRNA level of  TGF-β  PDGF  Collagen 1a2  RNA isolation… performed using High Pure RNA isolation kit 23
  • 24. MATERIALS AND METHODS REAL-TIME PCR ANALYSIS  Primer and probe sequence Gene Primer Sequence hTGF-β F actactacgccaaggaggtcac hTGF-β R tgcttgaacttgtcatagatttcg hPDGF F cacacctcctcgctgtagtattta hPDGF R gttatcggtgtaaatgtcatccaa hCOL1a2 F cccagccaagaactggtatagg hCOL1a2 R ggctgccagcattgatagtttc hGAPDH F agccacatcgctcagacac hGAPDH R gcccaatacgaccaaatcc 24
  • 25. STATISTICAL ANALYSIS  All experiments were performed in triplicate with three independent experiments for each condition.  Means and standard errors (SE) were calculated and data were analyzed for statistical significance using one-way analysis for cell viability and migration assay, two-way analysis of variance for ELISA, proliferation assay and real time PCR analysis with Turkey test  p values < 0.05 was considered significant by GraphPad Prism 6.0 software 25
  • 26. RESULTS  Growth Factor Release From PRF, A-PRF and A-PRF+ 26
  • 27. RESULTS  Growth Factor Release From PRF, A-PRF and A-PRF+ 27
  • 28. RESULTS  Growth Factor Release From PRF, A-PRF and A-PRF+ 28
  • 29. RESULTS  Growth Factor Release From PRF, A-PRF and A-PRF+ 29
  • 30. RESULTS Biocompatibility Of L-PRF, A-PRF and A-PRF+ On Human Gingival Fibroblasts  Investigated on cell viability of human gingival fibroblasts.  All platelet formulations… displayed excellent cell biocompatibility … high living cells GREEN CELLS… very few observable apoptotic cells red cells. 30
  • 31. RESULTS  Influence of PRF, A-PRF and A-PRF+ on Human Gingival Fibroblast Activity  For Cell Migration  For Cell Proliferation 31
  • 32. RESULTS  Influence of PRF, A-PRF and A-PRF+ on Human Gingival Fibroblast Activity  For mRNA expression of growth factors and collagen 32
  • 33. DISCUSSION  The aim of the present study… was to investigate the  Influence of centrifugation speed (g-force) and  Time on PRF matrix scaffolds  Their release of growth factors  Their effect on cellular biocompatibility and activity.  As the use of PRF has continuously and steadily increased in regenerative implant dentistry and periodontology, there remains great clinical benefit to optimize centrifugation protocols for clinical practice. 33
  • 34. DISCUSSION  Therefore, the aim of the present study was to investigate if… lower centrifugation speeds and time could be additionally used to improve growth factor release and cell bioactivity.  One of the interesting findings from a previous study by Ghanaati et al. found that cells quantified histologically within the PRF matrix observed that the majority of leukocytes were found near the bottom of the fibrin clot in standard L-PRF. 34 Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689
  • 35. DISCUSSION  Based on this finding, it became clear that centrifugation speeds (G-forces) were evidently too high pushing leukocytes down to the bottom of centrifugation tubes and away from the PRF matrix clot.  In order to redistribute leukocyte cell numbers across the entire PRF matrix, lower centrifugation speeds were investigated.  It was confirmed that higher cell number could be obtained by reducing G-force during centrifugation.* 35 Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689.
  • 36. DISCUSSION  Ghanaati et al. showed that while platelets were detected throughout the clot in both groups (L-PRF and A-PRF), but more platelets were found in the distal part of A-PRF.  Furthermore, by decreasing the rpm while increasing the centrifugation time in the A-PRF group, an enhanced presence of neutrophilic granulocytes in the distal part of the clot was also observed.  Red areas – red blood cells  Blue areas – platelets and white blood cell  Dark pink – dense fibrin network with interspersed loose fibrin network  Light pink – loose fibrin network 36 Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689
  • 37. DISCUSSION  Accordingly, it was reported that a higher presence of these cells might be able to influence the differentiation of host macrophages and macrophages within the clot after implantation.  Thus, it was concluded that A-PRF might influence bone and soft tissue regeneration, especially through the presence of monocytes/macrophages and their growth factors. 37 Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689
  • 38. DISCUSSION  It must also be noted that the role of leukocytes in tissue wound healing and bone biology has been extensively discussed and critically important to wound healing.  Interesting findings from basic science now point to the absolute necessity of macrophages during bone tissue remodeling and have further shown that macrophages are responsible for a 23-fold increase in osteoblast differentiation. 38 Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A. The role of leukocytes from L-PRP/L-PRF in wound healing and immune defense: new perspectives. Current pharmaceutical biotechnology 2012;13:1153-1162.
  • 39. DISCUSSION  Without these key immune cells, it has been shown that bone formation has very limited potential to generate new bone.  Furthermore, macrophages are key players in biomaterial integration and are the responsible cell type dictating material integration. 39 Miron RJ, Bosshardt DD. OsteoMacs: Key players around bone biomaterials. Biomaterials 2016;82:1-19.
  • 40. DISCUSSION  Therefore it becomes evident that both an increase in leukocyte number as well as their even distribution across the PRF scaffold as demonstrated with lower centrifugation speeds is highly favorable during tissue wound healing and during biomaterial integration of collagen barrier membranes, various classes of bone grafting materials and potentially dental implants.  Future research is therefore necessary. 40
  • 41. DISCUSSION  Another important aspect of leukocyte biology that has not been discussed in this study but again shows much clinical relevance is the fact leukocytes are the responsible cell-type acting to prevent infiltrating pathogens.  In light of this fact, it becomes of interest to note that PRF placed into extraction sockets has been shown to greatly decrease the rate of complications and infections. 41 1. Ramilo O, Allman W, Chung W, et al. Gene expression patterns in blood leukocytes discriminate patients with acute infections. Blood 2007;109:2066-2077. 2. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature reviews immunology 2008;8:958-969.
  • 42. DISCUSSION  Hoaling and Lines reported that filling 3rd molar extraction sockets with PRF led to a 10 fold decrease in osteomyelitis infections when compared to natural healing.  This study performed in 200 patients utilized bilateral extractions (one side filled with PRF, the other left to naturally heal) providing good scientific evidence for the reduced rate of infection following healing with PRF. 42 Hoaglin DR, Lines GK. Prevention of localized osteitis in mandibular third-molar sites using platelet-rich fibrin. International journal of dentistry 2013;2013:875380.
  • 43. DISCUSSION  One aspect that remains to be investigated is to determine…. if not only higher concentrations of growth factors are released from the various PRF formulations, but also if additional growth factors or cytokines may also be subsequently released.  Future research utilizing cytokine prolife assays comparing the various PRF formulations would be necessary to further investigate these possible differences. 43
  • 44. DISCUSSION  Another interesting area of research that is often left unstudied is the effect of higher than optimal doses of growth factors on tissue remodeling.  For instance, Oshima et al. found that certain growth factors including TGF-β and VEGF are not only capable of supporting tissue regeneration but may also participate in tissue degradation in periodontitis.  While in general both of these growth factors are routinely associated with tissue regrowth (TGF-β) and angiogenesis (VEGF), it must also not be excluded that they may also show negative effects also.  Future research investigating the optimal growth factor concentrations from PRF formulations remains to be determined. 44 1. Ohshima M, Yamaguchi Y, Matsumoto N, et al. TGF-beta signaling in gingival fibroblast-epithelial interaction. Journal of dental research 2010;89:1315-1321. 2. Ohshima M, Yamaguchi Y, Ambe K, et al. Fibroblast VEGF-receptor 1 expression as molecular target in periodontitis. Journal of clinical periodontology 2016;43:128-137.
  • 45. DISCUSSION  Furthermore, analysis of mRNA levels of PDGF and TGF-β also demonstrate the ability for PRF matrix scaffolds produced with the low speed concept to significantly increase the production of growth factors from gingival fibroblasts.  Therefore, not only are higher quantities of PDGF and TGF-β1 found in A-PRF+ scaffolds themselves… but the cells then in contact with their matrix are also further stimulated to release more growth factors… thus having a synergistic effect on the total growth factors produced locally. 45
  • 46. DISCUSSION  Lastly it was also shown that A-PRF and A-PRF+ samples were able to locally increase in collagen1 mRNA levels.  Not surprisingly, collagen remains one of the key factors during tissue wound healing and remodelling.*  Therefore the increase in collagen type 1 when cells were exposed to A-PRF and A-PRF+ further demonstrates the regenerative potential of the newer PRF formulations centrifuged at lower g-forces and lower centrifugation times. 46 Chattopadhyay S, Raines RT. Review collagen‐based biomaterials for wound healing. Biopolymers 2014;101:821-833.
  • 47. CONCLUSION  In summary, the results from the present study demonstrate that all formulations of PRF matrix scaffolds including PRF, A-PRF and A-PRF+ were able to secrete the local release of various growth factors important for tissue regeneration and A-PRF+ demonstrated significantly higher release of growth factors when compared to all other groups.  Furthermore, A-PRF and A-PRF+ matrix scaffolds were shown to directly impact the ability for human gingival fibroblasts to migrate, proliferate, release additional growth factors and increase mRNA levels of type 1 collagen. 47
  • 48. CONCLUSION  The findings from the present study demonstrate that modifications to centrifugation speed and time with the low-speed concept favors an increase in growth factor concentrations directly impacting human gingival fibroblasts. Future animal and clinical studies are now needed to further confirm the effects of these results in vivo. 48
  • 49. REFERENCES  1. Choukroun J, Adda F, Schoeffler C, Vervelle A. Opportunities in Implant Dentistry: PRF (french). Implantodontie 2001;42:e62.  2. Anfossi G, Trovati M, Mularoni E, Massucco P, Calcamuggi G, Emanuelli G. Influence of propranolol on platelet aggregation and thromboxane B2 production from platelet-rich plasma and whole blood. Prostaglandins, leukotrienes, and essential fatty acids 1989;36:1-7.  3. Fijnheer R, Pietersz RN, de Korte D, et al. Platelet activation during preparation of platelet concentrates: a comparison of the platelet-rich plasma and the buffy coat methods. Transfusion 1990;30:634-638.  4. Marx RE. Platelet-rich plasma: evidence to support its use. Journal of oral and maxillofacial surgery : official journal of the American Association of Oral and Maxillofacial Surgeons 2004;62:489-496.  5. Toffler M. Guided bone regeneration (GBR) using cortical bone pins in combination with leukocyte-and platelet-rich fibrin (L-PRF). Compendium of continuing education in dentistry (Jamesburg, NJ : 1995) 2014;35:192-198.  6. Lekovic V, Milinkovic I, Aleksic Z, et al. Platelet‐rich fibrin and bovine porous bone mineral vs. platelet‐rich fibrin in the treatment of intrabony periodontal defects. Journal of periodontal research 2012;47:409-417.  7. Shivashankar VY, Johns DA, Vidyanath S, Sam G. Combination of platelet rich fibrin, hydroxyapatite and PRF membrane in the management of large inflammatory periapical lesion. Journal of Conservative Dentistry 2013;16:261-4.  8. Hoaglin DR, Lines GK. Prevention of localized osteitis in mandibular third-molar sites using platelet-rich fibrin. International journal of dentistry 2013;2013:875380.  9. Aroca S, Keglevich T, Barbieri B, Gera I, Etienne D. Clinical evaluation of a modified coronally advanced flap alone or in combination with a platelet-rich fibrin membrane for the treatment of adjacent multiple gingival recessions: a 6-month study. Journal of periodontology 2009;80:244-252.  10. Padma R, Shilpa A, Kumar PA, Nagasri M, Kumar C, Sreedhar A. A split mouth randomized controlled study to evaluate the adjunctive effect of platelet-rich fibrin to coronally advanced flap in Miller's class-I and II recession defects. Journal of Indian Society of Periodontology 2013;17:631-636. 49
  • 50. REFERENCES  11. Agarwal SK, Jhingran R, Bains VK, Srivastava R, Madan R, Rizvi I. Patient-centered evaluation of microsurgical management of gingival recession using coronally advanced flap with platelet-rich fibrin or amnion membrane: A comparative analysis. European journal of dentistry 2016;10:121-133.  12. Agarwal A, Gupta ND, Jain A. Platelet rich fibrin combined with decalcified freeze-dried bone allograft for the treatment of human intrabony periodontal defects: a randomized split mouth clinical trail. Acta odontologica Scandinavica 2016;74:36-43.  13. Elgendy EA, Abo Shady TE. Clinical and radiographic evaluation of nanocrystalline hydroxyapatite with or without platelet-rich fibrin membrane in the treatment of periodontal intrabony defects. Journal of Indian Society of Periodontology 2015;19:61-65.  14. Medina-Porqueres I, Alvarez-Juarez P. The Efficacy of Platelet-Rich Plasma Injection in the Management of Hip Osteoarthritis: A Systematic Review Protocol. Musculoskeletal care 2016 Jun;14(2):121-5.  15. Salamanna F, Veronesi F, Maglio M, Della Bella E. New and emerging strategies in platelet-rich plasma application in musculoskeletal regenerative procedures: general overview on still open questions and outlook. BioMed Research International. 2015;2015:846045.  16. Albanese A, Licata ME, Polizzi B, Campisi G. Platelet-rich plasma (PRP) in dental and oral surgery: from the wound healing to bone regeneration. Immunity & ageing : I & A 2013;10:23.  17. Panda S, Doraiswamy J, Malaiappan S, Varghese SS, Del Fabbro M. Additive effect of autologous platelet concentrates in treatment of intrabony defects: a systematic review and meta-analysis. Journal of investigative and clinical dentistry 2014.  18. Peerbooms JC, van Laar W, Faber F, Schuller HM, van der Hoeven H, Gosens T. Use of platelet rich plasma to treat plantar fasciitis: design of a multi centre randomized controlled trial. BMC Musculoskeletal Disorders 2010;11:69-69.  19. Kobayashi E, Fluckiger L, Fujioka-Kobayashi M, et al. Comparative release of growth factors from PRP, PRF, and advanced-PRF. Clinical oral investigations 2016.Jan 25. [Epub ahead of print]  20. Lekovic V, Milinkovic I, Aleksic Z, et al. Platelet-rich fibrin and bovine porous bone mineral vs. platelet-rich fibrin in the treatment of intrabony periodontal defects. Journal of periodontal research 2012;47:409-417. 50
  • 51. REFERENCES  21. Panda S, Jayakumar ND, Sankari M, Varghese SS, Kumar DS. Platelet rich fibrin and xenograft in treatment of intrabony defect. Contemporary clinical dentistry 2014;5:550-554.  22. Pradeep AR, Rao NS, Agarwal E, Bajaj P, Kumari M, Naik SB. Comparative evaluation of autologous platelet-rich fibrin and platelet-rich plasma in the treatment of 3-wall intrabony defects in chronic periodontitis: a randomized controlled clinical trial. Journal of periodontology 2012;83:1499-1507.  23. Sharma A, Pradeep AR. Treatment of 3-wall intrabony defects in patients with chronic periodontitis with autologous platelet-rich fibrin: a randomized controlled clinical trial. Journal of periodontology 2011;82:1705-1712.  24. Kumar RV, Shubhashini N. Platelet rich fibrin: a new paradigm in periodontal regeneration. Cell and tissue banking 2013;14:453-463.  25. Bielecki T, Dohan Ehrenfest DM, Everts PA, Wiczkowski A. The role of leukocytes from L-PRP/L-PRF in wound healing and immune defense: new perspectives. Current pharmaceutical biotechnology 2012;13:1153-1162.  26. Martin P. Wound healing--aiming for perfect skin regeneration. Science 1997;276:75-81.  27. Barrick B, Campbell EJ, Owen CA. Leukocyte proteinases in wound healing: roles in physiologic and pathologic processes. Wound Repair and Regeneration 1999;7:410-422.  28. Ghanaati S, Booms P, Orlowska A, et al. Advanced platelet-rich fibrin: a new concept for cell-based tissue engineering by means of inflammatory cells. The Journal of oral implantology 2014;40:679-689.  29. Fujioka-Kobayashi M, Sawada K, Kobayashi E, Schaller B, Zhang Y, Miron RJ. Osteogenic potential of rhBMP9 combined with a bovine-derived natural bone mineral scaffold compared to rhBMP2. Clinical oral implants research 2016.  30. Sinder BP, Pettit AR, McCauley LK. Macrophages: Their Emerging Roles in Bone. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 2015;30:2140-2149. 51
  • 52. REFERENCES  31. Chang MK, Raggatt LJ, Alexander KA, et al. Osteal tissue macrophages are intercalated throughout human and mouse bone lining tissues and regulate osteoblast function in vitro and in vivo. Journal of immunology (Baltimore, Md : 1950) 2008;181:1232-1244.  32. Miron RJ, Bosshardt DD. OsteoMacs: Key players around bone biomaterials. Biomaterials 2016;82:1-19.  33. Ramilo O, Allman W, Chung W, et al. Gene expression patterns in blood leukocytes discriminate patients with acute infections. Blood 2007;109:2066- 2077.  34. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature reviews immunology 2008;8:958-969.  35. Dohan DM, Choukroun J, Diss A, et al. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part II: platelet-related biologic features. Oral surgery, oral medicine, oral pathology, oral radiology, and endodontics 2006;101:e45-50.  36. Ohshima M, Yamaguchi Y, Matsumoto N, et al. TGF-beta signaling in gingival fibroblast-epithelial interaction. Journal of dental research 2010;89:1315- 1321.  37. Ohshima M, Yamaguchi Y, Ambe K, et al. Fibroblast VEGF-receptor 1 expression as molecular target in periodontitis. Journal of clinical periodontology 2016;43:128-137.  38. Chattopadhyay S, Raines RT. Review collagen‐based biomaterials for wound healing. Biopolymers 2014;101:821-833. 52

Editor's Notes

  1. MTS Cell Proliferation Assay Kit is a colorimetric method for sensitive quantification of viable cells in proliferation and cytotoxicity assay. The method is based on the reduction of MTS tetrazolium compound by viable cells to generate a colored formazan product that is soluble in cell culture media. This conversion is thought to be carried out by NAD(P)H-dependent dehydrogenase enzymes in metabolically active cells. The formazan dye produced by viable cells can be quantified by measuring the absorbance at 490-500 nm. The assay can be used for the measurement of cell proliferation in response to growth factors, cytokines, mitogens, and nutrients, etc. It can also be used for the analysis of cytotoxic compounds like anticancer drugs and many other toxic agents and pharmaceutical compounds.